TẠO DÒNG VÀ BIỂU HIỆN GEN MÃ HÓA CHO PROTEIN VỎ VP19, VP26 CỦA VIRUS GÂY BỆNH ĐỐM TRẮNG (WSSV) TRÊN TÔM SÚ (Penaeus monodon) BẰNG HỆ THỐNG TẾ BÀO VI KHUẨN E.coli

59 8 0
  • Loading ...
1/59 trang

Thông tin tài liệu

Ngày đăng: 27/02/2019, 12:07

BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỐ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHĨA LUẬN TỐT NGHIỆP TẠO DỊNG VÀ BIỂU HIỆN GEN MÃ HÓA CHO PROTEIN VỎ VP19, VP26 CỦA VIRUS GÂY BỆNH ĐỐM TRẮNG (WSSV) TRÊN TÔM SÚ (Penaeus monodon) BẰNG HỆ THỐNG TẾ BÀO VI KHUẨN E.coli Ngành học: CÔNG NGHỆ SINH HỌC Sinh viên thực hiện: HAM MÁT Niên khóa: 2006 - 2010 Tháng 07 năm 2010 BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỐ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHĨA LUẬN TỐT NGHIỆP TẠO DỊNG VÀ BIỂU HIỆN GEN MÃ HÓA CHO PROTEIN VỎ VP19, VP26 CỦA VIRUS GÂY BỆNH ĐỐM TRẮNG (WSSV) TRÊN TÔM SÚ (Penaeus monodon) BẰNG HỆ THỐNG TẾ BÀO VI KHUẨN E.coli Hướng dẫn khoa học: Sinh viên thực hiện: ThS LÂM VỸ NGUYÊN HAM MÁT ThS NGUYỄN VŨ PHONG Tháng 07 năm 2010 LỜI CẢM ƠN Chân thành cảm ơn: • Ban Giám hiệu trường Đại Học Nông Lâm Thành Phố Hồ Chí Minh • Ban Chủ Nhiệm Bộ Mơn Cơng Nghệ Sinh Học • Ban Giám Đốc Trung tâm Cơng Nghệ Sinh Học Thành Phố Hồ Chí Minh • Các anh chị cơng tác phòng Cơng Nghệ Sinh Học Thủy Sản phòng Cơng Nghệ Sinh Học Y Dược Trung tâm Cơng Nghệ Sinh Học Thành Phố Hồ Chí Minh Đặc biệt em xin chân thành cảm ơn sâu sắc đến: • ThS Lâm Vỹ Ngun tận tình dạy bảo, hướng dẫn em thực hiên đề tài • ThS Trần Vân Anh, ThS Trần Hạnh Triết…đã giúp đỡ truyền đạt cho em kinh nghiệm quý báu suốt trình em thực đề tài • ThS Nguyễn Vũ Phong công tác Bộ Môn Công Nghệ Sinh Học trường Đại Học Nông Lâm Thành Phố Hồ Chí Minh • Xin chân thành cảm ơn bạn ngồi lớp giúp đỡ tơi nhiều suốt q trình thực khóa luận • Con xin gởi lòng biết ơn sâu sắc đến bố mẹ sinh thành, nuôi dưỡng, dạy dỗ bên thời điểm Sinh viên HAM MÁT i TĨM TẮT Ngành ni tơm Việt Nam phải đối mặt với dịch bệnh tôm, loại bệnh virus, virus gây bệnh đốm trắng làm tôm chết sau – ngày bị nhiễm bệnh gây tổn thất nặng nề cho người nuôi trồng cho kinh tế.Việc chẩn đốn nhanh bệnh virus tơm đưa thị trường kit test nhanh giấy thử (phương pháp miễn dịch học: kháng nguyên – kháng thể) cần thiết Nghiên cứu thực dựa tạo dòng gen vp19 gen vp 26, sau thơng qua biểu protein hai gen mã hóa để bước đầu tạo kháng nguyên kháng thể đa dòng chống lại virus WSSV gây nguy hiểm tôm sú Việt Nam nhằm thử nghiệm khả sử dụng kháng thể vào nghiên cứu nghiên cứu ứng dụng virus tôm nhằm sản xuất kit kiểm tra diện virus tôm với giá thành rẻ Mặt khác, sử dụng kháng thể cho nghiên cứu chuyên sâu virus tôm sau Những kết đạt được: thu thập mẫu tơm nhiễm bệnh WSSV từ tạo dòng thành