Luận văn nghiên cứu khả năng sử dụng vi sinh vật để ức chế quá trình Quorum Sensing của các vi khuẩn Vibrio gây bệnh trên động vật thủy sản

74 154 0
  • Loading ...
1/74 trang

Thông tin tài liệu

Ngày đăng: 29/04/2017, 20:31

ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN NGUYỄN THỊ KIM THU NGHIÊN CỨU KHẢ NĂNG SỬ DỤNG VI SINH VẬT ĐỂ ỨC CHẾ QUÁ TRÌNH QUORUM SENSING CỦA CÁC VI KHUẨN VIBRIO GÂY BỆNH TRÊN ĐỘNG VẬT THUỶ SẢN LUẬN VĂN THẠC SĨ KHOA HỌC Hà Nội - 2015 ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN Nguyễn Thị Kim Thu NGHIÊN CỨU KHẢ NĂNG SỬ DỤNG VI SINH VẬT ĐỂ ỨC CHẾ QUÁ TRÌNH QUORUM SENSING CỦA CÁC VI KHUẨN VIBRIO GÂY BỆNH TRÊN ĐỘNG VẬT THUỶ SẢN Chuyên ngành : Vi sinh vâṭ hoc̣ Mã số : 60420107 LUẬN VĂN THẠC SĨ KHOA HỌC Người hướng dẫn khoa học: TS Phạm Thế Hải Hà Nội - 2015 LỜI CẢM ƠN Trong suốt quá trình hoc̣ tâp̣ và thưc hiêṇ đề tài , em đã nhâṇ đươc sự giúp đỡ vàủng hộ nhiệt tình nhiều tập thểvàcánhân Đầu tiên, em xin bay tỏ lòng biết ơn chân và sâu sắc nhất đến người thầy hướng dẫn khoa hoc̣ : TS Phạm Thế Hải , người thầy tâm huyết , đã tâṇ tình hướng dẫn , chỉbảo vàgiúp đỡem quátrình thực hiện đềtài và hoànthành luâṇvăn này Em xin chân thành cảm ơn sự giúp đỡ , tạo điều kiện cô Đỗ Minh Phƣơng các anh chị, các bạn thuộc phòng thí nghiệm môn Vi sinh vật học suốt quátrình hoàn thành luận văn Em xin gửi lời cam ơn tới quý thầy cô taị Khoa Sinh hoc̣ , đăc̣ biêṭ là cac thầy cô ở Bô ̣ môn Vi sinh vâṭ hoc̣ , trường Đaị hoc̣ Khoa hoc̣ Tự nhiên đã nhiêṭ tinh giảng dạy và truyền đạt cho em những kiến thức bổ ích , phương pháp luâṇ và nghiên cứu khoa hoc̣ , làm hành trang quý báu cho sự phát triển công việc em Cuối cùng, xin bày tỏlòng biết ơn chân thành vàsâu sắc nhất đến gia đình , người thân , bạn bè đã động viên , giúp đỡ , tạo điều kiện và danh tinh cảm thân thương - đó là nguồn đông lưc maṇ h mẽ để có thể hoàn thành bản luâṇvăn này HàNội, ngày tháng năm 2015 HỌC VIÊN Nguyễn Thị Kim Thu MỤC LỤC LỜI CẢM ƠN MỤC LỤC DANH MỤC CÁC CHỮ VIẾT TẮT DANH MỤC BẢNG DANH MỤC HÌNH MỞ ĐẦU 1.1.Tổng quan vi khuẩn Vibrio 1.1.1 Đặc điểm chung chi Vibrio 1.1.2 Môi trường nuôi cấy các loài vi khuẩn Vibrio 1.1.3 Đặc điểm sinh hoá chi Vibrio 1.1.4 Một số Vibrio gây bệnh người và động vật thuỷ sản 1.1.5 Phân loại Vibrio các đặc điểm hình thái, sinh lý và sinh hoá 1.2 Hiện tƣợng cảm ứng mật độ (Quorum sensing) 1.2.1 Lịch sử phát hiện quá trình quorum sensing .8 1.2.2 Khái niệm quorum sensing 1.2.3 Cơ chế phân tử quá trình QS số vi khuẩn Vibrio .8 1.2.4 Quorum sensing điều khiển sự sản xuất các yếu tố gây độc các vi khuẩn Vibrio 11 1.3 Các phƣơng pháp ức chế trình QS đƣợc sử dụng .12 1.3.1 Sử dụng chất đối kháng quorum sensing 12 1.3.2 Bất hoạt phân tử tín hiệu dựa vào enzym 13 1.4 Nghiên cứu vi khuẩn ức chế quorum sensing đối kháng với số vi khuẩn Vibrio 14 CHƢƠNG NỘI DUNG, VẬT LIỆU VÀ PHƢƠNG PHÁP 16 2.1 Nội dung nghiên