TẠO DÒNG CASSETTE GEN ĐỘT BIẾN WZZ (Oantigen chain length determinant gene) CỦA VI KHUẨN Vibrio harveyi TRONG E.coli DH5α

73 3 0
  • Loading ...
1/73 trang

Thông tin tài liệu

Ngày đăng: 26/02/2019, 14:33

BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHĨA LUẬN TỐT NGHIỆP TẠO DỊNG CASSETTE GEN ĐỘT BIẾN WZZ (O-antigen chain length determinant gene) CỦA VI KHUẨN Vibrio harveyi TRONG E.coli DH5α Ngành học : CÔNG NGHỆ SINH HỌC Sinh viên thực :TRẦN PHẠM VŨ LINH Niên khóa :2009 - 2013 Tháng 06/2013 BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHĨA LUẬN TỐT NGHIỆP TẠO DỊNG CASSETTE GEN ĐỘT BIẾN WZZ (O-antigen chain length determinant gene) CỦA VI KHUẨN Vibrio harveyi TRONG E.coli DH5α Hướng dẫn khoa học Sinh viên thực TS NGUYỄN QUỐC BÌNH TRẦN PHẠM VŨLINH CN MAI THU THẢO Tháng 06/2013 LỜI CẢM ƠN Trước tiên,cho gởi lời cảm ơn chân thành đến Ban giám hiệu Trường Đại học Nơng Lâm Thành phố Hồ Chí Minh, quý thầy cô Bộ môn Công Nghệ Sinh Học tận tâm giảng dạy truyền đạt kiến thức cho suốt năm học đại học Tơi xin bày tỏ lòng biết sâu sắc đến thầy Nguyễn Quốc Bình đặc biệt Mai Thu Thảo, cho hội tiến hành đề tài này, dạy tận tình cho tơi nhiều học quý giá trình học tập làm khóa luận Tơi gởi lời cảm ơn chân thành đến người giúp đỡ nhiều suốt thời gian làm đề tài, cám ơn cô Ngô Huỳnh Phương Thảo,cô Biện Thị Lan Thanh, thầy Võ Khánh Hưng thầy Lâm Vỹ Nguyên Cám ơn người động viên, cỗ vũ giúp đỡ nhiều lúc gặp khó khăn Cám ơn anh chị phòng thí nghiệm Sinh Học Phân Tử, Trung tâm Cơng Nghệ Sinh Học Thành phố Hồ Chí Minh, giúp đỡ nhiều thời gian làm đề tài Tôi xin gởi lời cám ơn đến tất thành viên lớp DH09SH, dù người bận việc đề tài, động viên giúp đỡ lẫn Cám ơn người bạn mà quen Trung tâm Công Nghệ Sinh Học Thành phố Hồ Chí Minh thời gian làm đề tài Mọi người cho cảm giác ấm áp thân quen gia đình nhỏ Và cuối cùng, xin ghi nhớ công lao sinh thành dưỡng dục ba mẹ, cám ơn ba mẹ cho óc biết suy nghĩ, trái tim biết yêu thương bàn tay biết lao động khơng mệt mỏi Cám ơn gia đình nhỏ con, dõi theo bước cho bến đỗ bình yên lúc gặp áp lực thời gian làm đề tài sống Trần Phạm Vũ Linh i TÓM TẮT Thủy sản số ngành quan trọngđóng góp lớn vào kim ngạch xuất Việt Nam Tuy nhiên song hành với gia tăng kim ngạch xuất bùng phát dịch bệnh, bệnh phát sáng tơm vi khuẩn thuộc nhóm Vibrio spp gây dịch bệnh phổ biến gây chết hàng loạt Trong nhóm Vibrio spp gây bệnh Vibrio harveyi nguy hiểm gây bệnh nhiều Để hướng tới làm vaccine phòng bệnh, nhiều nghiên cứu cho thấy tính ưu việc kỹ thuật knockout gen (gen độc) dựa sở tái tổ hợp tương đồng đoạn cassette nhân tạo DNA gen hiệu Trong số gen gây độc nghiên cứu nhiều Vibrio harveyi, gen wzz điều hòa chiều dài O-antigen bề mặc tế bào vi khuẩn đối tượng knockout Do đó, mục đích nghiên cứu nhằm tạo đoạn cassette nhân tạo, thông qua kỹ thuật PCR Overlap tạo dòng đoạn cassette trên, phục vụ cho công tác nghiên cứu Trong nghiên cứu này, chủng Vibrio spp có từ phân lâp từ tơm bệnh, sàng lọc môi trường chọn lọc VHA (vibrio harveyi agar) kỹ thuật PCR với cặp mồi 16S_F/16S_R gyrB_F3/gyrB_R3, nhằm tìm chủng Vibrio harveyi hoang dại Sau đó, tiến hành PCR Overlap để tạo đoạn cassette nhân tạo PCR lần với ba cặp mồi: mồi đầu, mồi cuối gen wzz mồi đoạn kanmycin từ plasmid pKD4 PCR lần hai, nói đoạn lại với forward primers đoạn đầu reverse primers đoạn cuối Cuối cùng, tiến hành tạo dòng cassette vào vectơ đầu pJET1.2/blunt E.coli DH5α Kết quả, thu nhận hai chủng Vibrio harveyi hoang dại từ sáu chủng ban đầu Đoạn cassette nhân tạo H-K-T tạo dòng thành cơng có kích thước 2153 bp chèn vào vectơ đầu pJET1.2/blunt E.coli DH5α Qua bước sàng lọc sau tạo dòng giải trình tự, khẳng định kết đáng tin cậy ii SUMMARY Thesis “Molecular cloning of casstte wzz gene mutation (O-antigen chain lengthdeterminant gene) of Vibrio harveyi bacteria in Ecoli DH5α” Aquaculture is an important component of exports and an earner foreign exchange for our country There are many unfavourable elements influencing on commercial value of shrimps Luminous bacteria disease cause by Vibrio spp is one of the most dangerous and make serial shrimps death Vibriohaveryi is the most dangerous members of the Vibrionaceae Driving directions to vaccines made, some reports demonstrated the preeminence of knockout gene technique based on homologous recombinant between satellite cassette fragments brings us a lot of favourableness to make prophylactic vaccine On all of virulence genes is wzz which control the lenght of O antigen is gene knockout Using overlap PCR and clone this cassette to make satellite cassette provide for other researchs is this study’s pupose In thesis, the first isolating vibrio spp fromdeseased shrimps, was selected on VHA culture and used PCR technique with 16S_F/16S_R, gyrB_F3/gyrB_R3 primers for subdividing The second, Overlap PCR was used for creating cassette, first time PCR with three pair of primers: beginning fragment primers (H fragment), fragment primers (T fragment) of wzz gene primers and kanamycin primer from plasmid pKD4 Second time PCR with forward primer of the wzz gene beginning fragment and reverse primer of the wzz gene ending fragment piece to connect together Finaly, inserting these satellite cassette into blunt plasmid pJET1.2/blunt and transfer this plasmid into E.coli DH5α Results, there are of strains Vibrio spp isolated from deseased shrimps are wild types The size of H –K –T satellite cassette has been cloned successfully is 2153 bp and inserted correctly in blunt plasmid pJET1.2/blunt in E.coli DH5α Selecting methods after cloning and sequencing show that we had target satellite cassette in E.coli DH5α with pJET1.2/blunt Keywords: Vibrio harveyi, E.coli DH5α, cloning, isolate, cassette iii MỤC LỤC Trang Lời cảm ơn i Tóm tắt ii Summary iii Mục lục iv Danh sách chữ viết tắt vii Danh sách bảng viii Danh sách hình ix Chương MỞ ĐẦU 1.1 Đặt vấn đề 1.2 Mục tiêu đề tài 1.3 Nội dung thực Chương TỔNG QUAN TÀI LIỆU 2.1 Sơ lược vi khuẩn Vibrio harveyi gây bệnh phát sáng tôm 2.1.1 Đặc điểm Vibrio harveyi 2.1.2 Môi trường phân lập VHA (Vibrio harveyi agar) 2.1.3.Tình hình nghiên cứu vaccine phòng bệnh cho tơm kháng Vibrio harveyi 2.2 Sơ lược bệnh phát sáng V.harveyi gây tôm 2.2.1 Dấu hiệu bệnh tôm 2.2.1.1 Dấu hiệu bên tôm bệnh 2.2.1.2 Dấu hiệu mô học tôm bệnh 2.2.2 Điều kiện phát sinh bệnh 2.2.3 Khu vực phân bố bệnh 2.2.4 Tình hình thiệt hại bệnh Vibrio gây giới Việt Nam 2.3 Lipopolysacharide (LPS) vai trò gen wzz qua trình tổng hợp LPS 2.3.1 Cấu trúc chức LPS 2.3.2 Quá trình tổng hợp LPS vai trò gen wzz 10 2.4 Khái niệm cassette H-K-T gen đột biến wzz 12 2.5 Kỹ thuật tạo dòng gen ngoại lai 12 iv 2.5.1 Khái quát tạo dòng 12 2.5.2 Vật liệu dùng tạo dòng 14 2.5.3 Kỹ thuật dùng tạo dòng 16 Chương VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 19 3.1 Thời gian địa điểm 19 3.2 Vật liệu 19 3.2.1 Thiết bị, dụng cụ 19 3.2.2 Hóa chất 19 3.2.3 Môi trường 20 3.2.4 Vật liệu sinh học 21 3.3 Phương pháp nghiên cứu 23 3.3.1 Sàng lọc kiểm tra chủng Vibrio spp 23 3.3.1.1 Sàng lọc kiểm tra phương pháp cấy truyền môi trường 23 3.3.1.2 PCR chủng Vibrio spp với cặp mồi 16S_F/16S_R gyrB_F3/ 24 3.3.2 Tạo cassette H-K-T phương pháp PCR Overlap 25 3.3.2.1 Sơ đồ tạo cassette H-K-T phương pháp PCR Overlap 25 3.3.2.2 Thiết kế mồi 26 3.3.2.3 Phản ứng PCR lần 26 3.3.2.4 Tinh sản phẩm PCR 28 3.3.2.5 Phản ứng PCR lần hai 28 3.3.2.6 Tinh sản phẩm PCR từ gel 29 3.3.3 Tạo dòng cassette H-K-T vào vecto pJET1.2/blunt 29 3.3.3.1 Tạo tế bào khả nạp E.coli DH5α 29 3.3.3.2 Đo OD kiểm tra nồng độ DNA biến nạp 30 3.3.3.3 Phản ứng nối plasmid tái tổ hợp pJET1.2/blunt cassette H-K-T 30 3.3.3.4 Biến nạp plasmid tái tổ hợp pJET1.2/blunt::H-K-T vào E.coli DH5α 31 3.3.4 Kiểm tra sản phẩm biến nạp cassette H-K-T vào vecto pJET1.2/blunt 31 3.3.4.1 Kiểm tra PCR khuẩn lạc 32 3.3.4.2 Tách plasmid kiểm tra PCR plasmid tái tổ hợp 33 3.3.4.3 Kiễm tra plasmid pJET1.2/blunt:::H-K-T WZZ với enzyme cắt 34 3.3.4.4 Giải trình tự cassette H-K-T wzz 35 v Chương KẾT QUẢ VÀ THẢO LUẬN 36 4.1 Kết 36 4.1.1 Sàng lọc kiểm tra chủng vi khuẩn Vibrio spp 36 4.1.1.1 Cấy chuyền môi trường chọn lọc VHA (Vibrio harveyi agar) 36 4.1.1.2 PCR chủng Vibrio spp với cặp mồi 16S_R/16S_F gyrB_F/ 39 4.1.2 Tạo cassette H-K-T phương pháp PCR Overlap 41 4.1.2.1 Phản ứng PCR lần 41 4.1.2.2 Phản ứng PCR lần hai 42 4.1.2.3 Tinh sản phẩm PCR từ gel 43 4.1.3 Tạo dòng cassette H-K-T vào vecto pJET1.2/blunt 43 4.1.3.1 Đo OD kiểm tra nồng độ DNA chuẩn bị cho phản ứng nối 43 4.1.4 Kiểm tra sản phẩm biến nạp cassette H-K-T vào vecto pJET1.2/blunt 43 4.1.4.1 Kiểm tra PCR khuẩn lạc 44 4.1.4.2 Kiểm tra phương pháp PCR plasmid tái tổ hợp 45 4.1.4.3 Kiểm tra plasmid pJET1.2/blunt:::H-K-T WZZ với enzyme cắt 46 4.1.4.4 Kết giải trình tự 46 4.2 Thảo luận 59 Chương KẾT QUẢ VÀ ĐỀ NGHỊ 51 5.1 Kết luận 51 5.2 Đề nghị 51 TÀI LIỆU THAM KHẢO PHỤ LỤC vi DANH SÁCH CÁC CHỮ VIẾT TẮT ApR BHIA BL1 BL2 BL3 BL4 BL5 BLAST Bp BSA dATP dCTP dGTP DNA Dnase dNTP dTTP E coli FRT H K Kb LB LPS mRNA NCBI ` PCR T Taq TBE Rpm VH VHA UV Xg YHV WSSV Gen kháng ampicillin Brain Heart Infusion Agar Chủng vi khuẩn thứ phân lập từ Bạc Liêu Chủng vi khuẩn thứ hai phân lập từ Bạc Liêu Chủng vi khuẩn thứ ba phân lập từ Bạc Liêu Chủng vi khuẩn thứ tư phân lập từ Bạc Liêu Chủng vi khuẩn thứ năm phân lập từ Bạc Liêu Basic Local Alignment Search Tool Base pair Bovine Serum Albumin Deoxyadenosine triphosphate Deoxycytidine triphosphate Deoxyguanosine triphosphate Deoxyribonucleic acid Deoxyribonuclease Deoxynucleotide triphosphate Deoxythymidine triphosphate Escherichia coli Flippase recognition target Đoạn gen đầu, khuếch đại từ gen gây độc wzz Đoạn gen kháng kanamycin khuếch đại từ pKD4 kilobase pair Luria-Bertani Lipopolysacharide Messenger ribonucleic acid National Center for Biotechnology Information Polymerase Chain Reaction Đoạn gen cuối khuếch đại từ gen gây độcwzz Thermus aquaticus Tris/Borate/EDTA