cơng dòng gen vp19 vp26 Tiến hành biến nạp gen vào vi khuẩn E.coli BL21 DE3 cuối chúng tơi biểu protein VP19, VP26 hàm lượng chưa cao ii SUMMARY “CLONING AND EXPRESSION THE ENVELOPE PROTEINS VP19 AND VP26 OF THE WHITE SPOT SYNDROME VIRUS (WSSV) INFECTED IN SHRIMP (Penaeus monodon) USING THE E.coli SYSTEM” Shrimp culture industry in Vietnam is facing shrimp epidemic diseases, especially viral diseases, cause severe loss for farmer, as well as for the economics, typically shrimps infected with WSSV died after – days after that Quick diagnosis of viral diseases on shrimps is one of the issues that shrimp culturing centers especially pay attention to However, in Vietnam, there are just some detection kits by PCR and one kind of kit based on immunology used for white spot virus detection Performing PCR tests needs appropriate equipments and some knowledge of molecular biology, and just can only be done in provincial laboratories Bringing out to the market kits for quick test using test strip (immunology method: antigen – antibody) or ELISA kit (Enzyme Linked Immunosorbent Assay) is not only the dream of shrimp producers but also the dream of detection kit manufacturers This study perform cloning and expression the envelope proteins vp19 and vp26 of the white spot syndrome virus (wssv) as the first step to initially create an ELISA kit for quick detection of dangerous viral diseases on shrimp (White Spot Syndrome) in Vietnam in order to test the capacity of applying these antibodies into basic research as well as applied research on shrimp virus and to produce virus detection kits for shrimps with cheap price On the other hand, we can also use these antibodies for further study of virus on shrimps Results: Successfully cloning vp19 and vp26, transformed these genes into E.coli BL21 DE3 and over-expressed protein VP19, VP26, although the concentration of these protein is low iii MỤC LỤC Nội dung trang Lời cảm ơn i Tóm tắt ii Summary iii Mục lục iv Danh sách chữ viết tắt vii Danh sách bảng viii Danh sách hình ix Chương Mở đầu 1.1 Đặt vấn đề 1.2 Mục tiêu đề tài 1.3 Nội dung thực Chương Tổng quan tài liệu 2.1 Tình hình sản xuất tơm nước 2.2 Các bệnh thường gặp tôm 2.2.1 Cơ chế lây nhiễm chung virus 2.2.2 Một số loại virus gây bệnh tôm 2.3 Đặc điểm sinh học WSSV 2.3.1 Hình thái cấu trúc 2.3.2 DNA gen 11 2.3.3 Protein cấu trúc 12 2.4 Protein VP19 12 2.5 Protein VP26 12 2.6 Một số phương pháp phát bệnh WSSV 13 2.6.1 phương pháp chẩn đốn mơ học 13 2.6.2 Các phương pháp lai 14 iv 2.6.3 phương pháp PCR 14 2.6.4 Phương pháp miễn dịch 15 2.7 Sự tạo dòng 15 2.8 Kỹ thuật điện di 17 2.9 Plasmid 19 2.9.1 Plasmid pET30a+ 20 2.9.2 Hệ thống T7 21 2.10 Sự biến nạp vi khuẩn E.coli 21 2.11 Chọn lọc vi khuẩn biến nạp 22 2.12 Giải trình tự 22 Chương Vật liệu phương pháp nghiên cứu 24 3.1 Thời gian địa điểm thực đề tài 24 3.2 Vật liệu 24 3.3 Dụng cụ hóa chất 24 3.3.1 Dụng cụ 24 3.3.2 Hóa chất 24 3.3.3 Các dung dịch 25 3.4 Phương pháp nghiên cứu 25 3.4.1 Thu thập mẫu virus 25 3.4.2 Quy trình tạo dòng đoạn gen mục tiêu 25 3.4.2.1 Tạo dòng đoạn gen mục tiêu 26 3.4.2.2 Biến nạp gene mục tiêu vào E.coli DH5 α 27 3.4.2.3 Kiểm tra kết biến nạp PCR khuẩn lạc 28 3.4.2.4 Kiểm tra kết biến nạp cắt enzyme giải trình tự 30 3.4.2.5 Chuyển gene mục tiêu vào pET30a+ biến nạp vào E.coli BL21 DE3 33 3.4.2.6 Cảm ứng biểu gene mục tiêu 35 Chương Kết thảo luận 37 4.1 Thu thập mẫu tôm bệnh 37 4.2 Tạo dòng gen mã hóa cho protein vỏ VP19, VP26 WSSV 37 v 4.2.1 Gen mục tiêu 38 4.2.2 Thiết kế mồi khuếch đại gen mục tiêu 38 4.2.3 Tạo dòng gen mục tiêu vào vector pGEMT Easy 39 4.3 Tạo dòng gen mục tiêu vào vector biểu pET30a+ 41 4.4 Biểu gen mục tiêu 43 Chương Kết luận đề nghi 46 5.1 Kết luận 46 5.2 Đề nghị 46 TÀI LIỆU THAM KHẢO 47 vi DANH SÁCH CÁC CHỮ VIẾT TẮT Amp Ampicillin Bp base pair BLAST Basic Local Alignment Search Tool CBB Coomassie brilliant blue dNTP deoxynucleoside triphosphate ELISA Enzyme linked immunosorbent assay E.coli Escherichia coli EtBr ethidium bromide EDTA ethylen diamine tetraacetic acid G gram HPV Hepatopancreatic parvovirus IHHNV Infectious Hypodermal And Hematopoietic Necrosis Virus IPTG Isopropyl β-D-1-thiogalactopyranoside Kb .kilobase Μl microlitre Ml millilitre mM millimolar M molar MBV Monodon Baculovirus NCBI National Center of Biotechnology Information PAGE Polyacrymide gel elestrophoresis SDS Sodium dodecylsulfate TSV .Taura Syndrome Virus TAE Tris-Acetate-EDTA WSSV White Spot Syndrome Virus YHV Yellow Head Virus vii DANH SÁCH CÁC BẢNG Bảng 2.1 Sự phân tách DNA gel acrylamine 18 Bảng 2.2 Sự phân tách đoạn DNA gel agrose 18 Bảng 3.1 Thành phần PCR xác định nhiệt độ tối ưu cho cặp mồi 26 Bảng 3.2 Chu trình PCR xác định nhiệt độ tối ưu cặp mồi 27 Bảng 3.3 Thành phần phản ứng nối 28 Bảng 3.4 Thành phần phản ứng PCR khuẩn lạc kiểm tra kết biến nạp 29 Bảng 3.5 Chu trình phản ứng PCR khuẩn lạc kiểm tra kết biến nạp 30 Bảng 3.6 Thành phần phản ứng cắt enzyme cắt hạn chế 32 Bảng 3.7 Thành phần phản ứng nối enzyme T4 ligase 35 Bảng 4.1 Trình tự cặp mồi gen vp19 vp26 38 viii Các đoạn chèn sau tinh từ gel chèn vào plasmid biểu pET30a+ biến nạp vào tế bào E.coli BL21 DE3 Quy trình tiến hành sau: Thu nhận plasmid pET30a+ từ chủng E.coli có chứa plamid pET30a+ kit Miniprep hãng Qiagen (Mỹ) Cắt plasmid pET30a+ enzyme BamHI HindIII để tạo dạng mạch thẳng, đầu dính Loại bỏ đoạn cắt nhỏ kit QIAquick PCR Purification hãng Qiagen, Mỹ Quy trình sau: - Để tinh V thể tích sản phẩm cắt, thêm vào 5V thể tích dung dịch buffer PBI - Trộn cho dung dịch có màu vàng (màu buffer PBI) Nếu dung dịch có màu cam tím cho thêm 10µl Sodium acetate 3M, pH = dung dịch có màu vàng - Chuyển hổn hợp vào cột ml, ly tâm 13.000 vòng/phút 30 - 60 giây Đổ bỏ dịch - Thêm 0,75 ml buffer PE, 13.000 vòng/phút 30 - 60 giây Đổ bỏ dịch Ly tâm tiếp 13.000 vòng/phút 60 s để loại bỏ hoàn toàn buffer - Chuyển cột sang effendorf 1,5 ml Thêm 50 μl buffer EB (Tris-Cl 10 mM, pH 8,5) nước vào cột Ly tâm 13.000 vòng/phút 60 giây Để tăng lượng DNA thu được, bổ sung thêm 30 µl vào cột, để n phút sau ly tâm 13.000 vòng/phút 60 giây Nối đoạn gene tinh từ gel plasmid pET30a+ cắt enzyme BamHI HindIII enzyme T4 ligase Thành phần phản ứng nối thể bảng 3.5 34 Bảng 3.7 Thành phần phản ứng nối Thành phần T4 ligation buffer 10X 10U T4 ligase (150U/μl) Thể tích μl 0,67 μl Sản phẩm tinh μl pET30a+ cắt μl Nước vơ trùng 4.33 μl Tổng thể tích 10 μl Sau ủ hỗn hợp phản ứng 16oC qua đêm Biến nạp sản phẩm nối vào tế bào E.coli BL21 DE3 Quy trình thực tượng tự quy trình biến nạp vào tế bào E.coli DH5α Tế bào sau biến nạp trải dĩa LB có Kan 50 μg/ml Ủ qua đêm nhiệt độ 37oC Quy trình kiểm tra kết biến nạp vào tế bào E.coli BL21 DE3 PCR khuẩn lạc cắt enzyme tương tự quy trình kiểm tra tế bào E.coli DH5α 3.4.2.6 Cảm ứng biểu gene mục tiêu Quá trình biểu protein tái tổ hợp cảm ứng IPTG (Isopropyl-β-Dthiogalactoside) Plasmid biểu pET30a+ điều khiển promotor T7 Với cảm ứng IPTG (Isopropyl-β-D-thiogalactoside), promotor kích hoạt biểu protein dung hợp Sản phẩm protein dung hợp tạo bao gồm protein mục tiêu liên kết peptide với His-tag Quy trình cảm ứng biểu thực sau: 35 Hai chủng E.coli BL21 DE3 chứa gene biến nạp (pET30a+::vp19, pET30a+::vp26) tăng sinh 37oC, 250 vòng/phút qua đêm ml LB có bổ sung 50 µg/ml Kan Cấy chuyển ml dịch cấy qua đêm vào erlen lít chứa 200 ml LB có bổ sung 50 µg/ml Kan Ni cấy lắc 37oC, 250 vòng/phút đến đạt OD600 = 0,6 - 0,8 Lấy 10 ml dịch nuôi cấy, ly tâm 4.000 vòng/phút ph Đổ bỏ dịch nổi, hòa tan cặn ml PBS 1X Ly tâm 4.000 vòng/phút phút Đổ bỏ dịch Hòa tan cặn ml Lysis buffer (Tris-HCl M, EDTA 40 mM, Triton-X 1%, PMSF mM, NaCl 150 mM ) Bổ sung IPTG đạt mM, ủ 37oC, 250 vòng/phút Sau h, lấy 100 ml dịch cấy ly tâm 4.000 vòng/phút ph, đổ bỏ dịch nổi, hòa tan cặn 20 ml PBS 1X Ly tâm 4.000 vòng/phút/1ph Đổ bỏ dịch Hòa tan cặn 20 ml Lysis buffer (Tris-HCl M, EDTA 40 mM, Triton-X 1%, PMSF mM, NaCl 150 mM ) Phá mẫu máy Sonicator Chu kỳ 10 s chạy, 10 s nghỉ, tổng thời gian chạy 15 phút Trong trình phá mẫu, mẫu để đá Ly tâm 10.000 vòng/phút 10 phút, thu dịch cặn để tiến hành kiểm tra diện khả hòa tan protein tái tổ hợp SDS-PAGE 36 Chương KẾT QUẢ VÀ THẢO