cứu 16 2.2 Vật liệu nghiên cứu 16 2.2.1 Nguồn và chủng vi sinh vật sử dụng nghiên cứu 16 2.2.2 Hóa chất và thiết bị .17 2.2.3 Thành phần môi trường sử dụng nghiên cứu: 18 2.3 Phƣơng pháp nghiên cứu 20 2.3.1 Phân lập và tuyển chọn vi sinh vật có khả ức chế quá trình phát quang sinh học liên quan đến quorum sensing vi khuẩn Vibrio harveyi 20 2.3.2 Nghiên cứu ảnh hưởng số điều kiện môi trường tới khả ức chế sự phát sáng Vibrio harveyi các chủng VSV đối kháng 22 2.3.3 Nghiên cứu số đặc tính hình thái, phân loại các chủng vi khuẩn có hoạt tính ức chế phát sáng sinh học (liên quan đến QS) Vibrio harveyi 23 2.3.4 Phân tích gen 16S rRNA vi khuẩn .26 2.3.5 Chỉ tiêu theo dõi chung .29 2.3.6 Phương pháp tính toán thống kê xử lý số liệu 29 CHƢƠNG KẾT QUẢ VÀ THẢO LUẬN 30 3.1 Xác định mối tƣơng quan mật độ tế bào cƣờng độ phát quang đo đƣợc Vibrio harveyi thời điểm 30 3.2 Phân lập tuyển chọn số vi sinh vật có khả ức chế trình phát quang sinh học liên quan đến quorum sensing vi khuẩn Vibrio harveyi 31 3.2.1 Phân lập các vi sinh vật các vùng ao nuôi tôm, rừng ngập mặn, đất, bùn tỉnh Nam Định và Ninh Bình 31 3.2.2 Xác định khả ức chế sự phát sáng liên quan đến quorum sensing Vibrio harveyi các vi sinh vật phân lập 32 3.3 Kết phân tích định lƣợng khả ức chế phát sáng liên quan đến quorum sensing Vibrio harveyi VSV phân lập đƣợc 36 3.4 Nghiên cứu ảnh hƣởng số điều kiện môi trƣờng tới khả ức chế phát sáng Vibrio harveyi chủng VSV đối kháng 38 3.4.1 Ảnh hưởng nhiệt độ 38 3.4.2 Ảnh hưởng độ pH môi trường nuôi cấy 39 3.4.3 Ảnh hưởng nồng độ muối (NaCl) môi trường nuôi cấy .40 3.5 Xác định đặc điểm hình thái số đặc điểm phân loại học khác vi khuẩn có hoạt tính ức chế phát quang sinh học liên quan đến quorum sensing Vibrio harveyi 41 3.5.1 Quan sát hình dạng tế bào các chủng vi khuẩn có khả ức chế sự phát quang sinh học liên quan đến quorum sensing Vibrio harveyi 42 3.5.2 Hình thái khuẩn lạc hai chủng vi khuẩn tuyển chọn 42 3.5.3 Khả lên men yếm khí các chủng vi khuẩn có khả ức chế sự phát quang sinh học liên quan đến quorum sensing Vibrio harveyi 43 3.5.4 Khả di động các chủng vi khuẩn triển vọng 44 3.5.5 Kết phân tích các đặc điểm sinh hoá XTS1 .45 3.6 Phân tích trình tự gen 16S rRNA chủng XTS1 48 3.6.1 Khuếch đại gen 16S rRNA 48 3.6.2 Kết xác định loài vi khuẩn XTS1 ức chế sự phát sáng sinh học liên quan đến quorum sensing Vibrio harvei kỹ thuật sinh học phân tử 49 KẾT LUẬN VÀ KIẾN NGHỊ 52 TÀI LIỆU THAM KHẢO 53 PHỤ LỤC 58 DANH MUC CÁC CHƢ̃VIẾT TẮT Viết tắt Cụ m t AHL Chất N-Acyl homoserine lactone Cs Cộng sự DNA Deoxyribonucleic acid ĐC Đối chứng DN Dịch nuôi Epps Eppendorf HCD Mật độ tế bào cao (High cell density) Mật LCD độ tế bào thấp (Low cell density) LB Môi trường Luria-Bertani MQSR Master quorum sensing regulator MR Methyl red NCBI Cơ sở dữ liệu về công nghệ sinh học OD Optical density (mật độ quang) ONPG O-Nitrophenyl-β-D-galactopyranoside