Revolutions per minute Chủng vi khuẩn xin từ Viện thủy sản II Vibrio harveyi agar Ultraviolet Li tâm trọng lực Yellow Head Virus Whitespot Syndrome Baculovirus vii DANH SÁCH CÁC BẢNG Trang Bảng 2.1 Đặc điểm sinh hóa V.harveyi Bảng 2.2 Hình thái khuẩn lạc môi trường VHA Bảng 3.1 Trình tự cặp mồi cặp mồi 16S_F/16S_R gyrB_F3/gyrB_R3 24 Bảng 3.2 Thành phần phản ứng PCR với cặp mồi 16S_F/16S_R gyrB 24 Bảng 3.3 Chu trình nhiệt cho cặp mồi 16S_F/16S_R gyrB_F3/gyrB_R3 25 Bảng 3.4 Thành phần phản ứng PCR khuếch đại đoạn H, K T 27 Bảng 3.5 Chu trình nhiệt cho cặp mồi WF1/WR1và cặp mồi WF2/WR2 27 Bảng 3.6 Chu trình nhiệt cho cặp mồi KF/RF 27 Bảng 3.7 Thành phần phản ứng PCR nối đoạn H, K T 28 Bảng 3.8 Chu trình nhiệt cho cặp mồi WF1/WR2 29 Bảng 3.9 Thành phần phản ứng nối tạo plasmid tái tổ hợp 30 Bảng 3.10 Trình tự khuếch đại cặp mồi pJET1.2 F/pJET1.2 R 32 Bảng 3.11Thành phần phản ứng PCR kiểm tra khuẩn lạc 32 Bảng 3.12 Chu trình nhiệt cho cặp mồi pJET1.2 F / pJET1.2 R 33 Bảng 3.13 Thành phần phản ứng PCR plasmid tái tổ hợp 34 Bảng 3.14 Thành phần phản ứng cắt plasmid pJET1.2/blunt:::H-K-T wzz 35 Bảng 4.1 Hình dạng khuẩn lạc chủng Vibrio spp mọc môi trường VHA 36 Bảng 4.2 Kết đo OD nồng độ đoạn H, K, T 42 Bảng 4.3 Kết đo OD cassette H-K-T dùng cho phản ứng nối 43 viii Range 2: 1505 to 1934 Score Expect Identities Gaps Strand 789 bits(427) 0.0 429/430(99%) 0/430(0%) Plus/Plus Query 1070 GGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGG 1129 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1505 GGCTGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGG 1564 Query 1130 CGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCAT 1189 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1565 CGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCAT 1624 Query 1190 CGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACC 1249 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1625 CGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACC 1684 Query 1250 GACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAA 1309 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1685 GACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAA 1744 Query 1310 AGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGAT 1369 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1745 AGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGAT 1804 Query 1370 CTCATGCTGGAGTTCTTCGCCCACCCCAGCTTCAAAAGCGCTCTGAAGTTCCTATACTTT 1429 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1805 CTCATGCTGGAGTTCTTCGCCCACCCCAGCTTCAAAAGCGCTCTGAAGTTCCTATACTTT 1864 Query 1430 CTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCATATGGACCATGGCTAA 1489 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1865 CTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCATATGGACCATGGCTAA 1924 Query 1490 TTCCCATGTC 1499 |||||||||| Sbjct 1925 TTCCCATGTC 1934 Hình 4.13 Kết BLAST trình tự đoạn gen kan (đoạn K) cassette H-K-T wzz thu sở giải trình tự trình tự đoạn gen kan (đoạn K) cassette H-K-T wzz sở lý thuyết NCBI Query trình tự đoạn gen kan(đoạn K) cassette được giải trình tự; sbjct trình tự đoạn gen kan(đoạn K) cassette theo lý thuyết Score Expect Identities Gaps Strand 462 bits(250) 3e-134 282/298(95%) 0/298(0%) Plus/Plus Query GGGACTTGATTCGTAGGGGCTTGAGTAGAATGAGTTTCGTTCATTGAATTGCCTGTCATT |||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| Sbjct 1935 GGGACTTGATTCGTAGGGGCTTGAGTAGAATGAGTTCCGTTCATTGAGTTGCCTGTCATT 60 Query 61 120 Sbjct 1995 AGAAGAAGCTCTGATCGATAAATACAATGTCGCCAGGTTCTACAGAGCGTTGCATACTGA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGAAGAAGCTCTGATCGATAAATACAATGTCGCCAGGTTCTACAGAGCGTTGCATACTGA Query 121 180 Sbjct 2055 CGCTTTCAACCGTATTACCTGTTGCGTGTTGAGTAAGATTAATGCTCTTGCGGGACGCTC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCTTTCAACCGTATTACCTGTTGCGTGTTGAGTAAGATTAATGCTCTTGCGGGACGCTC Query 181 240 Sbjct 2115 GATCCGTTAAGCCTCCAGCTAGCGCGATGGCTTTTTCAATCGTCAATCCCGGCTGGTATT |||||||||||||||| ||||| ||||||||||||||||||||| ||||||| ||||||| GATCCGTTAAGCCTCCTGCTAGTGCGATGGCTTTTTCAATCGTCTATCCCGGATGGTATT Query 241 Sbjct 2175 CGAATCCACCAGGCTTTCGGACTTCACCATTTACGTAGAAAAGGCGGAAGCTATTGAT || |||||||||||| | ||||||| ||||| ||| | |||||||||| ||||||| CGGATCCACCAGGCTGTGGGACTTCGCCATTGACGGGGGAAAGGCGGAATGTATTGAT 1994 2054 2114 2174 298 2232 Hình 4.14 Kết BLAST trình tự đoạn cuối (đoạn T) cassette H-K-T wzz thu sở giải trình tự trình tự đoạn cuối (đoạn T) cassette H-K-T wzz sở lý thuyết NCBI Query trình tự đoạn cuối (đoạn T) cassette được giải trình tự; sbjct trình tự đoạn cuối (đoạn T) cassette theo lý thuyết 48 Qua phân tích kết BLAST cho thấy: Đoạn đầu (đoạn H) đoạn cuối (đoạn T) có độ tương đồng khơng cao so với trình tự lý thuyết Đoạn đầu tương đồng 97%, đoạn cuối tương đồng 95% Kết phần tín hiệu giải trình tự chưa ổn định,việc giải trình tự diễn chiểu để kiểm tra, phần lỗi trình khuếch đại gen tạo dòng Độ tương đồng hai vùng gen đầu cuối cassette chưa cao không hưởng nhiều đến độ tin cậy cassette, yêu cầu vùng tiếp hợp có độ tương đồng mức 95% - 99% trình trao đổi đoạn gen xảy Tuy nhiên vùng gen kan có độ tương đồng đến 99% (phụ lục hình 8), thêm vào khuẩn lạc chứa plasmid tái tổ hợp pJET1.2/blunt:::H-K-T wzz mọc môi trường chứa kháng sinh kanamycin, cho thấygen kan Overlap với hai trình tự đầu cuối gen wzz biểu tính trạng dấu hiệu chọn lọc cho trình sàn lọc knockout gen sau tiếp hợp tiến hành nghiên cứu 4.2 Thảo luận Mục tiêu chủ yếu nghiên cứu tạo thàng cơng cassette H-K-T wzz cloning giữ dòng, phục vụ cho nghiên cứu sau Để đảm bảo tính xác đáng tin cậy kết quả, tiến hành sàng lọc chủng Vibrio spp thực nghiệm có Qua kết sàng lọc môi trường chọn lọc VHA (vibrio harveyi agar) PCR cặp mồi đặc hiệu cho thấy, có chủng BL1 VH Vibrio harveyi Chúng tiến hành sử dụng chủng BL1 làm vật liệu cho bước nghiên cứu Bước PCR Overlap đoạn gen cassette lại với Do PCR Overlap chưa nghiên cứu nhiều Việt Nam, nên khó khăn để tiến hành thành cơng phản ứng Qua nhiều lần thử nghiệm protocol khác nhau, chúng tơi tìm protocol tối ưu cho việc PCR Overlap với nồng độ đoạn nối bổ sung 0,1pmol/phản ứng kiểm chứng qua nhiều lần phản ứng thành công liên tiếp, kết hoàn toàn phù hợp với nghiên cứu Nelson Fitch, ghi lại sách “Molecular Methods for Evolutionary Genetics” nhà xuất Springer xuất năm 2011 Cassette thu nhạy cảm, dễ bị đứt gãy không bảo quản tốt, sản phẩm PCR phải tinh cất giữ điều kiện -800C sau vừa PCR xong Bước khó khăn q trình làm xác định 49 lượng mẫu đoạn gen cho vào phản ứng PCR, việc cho không tỷ lệ, thường dẫn đến phản ứng thất bại, hay có thành cơng xuất nhiều băng phụ, khiến cho việc tinh sản phẩm PCR không hiệu Chúng tơi tiến hành tạo dòng cassette thu “Thermo Scientific CloneJET PCR Cloning Kit(iNtRON, Japan)” Đây kít cloning vector đầu Hiệu suất hiệu cloning cao, điều kiểm chứng thơng qua bước sàng lọc sau tạo dòng, tất khuẩn lạc cho kết tốt Để tối ưu hóa quy trình, chúng tơi tiến hành phản ứng như: - Tạp nhiễm DNA ngoại lai: tiến hành PCR với chứng âm (hỗn hợp phản ứng PCR không bổ sung DNA), hay chứng dương (cassette H-K-T aroA, DNA khuẩn lạc Virio harveyi) - Kiểm tra độ đặc hiệu primer: thay đổi quy trình nhiệt (tăng thời gian bắt cặp, giảm thời gian kéo dài) - Tối ưu hóa quy trình tạo dòng: tạo dòng với nồng độ DNA đích khác nhau, kéo dài thời gian nối Tóm lại, nghiên cứu thành cơng việc tạo dòng cassette H-K-T wzz tạo tiền đề cho bước knockout gen Trong giới hạn thời gian kinh phí đề tài, khơng cho phép tiếp tục tiến hành bước nghiên cứu knockout gen Nếu bước knockout gen thành cơng, kết vô tuyệt vời cho việc tạo vaccine nhược độc, phục vụ cho cơng tác phòng bệnh tình hình diễn biến dịch bệnh thủy sản phức tạp 50 Chương KẾT LUẬN VÀ ĐỀ NGHỊ 5.1 Kết luận Từ kết nghiên cứu, rút kết luận sau: Sàng lọc kiểm tra thành công chủng Vibrio spp có sẵn Tìm protocol tối ưu cho phản ứng PCR Overlap Tiến hành PCR Overlap thành công đoạn gen wzz tạo casstte H-K-T wzz Tạo dòng thành công cassette H-K-T wzz vào E.coli DH5α 5.2 Đề nghị Tiến hành knockout gen wzzở Vibrio harveyi tạo chủng nhược độc, có tìm làm vaccine phòng bệnh tơm Thử nghiệm độc lực để kiểm tra hiệu trình knockout gen 51 TÀI LIỆU THAM KHẢO Tài liệu tiếng Việt Hồ Huỳnh Thùy Dương 2002 Sinh học phân tử Nhà xuất Giáo dục, 180196 Trịnh Đình Đạt 2010 Cơng nghệ sinh học - Tập - Công nghệ di truyền Nhà xuất Giáo dục Nguyễn Như Hiền 2007 Công nghệ sinh học - Tập - Sinh học phân tử tế bào - Cơ sở khoa học công nghệ sinh học Nhà xuất Giáo dục Nguyễn Văn Hảo 2010 Nghiên cứu bước đầu đặc điểm sinh học cá trê Phú Quốc Khóa luận tố nghiệp Kỹ sư Thủy sản, trường Đại học Nơng Lâm Tp Hồ Chí Minh Đỗ Thị Hòa, Võ Khả Tâm Trần Thị Lan Hương 2001 Nghiên cứu bệnh đỏ mang tôm mẹ bệnh đục thân, bệnh phát sáng ấu trùng tôm sú Báo cáo đề tài nghiên cứu khoa học, Viện Nghiên cứu Nuôi trồng Thủy sản 2, Tp Hồ Chí Minh Võ Tấn Hùng 2011 Tạo dòng biểu gen ORF6 virus gây hội chúng rối loạn sinh sản hơ hấp lợn (PRRSV) Khóa luận tốt nghiệp Kỹ sư Công Nghệ Sinh Học, trường Đại học Nơng Lâm Tp Hồ Chí Minh Lý Thị Loan 1991 Các bệnh thường gặp Thủy sản ni trồng Đồng Bằng Sơng Cửu Long, Giáo trình hướng dẫn ôn tập thi tuyển công chức, Ngạch nghiên cứu viên nuôi trồng thủy sản (Viện nghiên cứu nuôi trồng thủy sản 2), Bộ Thủy sản, Tp.Hồ Chí Minh, 197-228 Nguyễn Hồng Lộc 2007 Giáo trình Cơng nghệ DNA tái tổ hợp Nhà xuất Đại học Quốc gia Tp Hồ Chí Minh Nguyễn Đình Nghi 2005 Đánh giá hiệu tác dụng vài hợp chất tự nhiên chiết xuất từ thảo mộc điều trị bệnh phát sáng Vibrio harveyi tôm sú (Penaeus monodon) Khóa luận tốt nghiệp Kỹ sư Cơng Nghệ Sinh Học, trường Đại học Nơng Lâm Tp.Hồ Chí Minh 10 Trần Thị Thanh Thanh 2010 Tạo chủng vi khuẩn Edwardsiella ictaluri đột biến phương pháp knockout gen wzz (O-antigen chain length determinant gene) Luận văn thạc sĩ Sinh học, trường Đại học Khoa Học Tự Nhiên 11 Mai Thu Thảo 2011 Đề cương “Tạo dòng Vibrio harveyi nhược độc chứa DNA vector mang gen mã hóa protein vỏ VP28 