LUẬN 4.1 Thu thập mẫu tôm bệnh Mẫu tôm mang triệu chứng đặc trưng bệnh Đốm trắng thu nhận Các mẫu tơm ly trích DNA kiểm tra diện WSSV kit Trung tâm Công nghệ Sinh học TP.HCM -1 10 -2 10 Test mẫu WSSV 10-1 10-2 M Hình 4.1 Kết kiểm tra diện WSSV dịch ly trích nồng độ pha lỗng khác PCR Sự xuất band 250 bp hình 4.1 cho thấy diện WSSV dịch ly trích thu nhận Dựa vào độ sáng (nồng độ DNA) band, xác định khả ức chế hoạt động Taq polymera dịch ly trích Chúng tơi chọn nồng độ pha lỗng dịch ly trích DNA 10-1 để thực tiếp tục thí nghiệm sau 4.2 Tạo dòng gen mã hóa cho protein vỏ VP19, VP26 WSSV tế bào E.coli DH5α 37 4.2.1 Gen mục tiêu Các gen mục tiêu chọn vp19 (365 bp), vp26 (615 bp) 4.2.2 Thiết kế mồi khuếch đại gen mục tiêu Dựa trình tự cơng bố NCBI, thiết kế cặp mồi đặc hiệu cho WSSV (các gen vp19, vp26), TSV Các đoạn mồi xuôi chèn thêm vị trí cắt enzyme BamHI đầu 5’ mồi ngược chèn thêm vị trí cắt enzyme HindIII đầu 5’ Đã thiết kế cặp mồi sau: Bảng 4.1 Trình tự cặp mồi gen vp19 vp26 Tên primer Trình tự 5’Ỉ 3’ Nhiệt độ bắt cặp VP26-FP ATGGAATTTGGCAACCTAACAAACC 62.6oC VP26-RP TTACTTCTTCTTGATTTCGTCCTTGATATCG 60.8oC VP19-FP ATGGCCACCACGACTAACAC 63.8oC VP19-RP TTACTGCCTCCTCTTGGGG 60.7oC Mỗi cặp mồi chạy nhiệt độ bắt cặp (Ta) khác để xác định nhiệt độ tối ưu cho cặp mồi Kết thể hình 4.2 10 11 12 Hình 4.2 Kết kiểm tra cặp mồi tạo dòng cho vp19, vp26 nhiệt độ bắt cặp khác nhau: 1-vp19 54oC, 2- vp19 56oC, 3- vp19 58oC, 4-vp19 60oC, 5-vp26 54oC, 6- vp26 56oC, 7-vp26 58oC, 8-vp26 60oC, 9đối chứng âm, 10-đối chứng dương WS1, 11-đối chứng dương kit, 12- thang 38 Dựa vào xuất band 615 bp vp26 365 bp vp19 với độ sáng chúng hình 4.2, chúng tơi chọn nhiệt độ bắt cặp thích hợp cho cặp mồi : mồi đặc hiệu cho gen vp19 54oC, mồi đặc hiệu cho gen vp26 60oC 4.2.3 Tạo dòng gen mục tiêu vào vector nhân dòng pGEMT Easy Sau khuếch đại PCR, tiến hành chèn gen mục tiêu vào vector nhân dòng pGEMT KIT pGEM®-T Easy Vector Systems biến nạp vào tế bào E coli DH5α Kết biến nạp vào tế bào E coli DH5α kiểm tra PCR khuẩn lạc, enzyme cắt giải trình tự 10 11 Hình 4.3: Kết PCR khuẩn lạc kiểm tra diện gen mục tiêu vp19, vp26 tế bào E coli DH5α : 1, 2, 3, 4, - vp19 ; 6, 7, 8, 9, 10 - vp26 ; 11- thang 100bp Từ xuất band hình 4.3 cho thấy chúng tơi thu nhận đoạn chèn có kích thước phù hợp với kích thước gen mục tiêu dòng số 1, 3, 4, 6, 7, 8, 9, 10 Các khuẩn lạc sau kiểm tra PCR khuẩn lạc tách plasmid kit Miniprep hãng Qiagen (Mỹ) tiếp tục kiểm tra enzyme cắt sử dụng enzyme HindIII BamHI 39 10 Hình 4.4 Kết kiểm tra plasmid tái tổ hợp enzyme BamHI HindIII: 1, 2, - pGEMT::vp19; 4- thang 100 bp; 5, 6, 7, 8, 9- pGEMT::vp26; 10 thang 1kbp Từ xuất band kích thước 365 bp 615 bp tương ứng với kích thước vp19 vp26 hình 