PCR Phản ứng chuỗi trùng hợp QS Quorum sensing Rpm revolutions per minute (số vòng phút) sp Một loài spp Nhiều loài sRNA Small RNA Vi VSV sinh vật V VK har RNA veyi V parahaemolyt icus V P V V V V R DANH MỤC BẢNG Bảng 1.1 Hình thái số khuẩn lạc Vibrio điển hình môi trường Bảng 2.1 Thành phần môi trường LB 0.5% NaCl nuôi cấy các VSV phân lập 19 Bảng 2.2 Thành phần môi trường TCBS để chọn lọc vi khuẩn Vibrio 19 Bảng 3.1 Số chủng VSV phân lập từ tỉnh Nam Định và Ninh Bình 31 Bảng 3.2 Kết phân lập số chủng vi khuẩn nghi ngờ có hoạt tính ức chế sự phát quang sinh học Vibrio harveyi 32 Bảng 3.3 Ảnh hưởng nhiệt độ tới khả ức chế sự phát quang sinh học Vibrio harveyi các chủng XTS1 và CP1 38 Bảng 3.4 Ảnh hưởng pH môi trường tới khả ức chế phát quang sinh học liên quan đến QS Vibrio harveyi chủng vi khuẩn XTS1 và CP1 39 Bảng 3.5 Ảnh hưởng nồng độ muối (NaCl) đến khả ức chế chủng XTS1 và CP1 tới sự phát quang sinh học(QS) Vibrio harveyi 41 Bảng 3.6 Khả lên men yếm khí số chủng vi khuẩn có triển vọng ức chế phát quang sinh học Vibrio harveyi 43 Bảng 3.7 Kết thử nghiệm MR phân loại vi khuẩn dựa vào khả lên men đường glucose tạo sản phẩm acid bền 45 Bảng 3.8 Kết thử nghiệm VP chủng vi khuẩn XTS1 46 Bảng 3.9 Kết thử nghiệm ONPG chủng vi khuẩn XTS1 47 Bảng 3.10 Kết xác định loài vi khuẩn ức chế sự phát sáng liên quan đến QS Vibrio harveyi kỹ thuật sinh học phân tử 49 DANH MUC HÌNH Trang Hình 1.1 Sơ đồ phân loại các loài Vibrio các phản ứng sinh hoá .7 Hình 1.2 Quá trình quorum sensing Vibrio fisheri Hình 1.3 Quorum sensing vi khuẩn Vibrio harveyi .10 Hình 1.4 Hai enzym AHL lactonase và AHL cyclase phân huỷ AHL 13 Hình 3.1 Đồ thị mô tả sự tương quan giữa giá trị OD600nm và lượng phát quang Vibrio harveyi các thời điểm 0h, 6h, 12h và 18h 30 Hình 3.2 Kết thử hoạt tính ức chế phát quang sinh học Vibrio harveyi các chủng XTS1, CP1, CP10 33 Hình 3.3 Đồ thị sinh trưởng các chủng VSV 34 Hình 3.4 Kết khảo sát tính đối kháng giữa các chủng Vibrio harveyi và chủng VSV phân lập phương pháp cấy vạch vuông góc 35 Hình 3.5 Kết khảo sát sự ức chế sinh trưởng giữa các chủng XTS1 và CP1 với V.harveyi phương pháp đục lỗ thạch 36 Hình 3.6 Đồ thị biểu thị cường độ phát quang Vibrio harveyi các giếng thí nghiệm .37 Hình 3.7 Hiệu ức chế phát quang sinh học Vibrio harveyi hai chủng vi khuẩn XTS1 và CP1 37 Hình 3.8 Hình dạng tế bào XTS1 quan sát vật kính 100x 42 Hình 3.9 Quan sát hình dạng tế bào CP1 vật kính 100x 42 Hình 3.10 Hình ảnh khuẩn lạc chủng vi khuẩn XTS1 môi trường LB 3% NaCl và TCBS 43 Hình 3.11 Khả lên men yếm khí chủng vi khuẩn có khả ức chế sự phát quang sinh học liên quan đến quorum sensing Vibrio harveyi 44 Hình 3.12 Khả di động XTS1 và CP1 45 Hình 3.13 Kết thử nghiệm MR 46 Hình 3.14 Thử nghiệm VP chủng vi khuẩn XTS1 47 Hình 3.15 Kết thử nghiệm ONPG chủng vi khuẩn XTS1 48 Hình 3.16 Kết quả PCR khuếch đại đoạn 16S rADN XTS1 