virus gây bệnh đốm trắng, có tiềm ứng dụng làm vaccine ngừa bệnh đốm trắng tôm sú” Trung tâm Cơng Nghệ Sinh Tp Hồ Chí Minh 12 Nguyễn Thị Ngọc Tĩnh, Hoàng Thanh Lịch, Nguyễn Văn Vũ Nguyễn Thảo Sương 2010 Kết thử nghiệm số hỗn hợp vi khuẩn phân hủy quorum sensing quy mô poliot Trung tâm nghiên cứu nuôi trồng thủy sản 52 Tài liệu tiếng Anh 13 Bengoechea, Pinta E., Salminen T., Oertelt C., Holst O., Radziejewska-Lebrecht J., Piotrowska-Seget Z., Venho R and Skurnik M 2000 Functional Characterization of Gne (UDP-N-Acetylglucosamine- 4-Epimerase), Wzz (Chain Length Determinant), and Wzy (O-AntigenPolymerase) of Yersinia enterocolitica Serotype O:8.Journal of Bacteriology,184: 4277-4287 14 Burrows L L., Chow D and Lam J S 1997 Pseudomonas aeruginosa BVạch OAntigen Chain Length Is Modulated by Wzz (Rol) Journal ofbacteriology, 14821489 15 Croci L., Serratore P., Cozzi L., Stacchini A., Milandri S., Suffredini E and Toti L 2001 Detection of Vibrionaceae in mussels and in their seawater growing area Lett Appl Microbiol, 32: 57-61 16 Franco A.V., Liu D and Reeves P.R 1998.The Wzz (Cld) Protein in Escherichia coli: Amino Acid Sequence Variation Determines O-AntigenChain Length Specificity Journal of bacteriology, 190: 2670-2675 17 Fraser S 2005 A novel anti-bacterial agent addressing a critical need in a large and growing market, Centex Shrimp Mahidol University, Bangkok 10400, Thailand 18 Guo H., Yi W., Shao J., Lu Y., Zhang W., Song J and Wang P.G.2005 Molecular Analysis of the O-Antigen Gene Cluster of Escherichia coli O86:B7 and Characterization of the Chain Length Determinant Gene Applied and Environmental Microbiology, 7995-8001 19 Harris L., Owens L and Smith S 1996 A selective and diffrentail medium for Vibrio harveyi Appl Environ Microbiol, 62: 3548-3550 20 Harris L., Owens L., and Smith S 1996 A Selective and Differential Medium for Vibrio harveyi.American Society for Microbiologyi,62: 3548-3549 21 JoelR and Maat T 2011 De Novo gene Synthesis by Rapid Polymerase Chain Assembly Coupled with Immunoaffinty Purification A Novel Process and Workstation 22 Katarina S.T 2005 Detection and characterization of Vibrio harveyi isolate Dublin Institute of Technology 23 Lavilla-Pitogo C.R., Lean E.M and Paner M G 1998 Mortalities of pond-cultured juvenile shrimp Penaeus monodon, associated with dominance of luminescent Vibrios in the rearing environment Aquaculture, 164: 337-349 24 Liu p C., Lee K K., Tu C C and Chen S N 1997 Purification and characterization of a cysteine protein produced by pathogenic luminous Vibrio harveyi.Curr Microbiol, 35:32-39 25 Montero A.B and Austin B 1999 Characterization of extracellular products from an isolate of Vibrio harveyi recovered from diseased post-larval Penaeus Journal of Fish Diseases, 22: 337-386 53 26 Nelson M.D and Fitch D.H.A 2011 Chapter 27:Overlap Extension PCR: An Efficient Method for Transgene Construction.Molecular Methods for Evolutionary Genetics Springer, 459-470 27 Oakey H.J., Levy N., Boume D.G., Cullen B and Thomas A 2003 The use of PCR aid in the rapid identification of Vibrio harveyi isolates Journal of Applied Microbiolofy, 95: 1293-1303 28 Sambrook, Joseph and RussellD.W 2001 Molecular cloning : a laboratory manual, volume 1st, 3rd Cold Spring Harbor 29 Sung H.H., Hsu S.F., Chen C.K., Ting Y.Y and Chao W.L 2001 Relationships between outbreak in cultured tiger shrimp (Penaeus monodon) and the composition of Vibrio communities in pond water and shrimp hepatopancreas during cultivation Aquaculture, 192:101-110 30 Tang K.H., Guo H., Yi W., Tsai M., George P and Wang P.G 2007 Investigation of the Conformational States of Wzz and Wzz.O-Antigen Complex under NearPhysiological Condition Department of Chemistry and Biochemistry, The Ohio State University,46:11744-11752 31 Tang K.H., Guo H., Yi W., Tsai M.D and Wang P.G.2007 Investigation of the Conformational States of Wzz and the Wzz O-Antigen Complex under Near Physiological Conditions Biochemistry, 46: 11744-11752 32 Thaithongnum S., Ratanama P., Weeradechapol K., Sukhoom A and Vuddhakul V 2006 Detection of V.harveyi in shrimp postlarvae and hatchery tank water by the Most Probale Number technique with PCR Aquaculture, 261: 1-9 33 Uma A., Saravanabava K., Singaravel R and Koteeswaran A 2004 Antibiotic resistant Vibrio harveyi isolatied from swollen hindgut syndrome (shg) affected Penaeus monodon post larvae from commercial shrimp hatcheries Tamilnadu Veterinary and Animal Sciences University,16-19 34 Vattaanaviboon P and Mongkolsuk S 2001 Unsual adaptive, cross protection responses and growth phase resistance againt peroxide killing in a bacterial shrimp pathogen, Vibrio harveyi FEMS Microbiology Letters, 200: 111-116 35 Zhang X H., Meaden P.G and Austin B 2001 Duplication of Hemolysin Genes in a Virulent Isolate of Vibrio harveyi Appl Environ Microbiol, 67: 3161-3167 Tài liệu từ internet 36 http://www.thermoscientificbio.com/molecular-cloning/clonejet-pcr-cloning-kit/ Ngày truy cập: 03/2013 37 http://www.thermoscientificbio.com/restriction-enzymes/bglii/.Ngày truy cập: 04/2013 38 http://xetnghiemdakhoa.com/diendan/showthread.php?tid=313.Ngày truy cập: 04/2013 39 http://www.thermoscientificbio.com/molecular-cloning/clonejet-pcr-cloning-kit/ Ngày truy cập 05/2013 40 http://baodientu.chinhphu.vn/Home/Xuat-khau-thuy-san-duy-tri-phongdo/201210/152765.vgp 54 PHỤ LỤC Các vùng trình tự vectơ pKD4 FRT NEOKAN_promoter Orf2 98 - 51 321 - 370 459 - 1253 NeoR/KanR R6Kg_origin 462 - 1250 1523 - 1894 pUni_fwd_primer 1882 - 1900 Orf1 Ampicillin 2839 - 1979 2839 - 1979 AmpR_promoter rrnB_T1_terminator 2909 - 2881 3038 - 3081 rrnB_T2_terminator 3213 - 3240 Các vùng trình tự vevtơ pJET1.2/blunt Eco47IR 16 - 753 T7 promoter 305 - 324 Multiple cloning site (MCS) 328 - 422 Insertion site 371 - 372 pJET1.2 forward sequencing primer 310 - 332 pJET1.2 reverse sequencing primer 405 - 428 PlacUV5 769 - 892 Replication start 1162 ± rep (pMB1) 1148 - 1762 R bla (Ap ) 1922 - 2782 Kết PCR kiểm tra sản phẩm cloning  PCR với cặp mồi pJET1.2 F / pJET1.2 R Qua kết điện di hình 1, ta thấy 10 chủng mang đoạn gen kích thước, nhiên băng bị xuất vạch mia mờ.Nguyên nhân thành phần trình pha mic PCR khơng hay mẫu chứa nhiều plasmid 2000bp 1000bp 500bp Hình Kết PCR plasmid với cặp mồi pJET1.2 F / pJET1.2 R Giếng Ecoli DH5α mang casstte H-K-T :: aroA Từ giếng đến giếng 11 10 chủng E.coli DH5α mang casstte H-K-T :: wzz2 Giếng 12 la chứng âm Giếng 13 thang 1kbp.Giếng 12 thang 1kb  PCR với cặp mồi 2W2F1/2W2R2 khuếch đại toàn casstte H-K-T Kết điện di cho băng kích thước ~ 2153bp, nhiên điện trường máy điện di không đều, nên thang băng không thẳn 2000bp 1000bp 500bp Hình Kết PCR plasmid với cặp mồi 2W2F1/2W2R2.Giếng casstte H-K-T thu qua phản ứng PCR lần Từ giếng đến giếng 11 10 chủng Ecoli DH5α mang casstte H-K-T :: wzz2 Giếng 12 chứng âm Giếng 13 thang 1kb  PCR với cặp mồi 2W2F1/2W2R1 khuếch đại đoạn H Kết điện di cho băng kích thước ~ 369 bp, nhiên điện trường máy điện di không đều, nên thang băng không thẳng hàng 2000 bp 1000 bp 500 bp Hình Kết PCR plasmid với cặp mồi 2W2F1/2W2R1.Giếng DNA Vibrio harveyi chủng BL1 Từ giếng đến giếng 11 10 chủng E.coli DH5α mang casstte H-K-T :: wzz2 Giếng 12 la chứng âm Giếng 13 thang 1kb  PCR với cặp mồi KF/KR khuếch đại đoạn Km Kết điện di cho băng có kích thước 1500 bp Đúng kích thước đoạn Km 2000 bp 1000 bp 500 bp Hình Kết PCR plasmid với cặp mồi KF/RF.Giếng vecto pKD4 Từ giếng đến giếng 11 10 chủng E.coli DH5α mang casstte H-K-T :: wzz2 Giếng 12 chứng âm Giếng 13 thang 1kb  PCR với cặp mồi 2W2F2/2W2R2 khuếch đại đoạn T Kết điện di cho băng kích thước ~ 284 bp 2000 bp 1000 bp 500 bp Hình Kết PCR plasmid với cặp mồi 2W2F1/2W2R1.Giếng DNA Vibrio harveyi chủng BL1 Từ giếng đến giếng 11 10 chủng Ecoli DH5α mang casstte H-K-T :: wzz2 Giếng 12 la chứng âm Giếng 13 thang 1kb Trình tự gen wzz dựa sở lý thuyết Dựa trình tự gen Vibrio harveyi ATCC BAA_1116 công bố ngân hàng gen (Genbank ID: NC_009784.1) trình tự gen kan kháng kanamycin plasmid pKD4 ngân hàng gen (Genbank ID: AY048743.1) ACGGTCAGATGCCAATAGCTCCTGTGGATTTGGTGGAATAATACCGGCAGGCAA CACATCTAAGTTCGCCTCTTCTTTTTTGATGATGCATTCGCTCAAAGGCGTATCCA TCGTAAGAATGTTGGTTAAACCTGGGCTTGATTCTGGAAGGTTGAAGCGTTTTGC TAATGAGGGTTTTCGCAGGTCGCAGTCAATCAGCAGTACCTTTTCCATGGTTGAG AACGAGACAGCCATATTAATACTGGTTGATGTCTTTCCTTCCTCAGGAATGGCAG AAGTAAATGGTAAGATTTTCTGCTTAGAGTTCGTTAGTCTCAGCAATAACGAGGT TCGGACGGAGCGACACGGTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCT AGAGAATAGGAACTTCGGAATAGGAACTTCAAGATCCCCTCACGCTGCCGCAAG CACTCAGGGCGCAAGGGCTGCTAAAGGAAGCGGAACACGTAGAAAGCCAGTCC GCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAG GGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGTGGGCTTACATGGC GATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTG GGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTT GCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACAGGATG AGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCT TGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCT GATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGA CCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGT GGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGC GGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATC TCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTG CATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCG AGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACG AAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCA TGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATAT CATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTG GCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTG GCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTC GCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGG GGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATT CCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGG CTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAGC TTCAAAAGCGCTCTGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAG GAACTAAGGAGGATATTCATATGGACCATGGCTAATTCCCATGTCGGGACTTGAT TCGTAGGGGCTTGAGTAGAATGAGTTTCGTTCATTGAATTGCCTGTCATTAGAAG AAGCTCTGATCGATAAATACAATGTCGCCAGGTTCTACAGAGCGTTGCATACTGA CGCTTTCAACCGTATTACCTGTTGCGTGTTGAGTAAGATTAATGCTCTTGCGGGA CGCTCGATCCGTTAAGCCTCCAGCTAGCGCGATGGCTTTTTCAATCGTCAATCCC GGCTGGTATTCGAATCCACCAGGCTTTCGGACTTCACCATTTACGTAGAAAAGGC GGAAGCTATTGATTGCCAC 5.Trình tự gen wzz dựa sở giải trình tự >Cassette H-K-T wzz (pJET1.2 F, pJET1.2 R, WF1, KF) ACGGTCAGATGCCAATAGCTCCTGTGGATTTGGTGGAATAATACCGGCAGGCAA CACATCTAAGTTCGCCTCTTCATTTCTAATGATGCATTCGCTCAAAGGCGTATCCA TCGTAAGTATGTTGGTTAAACCTGGGCTTGATTCTGGAAGATTAAAGCGTTTTGC TAGTGAGGGTCTTCGCAGGTCGCAGTCAATCAGCAGTACCTTTTCCATGGTTGAG AACGAGACAGCCATATTAATACTGGTTGATGTCTTTCCTTCTTCAGGAATGGCAG AAGTAAATGGCAAGATTTTCTGCTTAGAGTTCGTTAGTCTCAGCAATAACGAGGT TCGGACGGAGCGGCACGCTTCGCTGAACAGCTTTTCGTCTGTGTAGGCTGGAGCT GCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCAA GATCCCCCACGCTGCCGCAAGCACTCAGGGCGCAAGGGCTGCTAAAGGAAGCGG AACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGC TACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGC TTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAG CGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAA AGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAG ATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATT GCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGC ACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGG GCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAG GACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCT GTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTG CCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCA TGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGA CCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCT TGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACT GTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCA TGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTC ATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCT ACCCGTGATATTGCTGAAGAACTTGGCGGCGAATGGGCTGACCGCTATCAGGAC ATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGAC CGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTA TCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACC AAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGA AAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGC GGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAGCTTCAAAAGCGCTCTGAAGT TCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCA TATGGACCATGGCTAATTCCCATGTCGGGACTTGATTCGTAGGGGCTTGAGTAGA ATGAGTTCCGTTCATTGAGTTGCCTGTCATTAGAAGAAGCTCTGATCGATAAATA CAATGTCGCCAGGTTCTACAGAGCGTTGCATACTGACGCTTTCAACCGTATTACC TGTTGCGTGTTGAGTAAGATTAATGCTCTTGCGGGACGCTCGATCCGTTAAGCCT CCTGCTAGTGCGATGGCTTTTTCAATCGTCTATCCCGGATGGTATTCGGATCCACC AGGCTGTGGGACTTCGCCATTGACGGGGGAAAGGCGGAATGTATTGATAGACAC Kết BLAST trình tự cassette H-K-T wzz thu giải trình tự trình tự H-K-T wzz sở lý thuyết Range 1: to 1493 Score Expect Identities Gaps Strand 2584 bits(1399) 0.0 1481/1516(98%) 23/1516(1%) Plus/Plus Query Sbjct Query 61 Sbjct 61 Query 121 Sbjct 121 Query 181 Sbjct 181 Query 241 Sbjct 241 Query 301 Sbjct 301 Query 361 Sbjct 346 Query 421 Sbjct 398 Query 480 Sbjct 458 Query 540 Sbjct 518 ACGGTCAGATGCCAATAGCTCCTGTGGATTTGGTGGAATAATACCGGCAGGCAACACATC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ACGGTCAGATGCCAATAGCTCCTGTGGATTTGGTGGAATAATACCGGCAGGCAACACATC 60 TAAGTTCGCCTCTTCATTTCTAATGATGCATTCGCTCAAAGGCGTATCCATCGTAAGTAT ||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||| || TAAGTTCGCCTCTTCTTTTTTGATGATGCATTCGCTCAAAGGCGTATCCATCGTAAGAAT 120 GTTGGTTAAACCTGGGCTTGATTCTGGAAGATTAAAGCGTTTTGCTAGTGAGGGTCTTCG |||||||||||||||||||||||||||||| || ||||||||||||| ||||||| |||| GTTGGTTAAACCTGGGCTTGATTCTGGAAGGTTGAAGCGTTTTGCTAATGAGGGTTTTCG 180 CAGGTCGCAGTCAATCAGCAGTACCTTTTCCATGGTTGAGAACGAGACAGCCATATTAAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGGTCGCAGTCAATCAGCAGTACCTTTTCCATGGTTGAGAACGAGACAGCCATATTAAT 240 ACTGGTTGATGTCTTTCCTTCTTCAGGAATGGCAGAAGTAAATGGCAAGATTTTCTGCTT ||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| ACTGGTTGATGTCTTTCCTTCCTCAGGAATGGCAGAAGTAAATGGTAAGATTTTCTGCTT 300 AGAGTTCGTTAGTCTCAGCAATAACGAGGTTCGGACGGAGCGGCACGCTTCGCTGAACAG ||||||||||||||||||||||||||||||| |||| ||| | || | ||| AGAGTTCGTTAGTCTCAGCAATAACGAGGTT CGGA-CGG-A GC-G-ACA- 360 CTTTTCGTCTGTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAA || |||||||||||||||||||||||||||||||||||||||||||||||||| -CG -GTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAA 420 60 120 180 240 300 345 397 CTTCGGAATAGGAACTTCAAGATCCCCCCACGCTGCCGCAAGCACTCAGGGCGCAAGGGC 479 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTTCGGAATAGGAACTTCAAGATCCCCTCACGCTGCCGCAAGCACTCAGGGCGCAAGGGC 457 TGCTAAAGGAAGCGGAACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TGCTAAAGGAAGCGGAACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATG 539 AATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTA 599 517 577 Query 600 Sbjct Query 578 660 Sbjct 638 Query 720 Sbjct 698 Query 780 Sbjct 758 Query 840 Sbjct 818 Query 900 Sbjct 878 Query 960 Sbjct 938 Query 1020 Sbjct 998 Query 1080 Sbjct 1058 Query 1140 Sbjct 1118 Query 1200 Sbjct 1178 Query 1260 Sbjct 1238 Query 1320 Sbjct 1298 Query 1380 Sbjct 1358 Query 1440 Sbjct 1418 Query 1500 Sbjct 1478 GCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAA CCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGG 659 ATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCTGATCAAGAGACA 779 GGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCT TGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCC GCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCC 637 719 697 757 839 817 899 877 959 937 GGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGC 1019 GTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTG 1079 GGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCC 1139 ATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGAC 1199 CACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGAT 1259 CAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTC 1319 AAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCG 1379 AATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTG 1439 GCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAACTTGGCGGC |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| GCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGC 1499 GAATGGGCTGACCGCT |||||||||||||||| GAATGGGCTGACCGCT 997 1057 1117 1177 1237 1297 1357 1417 1477 1515 1493 Range 2: 1417 to 2144 Score Expect Identities Gaps Strand 1251 bits(677) 0.0 711/728(98%) 0/728(1%) Plus/Plus Query 1505 Sbjct 1417 Query 1565 Sbjct 1477 GGCTGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGG ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| GGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGG 1564 CGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCAT 1624 1476 1536 Query 1625 Sbjct 1537 Query 1685 Sbjct 1597 Query 1745 Sbjct 1657 Query 1805 Sbjct 1717 Query 1865 Sbjct 1777 Query 1925 Sbjct 1837 Query 1985 Sbjct 1897 Query 2045 Sbjct 1957 Query 2105 Sbjct 2017 Query 2165 Sbjct 2077 Query 2225 Sbjct CGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACC GACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAA AGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGAT 1684 1596 1744 1656 1804 1716 CTCATGCTGGAGTTCTTCGCCCACCCCAGCTTCAAAAGCGCTCTGAAGTTCCTATACTTT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTCATGCTGGAGTTCTTCGCCCACCCCAGCTTCAAAAGCGCTCTGAAGTTCCTATACTTT 1864 CTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCATATGGACCATGGCTAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CTAGAGAATAGGAACTTCGGAATAGGAACTAAGGAGGATATTCATATGGACCATGGCTAA 1924 TTCCCATGTCGGGACTTGATTCGTAGGGGCTTGAGTAGAATGAGTTCCGTTCATTGAGTT |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || TTCCCATGTCGGGACTTGATTCGTAGGGGCTTGAGTAGAATGAGTTTCGTTCATTGAATT 1984 GCCTGTCATTAGAAGAAGCTCTGATCGATAAATACAATGTCGCCAGGTTCTACAGAGCGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCCTGTCATTAGAAGAAGCTCTGATCGATAAATACAATGTCGCCAGGTTCTACAGAGCGT 2044 TGCATACTGACGCTTTCAACCGTATTACCTGTTGCGTGTTGAGTAAGATTAATGCTCTTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TGCATACTGACGCTTTCAACCGTATTACCTGTTGCGTGTTGAGTAAGATTAATGCTCTTG 2104 CGGGACGCTCGATCCGTTAAGCCTCCTGCTAGTGCGATGGCTTTTTCAATCGTCTATCCC |||||||||||||||||||||||||| ||||| ||||||||||||||||||||| ||||| CGGGACGCTCGATCCGTTAAGCCTCCAGCTAGCGCGATGGCTTTTTCAATCGTCAATCCC 2164 GGATGGTATTCGGATCCACCAGGCTGTGGGACTTCGCCATTGACGGGGGAAAGGCGGAAT || ||||||||| |||||||||||| | ||||||| ||||| ||| | |||||||||| GGCTGGTATTCGAATCCACCAGGCTTTCGGACTTCACCATTTACGTAGAAAAGGCGGAAG 2224 1776 1836 1896 1956 2016 2076 2136 GTATTGAT 2232 ||||||| 2137 CTATTGAT 2144 Hình Kết BLAST trình tự cassette H-K-T wzz thu sở giải trình tự cassette H-K-T wzz sở lý thuyết NCBI Query trình tự cassette được giải trình tự; sbjct trình tự cassette theo lý thuyết ... Tạo dòng gen đột biến WZZ (O-antigen chain length determinant gene )của vi khuẩn Vibrio harveyi E.coli DH5α thực Bước đầu tạo dòngcassette nhân tạo H-K-T với H T trình tự đoạn đầu cuối gen wzz, ... Virio harveyi với lồi Vibrio khác Bảng 2.2 Hình thái khuẩn lạc mơi trường VHA Lồi Vibrio harveyi Vibrio natriegens Vibrio vulnificus, Vibrio anguillarum Vibrio pelagius Vibrio aestuarianus Vibrio. .. ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHĨA LUẬN TỐT NGHIỆP TẠO DỊNG CASSETTE GEN ĐỘT BIẾN WZZ (O-antigen chain length determinant gene) CỦA VI KHUẨN Vibrio
- Xem thêm -

Xem thêm: TẠO DÒNG CASSETTE GEN ĐỘT BIẾN WZZ (Oantigen chain length determinant gene) CỦA VI KHUẨN Vibrio harveyi TRONG E.coli DH5α , TẠO DÒNG CASSETTE GEN ĐỘT BIẾN WZZ (Oantigen chain length determinant gene) CỦA VI KHUẨN Vibrio harveyi TRONG E.coli DH5α

Gợi ý tài liệu liên quan cho bạn