4.4 cho thấy chúng tơi chèn thành công đoạn gen vp19, vp26 vào plasmid nhân dòng pGEMT Easy Các plasmid sau kiểm tra enzyme cắt khẳng định giải trình tự sử dụng cặp mồi M13 đặc hiệu cho plasmid pGEMT Easy Viện Pasteur TPHCM Kết giải trình tự plasmid pGEMT ::vp19 ATGGCCACCACGACTAACACTCTTTCTTTCGGCAGGACCGGAGTCCAGGCCGCTGGCCCT TCTTACACCATGGAAGATCTTGAAGGCTCCATGTCTATGGCTCGCATGGGTCTCTTTTTG ATCGTTGCTATCTCAATTGGTATCCTCGTCCTGGCCGTCATGAATGTATGGATGGGACCA AAGAAGGACAGCGATTCTGACACTGATAAGGACACCGATGATGATGACGACACTGCCAAC GATAACGATGATGAGGACAAATATAAGAACAGGACCAGGGATATGACGCTTCTGGCTGGG TCCGCTCTTCTGTTCCTCGTTTCCGCCGCCACCGTTTTTATGTCTTACCCCAAGAGGAGG CAGTAA 40 Kết giải trình tự plasmid pGEMT ::vp26 ATGGAATTTGGCAACCTAACAAACCTGGACGTTGCAATTATTGCAATCTTGTCCATTGCA ATCATTGCTCTAATCGTTATCATGGTTATAATGATTGTATTCAACACACGTGTTGGAAGA AGCGTCGTCGCTAATTATGATCAGATGATGCGAGTCCCAATTCAAAGAAGGGCAAAGGTA ATGTCAATTCGTGGAGAGAGGTCCTACAATACTCCTCTTGGAAAGGTGGCCATGAAGAAT GGTCTCTCCGATAAGGACATGAAGGATGTTTCTGCTGATCTTGTCATCTCTACCGTCACA GCCCCAAGGACTGATCCCGCTGGCACTGGGGCCGAGAACTCTAACATGACTTTGAAGATC CTCAACAACACTGGCGTCGATCTCTTGATCAACGACATTACTGTTCGGCCAACTGTTATT GCAGGAAACATTAAGGGAAATACTATGTCGAACACTTACTTCTCGAGCAAGGACATTAAA TCTTCATCTTCAAAAATTACCCTCATTGACGTGTGCAGCAAATTTGAAGACGGCGCAGCC TTCGAAGCTACAATGAACATTGGATTCACCTCCAAGAATGTGATCGATATCAAGGACGAA ATCAAGAAGAAGTAA Kết giải trình tự kiểm tra công cụ BLAST phần mềm Clustalw cho thấy đoạn gen nhân dòng gen mục tiêu với độ xác 100% 4.3 Tạo dòng gen mục tiêu vào vector biểu pET30a+ Các vector tái tổ hợp pGEMT sau kiểm tra giải trình tự cắt đoạn chèn chèn vào vector biểu pET30a+ 41 Hình 4.5 Kết cắt plasmid tái tổ hợp enzyme BamHI HindIII: 1- thang 100 bp; 2pGEMT ::vp19 , 3-pGEMT ::vp26; 4-pGEMT ::vp26;5thang 1kbp;6- pET30a+ cắt Các đoạn chèn thu nhận tinh từ gel sử dụng kit Gel Extraction Kit hãng Qiagen (Mỹ), plasmid pET30a+ sau cắt tinh kit PCR Purification Kit hãng Qiagen (Mỹ) để loại bỏ đoạn cắt Các đoạn chèn plasmid pET30a+ sau tinh nối enzyme T4 ligase hãng Biolab (Anh) Sản phẩm nối biến nạp vào chủng E coli BL21 DE3 hóa biến nạp Kết biến nạp kiểm tra PCR khuẩn lạc sử dụng mồi clone mồi T7 đặc hiệu cho plamsid pET30a+ 10 11 12 Hình 4.6 Kiểm tra kết biến nạp vào plasmid pET30a+ sử dụng mồi clone: 1, 2, 3, 4, 5- vp19; 6- thang 100 bp; 7, 8, 9, 10, 11- vp26; 12- đối chứng âm 10 Hình 4.7 Kiểm tra kết biến nạp vào plasmid pET30a+ sử dụng mồi T7: 1, 2, 3, 4, 5- vp19;6, 7, 8- vp26; 9- đối chứng âm; 10thang 100 bp 42 Dựa vào xuất band cho thấy biến nạp thành công đoạn gen mã hóa cho protein VP19, VP26 virus WSSV vào plasmid pET30a+ biến nạp vào tế bào E.coli BL21 DE3 4.4 Biểu gen mục tiêu Dịch vi khuẩn sau cảm ứng điện di SDS-PAGE để kiểm tra diện protein tái tổ hợp Những mẫu có biểu protein