49 Hình 3.17 Kết so sánh trình tự 16S rDNA XTS1 GenBank 50 Hình 3.15 Kết thử nghiệm ONPG chủng vi khuẩn XTS1 Trong đó, các ống nghiệm XTS1, Ec, ĐC lần lượt là các ống chứa vi khuẩn XTS1, E coli và đối chứng chỉ có môi trường ONPG Thử nghiệm ONPG với XTS1 cho kết âm tính ĐC âm (chỉ có môi trường) và đối chứng dương (thử nghiệm với E.coli) đều cho kết hợp lý Vì vậy, có thể khẳng định XTS1 có phản ứng ONPG âm tính (hình 3.15) Vậy theo sơ đồ phân loại mục 1.1.5 nghiên cứu về định danh loài Vibrio C.V.L Jayasinghe và cs (2010), XTS1 có khả là Vibrio parahaemolyticus (mọc TCBS cho khuẩn lạc màu xanh, không mọc môi trường 0% NaCl, MRVP (-), ONPG (-) Để định danh xác chủng vi khuẩn này, chúng tiến hành phân tích trình tự 16S rDNA XTS1) 3.6 Phân tích trình tự gen 16S rRNA chủng XTS1 Sau tách DNA hệ gen chủng vi khuẩn XTS1, gen 16S rRNA chủng này khuếch đại phương pháp PCR sử dụng cặp mồi p61F và p1378R 3.6.1 Khuếch đại gen 16S rRNA Kết cho thấy sản phẩm PCR đặc hiệu sử dụng cặp mồi p63F và p1378R (Hình 3.16) Sản phẩm PCR là đoạn DNA có chiều dài khoảng 1300 bp sáng rõ giếng số 2, giếng cho kết mờ 48 1489bp ~ 1300bp Hình 3.16 Kết quả PCR khuếch đại đoạn 16S rADN vi khuẩn XTS1 với cặp mồi p61F & p1378R từ sản phẩm tách DNA tổng số Trong đó, giếng ĐC là đối chứng âm, DNA Giếng M là giếng chứa marker  Giếng 1, l a ̀ s ả n p h ẩ m P trình tự First Base, C Singapore R 3.6.2 Kết xác định loài vi khuẩn XTS1 ức chế n phát sáng sinh học liên h quan đến quorum â sensing Vibrio n harvei kỹ thuật sinh học phân tử đ Sản phẩm PCR nêu o tinh và giải trình tự Sau giải trình tự, n tiến hành phân tích trình tự và so sánh trình tự ngân hàng gen S r R N A NCBI, kết cho thấy trình tự gen 16S rRNA XTS1 có độ tương đồng tới 99% với trình tự tương ứng V parahaemolyticus (hình 3.17 và bảng 3.10) Bảng 3.10 Kết xác định loài vi khuẩn ức chế phát sáng liên quan đến Q Sản phẩm PCR giếng số tinh và đem giải S Vibrio harveyi kỹ thuật sinh g học g ầ n phân tử K í c h g ũ i n h ấ t t h ƣ c ( b p ) P h ầ n t r ì n h t r ă m t ự XTS1 K H CP009982.1 Vibrio parahaemolyticus M ã G e n B a n k ản phẩm đồng Loài c h ủ n 1377 99 s Hình 3.17 Kết so sánh trình tự 16S rDNA XTS1 GenBank NCBI Như vậy, các kết thử nghiệm sinh hoá và phân tích gen 16S rRNA đều cho thấy XTS1 là chủng thuộc loài Vibrio parahaemolyticus Kết khá bất ngờ Vibrio parahaemolyticus (cùng chi với Vibrio harveyi) lại có khả ức chế sự phát quang sinh học liên quan đến quorum sensing Vibrio harveyi Mặc dù Vibrio parahaemolyticus là chủng vi khuẩn gây bệnh động vật thuỷ sản, nhiên chủng nào gây bệnh Hơn nữa, việc sử dụng dịch nuôi XTS1 để ức chế V harveyi có thể là phương án khả thi hoàn toàn tránh nguy gây bệnh XTS1 Chưa có nghiên cứu nào công bố kết tương tự về sự đối kháng ức chế quorum sensing loài Vibrio này với loài Vibrio khác Sự cạnh tranh thú vị này có thể là chế giúp các Vibrio cạnh tranh