tái tổ hợp phá mẫu sóng siêu âm sử dụng máy Sonicator Dịch khuẩn sau phá mẫu ly tâm để thu phần (chứa protein hòa tan) phần cặn (chứa protein hòa tan) để kiểm tra diện protein tái tổ hợp điện di SDS-PAGE Kích thước lý thuyết loại protein tái tổ hợp bao gồm kích thước lý thuyết protein kích thước His tag (2 Kda): • Protein VP19-His tag: 17 Kda • Protein VP26-His tag: 24 Kda Kết điện di thể hình 4.8, hình 4.9 KDa 97,4 66,2 45 31 21,5 14,4 Hình 4.8 Kết cảm ứng biểu protein tái tổ hợp: VP19 trước cảm ứng ; 2,3 VP26 trước cảm ứng ; 4,5 Protein ladder ; VP19 sau cảm ứng ; 7,8 VP26 sau cảm ứng Kết hình 4.8 cho thấy mẫu VP19, VP26 có diện vạch protein có kích thước phù hợp với kích thước lý thuyết 43 KDa 97,4 66,2 45 31 21,5 14,4 Hình 4.9 Kết kiểm tra khả hòa tan protein tái tổ hợp : Protein ladder ; VP19 phần cặn ; VP19 phần dịch ; VP26 phần cặn ; VP26 phần dịch Kết hình 4.9 cho thấy có xuất vạch protein phù hợp với kích thước lý thuyết Tuy nhiên, hàm lượng protein ít, không tan nằm phần cặn nên dụng để tinh Nguyên nhân làm cho protein tái tổ hợp không biểu với hàm lượng cao nằm phần cặn nhiều nguyên nhân như: • Điều kiện cảm ứng chưa tối ưu • Chủng E coli không phù hợp với hệ thống biểu pET • Protein tái tổ hợp gây độc cho tế bào E Coli • Protein biểu nhiều nên tồn dạng không tan (inclusion body) nằm phần cặn Ngay ngành kinh tế ni tơm Việt Nam phát triển virus WSSV lây nhiễm làm cho tôm chết hàng loạt gây thiệt hại nặng cho người dân nuôi tôm kinh tế chung nước 44 Chúng tơi thực đề tài tài nhằm mục đích bước đầu tạo kháng thể đa dòng kháng virus WSSV để từ tạo kit ELISA giúp chẩn đốn nhanh loại virus gây bệnh nguy hiểm tôm với giá thành rẻ Với kết mà thực nhân dòng biểu gen mã hóa cho protein VP19, VP26 Tuy hàm lượng không cao bước khởi đầu tốt q trình nghiên cứu chúng tơi 45 Chương KẾT LUẬN VÀ ĐỀ NGHỊ 5.1 Kết luận Chúng tơi thực hiên thành cơng việc nhân dòng biểu hiên gen mã hóa cho protein vỏ VP19, VP26 virus gây bệnh đốm trắng tôm sú Plasmid tái tổ hợp pET30a+::vp19 pET30a+::vp26 đươc biến nạp thành công vào tế bào khả nạp E.coli BL21 DE3 Biểu protein tái tổ hợp VP19, VP26 Tuy nhiên, hàm lượng thấp protein tồn dạng cặn (inclusion body) 5.2 Đề nghị Tối ưu hóa điều kiện biểu để thu lượng lớn protein dạng hòa tan Tinh protein tái tổ hợp Sự dụng protein tinh để gây đáp ứng miễn dịch thỏ Thu kháng thể từ huyết thỏ để tạo kit ELISA chẩn đốn bệnh đốm trắng tơm sú 46 TÀI LIỆU THAM KHẢO TIẾNG VIỆT Đỗ Thị Hòa, Bùi Quang Tề, Nguyễn Hữu Dũng Nguyễn Thị Muội, 2004 Bệnh học thủy sản Nhà xuất Nông Nghiệp http://agriviet.com/nd/990-cac-benh-thuong-gap-o-tom/ http://chongbanphagia.vn/beta/diemtin/20100104/xuat-khau-tom-viet-nam-daunam-2009-va-trien-vong-2010 