vật chủ để gây bệnh và có thể khai thác ứng dụng kiểm soát sinh học các Vibrio gây bệnh thủy sản Kết nghiên cứu chúng cho thấy tác nhân ức chế quá trình phát quang sinh học liên quan đến quorum sensing Vibrio harveyi có mặt dịch nuôi XTS1 (Vibrio parahaemolyticus) (do XTS1 tiết ngoài môi trường) Tác nhân này có thể là các enzyme phân giải các phân tử tín hiệu quorum sensing V harveyi là thân các phân tử tín hiệu V parahaemolyticus có khả 50 làm nhiễu phân tử tín hiệu quorum sensing gây sự phát quang sinh học V harveyi (phân tử tín hiệu V harveyi có cấu trú c tương tự V.parahaemolyticus) [9; 26] Bản chất tác nhân này cần tìm hiểu sâu thêm các nghiên cứu sau 51 KẾTLUẬNVÀKIẾNNGHI ̣ Kết luân - Đã phân lập, tuyển chọn chủng vi khuẩn là XTS1 và CP1 có khả ức chế quá trình phát quang sinh học liên quan đến quá trình quorum sensing vi khuẩn Vibrio harveyi - Hai chủng XTS1 và CP1 đều có hoạt tính ức chế sự phát quang sinh học liên quan đến quorum sensing Vibrio harveyi mà không ức chế sự sinh trưởng vi khuẩn này - Ở điều kiện nhiệt độ, pH, nồng độ muối khác nhau, hiệu ức chế phát quang sinh học V harveyi XTS1 không bị ảnh hưởng Hiệu ức chế phát quang sinh học CP1 bị ảnh hưởng độ pH thấp và nồng độ muối cao - Kết hợp các đặc điểm hình thái, sinh hoá và phân tích gen 16S rRNA XTS1, có thể nhận định XTS1 là chủng thuộc loài Vibrio parahaemolyticus Kiến nghi ̣ - Tiếp tục nghiên cứu các vi sinh vật có khả ức chế số quá trình liên quan đến quorum sensing các vi khuẩn Vibrio gây bệnh động vật thuỷ sản - Cần sâu nghiên cứu chế ức chế sự phát quang sinh học liên quan đến quorum sensing Vibrio harveyi vi khuẩn Vibrio parahaemolyticus XTS1 52 TÀI LIỆU THAM KHẢO Tiếng Việt Nguyễn Thị Hồng Vân và Bùi Thị Việt Hà (2011), Giáo trình Di truyền học sinh vật nhân sơ, NXB Giáo dục Việt Nam Đặng Xuân Bình, Bùi Quang Tề, Đoàn Quốc Khánh (2012) , Giáo trình Bệnh động vật thuỷ sản, NXB Nông Nghiệp, Hà Nội Mai Thị Hằng, Đinh Thị Kim Nhung, Vương Trọng Hào (2011), Thực hành Vi sinh vật học, NXB Đại học sư phạm, Hà Nội Nguyễn Văn Phúc, Phan Thị Phượng Trang (2014), "Phân lập, định danh và xác định các đặc tính có lợi chủng Bacillus spp từ ao nuôi tôm tỉnh Bến Tre", Tạp chí khoa học - Đại học Sư phạm TPHCM, 64, tr 94-102 Tiếng Anh R Chythanya, Indrani Karunasagar, (2002), "Iddya Karunasagar Inhibition of shrimp pathogenic vibrios by a marine Pseudomonas I-2 strain", Aquaculture, 208, pp 1-10 Alsina M & Blanch AR (1994), "A set of keys for biochemical identification of environmental Vibrio species", Journal of Applied Bacteriology, 76, pp 79- 85 Alsina M & Blanch AR (1994), "Improvement and update of a set of keys for biochemical identification of Vibrio species", Journal of Applied Bacteriology, 76, pp 719-721 Simidu, U., and K Tsukamoto (1980), "A method of the selective isolation and enumeration of marine Vibrionaceae", Microb Ecol, 6, pp.181-184 Debra L Milton (2006), "Quorum sensing in vibrios: Complexity for diversification", Internal Journal of Medical Microbiology, 296, pp 61-71 10 Claudia Lupp & Edward G Ruby (2005),"Vibrio fischeri Uses Two QuorumSensing Systems for the Regulation of Early and Late Colonization Factors", J Bacteriol, 187, pp 3620-3629 53 11 Josephine R Chandler & et al, (2012), "Acyl-homoserine lactone-dependent eavesdropping promotes competition in a laboratory co-culture model", The ISME Journal, 6, pp 2219-2228 12 Yi-Hu Dong & et al, (2011),"Quenching quorum-sensing dependent bacterial infection by an N-acyl homoserine lactonase", Nature 411, pp 813-817 13 Brian K Hammer, Bonnie L Bassler (2003), "Quorum sensing controls biofilm formation in Vibrio cholerae", Mol Microbiol, 50, pp 1521 14 Dalsgaard A et al (1995), "Characterization of Vibrio cholerae non-O1 serogroup obtained from an outbreak of diarrhoea in Lima, Peru", Journal of Clinical Microbiology 33, pp.2715-2722 15 Kimberly C Tu, Tao Long, Sine L Svenningsen, Ned S Wingreen, and Bonnie L Bassler, (2010), "Negative Feedback Loops Involving Small Regulatory RNAs Precisely Control the Vibrio harveyi Quorum-Sensing Response", PMC, pp 567-579 16 Audra J Pompeani, Joseph J Irgon, Michael F Berger, Martha L Bulyk, Ned S Wingreen1 and Bonnie L Bassler, (2008), "The Vibrio harveyi master quorum-sensing regulator, LuxR, a TetR-type protein is both an activator and a repressor: DNA recognition and binding specificity at target promoters", Molecular Microbiology, 70, pp 76-88 17 Yi Shao and Bonnie L Bassler (2012), "Quorum-sensing non-coding small RNAs use unique pairing regions to differentially control mRNA targets", Molecular Microbiology, 83, pp 599-611 18 Kimberly C Tu1 and Bonnie L Bassler, (2007), "Multiple small RNAs act additively to integrate sensory information and control quorum sensing in Vibrio harveyi", Genes & development, 21, pp 221-233 19 Derrick H Lenz, Kenny C Mok, Ned S Wingreen, Bonnie L Bassler, (2008), "Small RNAs and bacterial strains involved in quorum sensing" , United States Patent 20 Andrei Y Chistoserdov & et al, (2005), Culture-Dependent characterization of the microbial community associated with epizootic shell disease lesions in 54 American lobster, Homarus Americanus, Journal of Shellfish Research 24, pp 741-747 21 Alcaiden E et al (2001), Vibrio harveyi causes disease in seahorse, Hippocampus sp Journal of Fish Diseases, 24, pp 311-313 22 Austin B et al (1993), Bacterial fish pathogens: Disease of farmed and wild fish, 3rd edition, Ellis Horwood 23 Lightner, D.V & et al, (1996), A Handbook of Shrimp Pathology and Diagnostic Procedures for Disease of Cultured Penaeid Shrimp, World Aquaculture Society, Baton Rouge 24 Julian R Marchesi et al (1998), "Design and Evaluation of Useful BacteriumSpecific PCR primers that amplify genes coding for Bacterial 