http://nhanong.net/?nn=view&action=showid&id=2578&page=8 http://tintuc.xalo.vn/00543725685/tom_chua_kiem_soat_duoc_chat_luong_nuoi.ht ml http://vietlinh.com.vn/kithuat/benhthuysan/banvebanhtom.htm http://vietlinh.com.vn/kithuat/benhthuysan/banvebanhtom.htm http://www.agro.gov.vn/news/newsdetail.aspx?targetid=11965 http://www.hcmbiotech.com.vn/print.php?id=60&p=technology&f1=title_vn&f2= detail_vn 10 http://www.sggp.org.vn/kinhte/2008/9/165267/ 11 Lý Thị Thanh Loan, 2001 Nghiên cứu số bệnh thường gặp vi sinh vật gây tôm sú Viện nghiên cứu nuôi trồng thuỷ sản II 12 Nguyễn Văn Hảo, 2003 Nghiên cứu số bệnh thường gặp, yếu tố nguy biện pháp phòng trị, dự phòng vật ni thuỷ sản Viện nghiên cứu nuôi trồng thuỷ sản II TIẾNG ANH Dhar, A.K., M.M Roux, and K.R Klimpel, (2001) Detection and Quantification of Infectious Hypodermal and Hematopoietic Necrosis Virus and White Spot Virus in Shrimp Using Real-Time Quantitative PCR and SYBR Green Chemistry Journal of clinical microbiology, 39: 2835–2845 47 D.V Lightner , R.M Redman, (1998), Shrimp diseases and current diagnostic methods Aquaculture 164: 201–220 Ha, Yu-Mi, Soo-Jung Gong, Thi-Hoai Nguyen, Chae Hun Ra, Ki-Hong Kim, Yoon-Kwon Nam, and Sung-Koo Kim, (2008), Vaccination of Shrimp (Penaeus chinensis) against White Spot Syndrome Virus (WSSV), J Microbiol Biotechnol 18(5): 964–967 Kanokpan Wongprasert et al (2007), Cloning and characterization of a caspase gene from black tiger shrimp (Penaeus monodon)-infected with white spot syndrome virus (WSSV) Journal of Biotechnology, 131: 9–19 OIE, Manual diagnostic tests for aquatic animals 2003 2003 T.W Flegel (2006), Detection of major penaeid shrimp viruses in Asia, a historical perspective with emphasis on Thailand Aquaculture 258: 1–33 Trình tự WSSV: http://www.ncbi.nlm.nih.gov/nuccore/19481591 48 ... BẰNG HỆ THỐNG TẾ BÀO VI KHUẨN E.coli Hướng dẫn khoa học: Sinh viên thực hiện: ThS LÂM VỸ NGUYÊN HAM MÁT ThS NGUYỄN VŨ PHONG Tháng 07 năm 2010 LỜI CẢM ƠN Chân thành cảm ơn: • Ban Giám hiệu trường... Con xin gởi lòng biết ơn sâu sắc đến bố mẹ sinh thành, nuôi dưỡng, dạy dỗ bên thời điểm Sinh viên HAM MÁT i TĨM TẮT Ngành ni tơm Việt Nam phải đối mặt với dịch bệnh tôm, loại bệnh virus, virus gây... luận đề nghi 46 5.1 Kết luận 46 5.2 Đề nghị 46 TÀI LIỆU THAM KHẢO 47 vi DANH SÁCH CÁC CHỮ VIẾT TẮT Amp Ampicillin Bp
- Xem thêm -

Xem thêm: TẠO DÒNG VÀ BIỂU HIỆN GEN MÃ HÓA CHO PROTEIN VỎ VP19, VP26 CỦA VIRUS GÂY BỆNH ĐỐM TRẮNG (WSSV) TRÊN TÔM SÚ (Penaeus monodon) BẰNG HỆ THỐNG TẾ BÀO VI KHUẨN E.coli , TẠO DÒNG VÀ BIỂU HIỆN GEN MÃ HÓA CHO PROTEIN VỎ VP19, VP26 CỦA VIRUS GÂY BỆNH ĐỐM TRẮNG (WSSV) TRÊN TÔM SÚ (Penaeus monodon) BẰNG HỆ THỐNG TẾ BÀO VI KHUẨN E.coli

Gợi ý tài liệu liên quan cho bạn