16S rRNA", Appl Environ Microbiol, 64, pp (795-799) 25 C.V.L Jayasinghe et al (2008), "The Isolation and Identification of Vibrio Species in Marine Shrimps of fischeri Lanka", Journal of Food and Agriculture, 1, pp 36-44 26 Defoirdt T et al (2006), "Quorum sensing-disrupting brominated furanones protect the gnotobiotic brine shrimp Artemia franciscana from pathogenic Vibrio harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates", Appl Environ Microbiol, 72, pp 6419-23 27 Austin B & Zhang XH (2006), "Vibrio harveyi: a significant pathogen of marine vertebrates and invertebrates", Lett Appl Microbiol 43, pp 119-124 28 Belas R et al (1982), "Bacterial bioluminescence: isolation and expression of the luciferase genes from Vibrio harveyi", Science, 218, pp 791-793 29 B L Bassler, E P Greenberg and A M Stevens (1997), "Cross-species induction of luminescence in the quorum-sensing bacterium Vibrio harveyi", J Bacteriol, 179, pp 4043-4045 30 F.M.I Natrah et al (2011), "Regulation of virulence factors by quorum sensing in Vibrio harveyi", Veterinary Microbiology, 154, pp 124-129 55 31 Yi-Hu Dong et al (2002), "Identification of Quorum-Quenching N-Acyl Homoserine Lactonases from Bacillus Species", Appl Environ Microbio, 68, pp 1754-1759 32 Jun Zhu et al (2002), "Quorum-sensing regulators control virulence gene expression in Vibrio cholera", PNAS, 99, pp 3129-3134 33 Martin, M., Showalter, R & Silverman, M (1989), "Identification of a locus controlling expression of luminescence genes in Vibrio harveyi", J Bacteriol, 171, pp 2406-2414 34 Manefield M et al (2000), "Inhibition of luminescence and virulence in the black tiger prawn (Penaeus monodon) pathogen Vibrio harveyi by intercellular signal antagonists", Appl Environ Microbiol, 66, pp 2079- 2084 35 Swift, S., Throup, J., Bycroft, B., Williams, P & Stewart, G (1998), "Quorum sensing: bacterial cell-cell signaling from bioluminescence to pathogenicity, In Molecular Microbiology, 103, pp.185-207 36 "Autoinduction in Erwinia amylovora: Evidence of an Acyl-Homoserine Lactone Signal in the Fire Blight Pathogen", J Bacteriol, 187, pp 3206- 3213 37 U Schmidt, H Chmel, and C Cobbs (1979), "Vibrio alginolyticus infections in humans, J Clin Microbiol, 10, pp 666-668 38 Jennifer M Henke and Bonnie L Bassler (2004), "Three Parallel QuorumSensing Systems Regulate Gene Expression in Vibrio harveyi", Journal of Bacteriology, 186, pp 6902-6914 39 Martins, ML et al (2008), "Isolation and experimental infection with Vibrio alginolyticus in the sea horse, Hippocampus reidi Ginsburg, 1933 (Osteichthyes: Syngnathidae) in Brazil", 70, pp 205-209 40 Nguyen Thi Ngoc Tinh et al, "Inhibition of Quorum Sensing-mediated Bioluminescence in Vibrio harveyi by a Recombinant AHL-lactonase from Bacillus cereus", Journal of Pure and Applied Microbiology, Trang web 56 41 42 43 44 45 57 PHỤ LỤC Phụ lục 1: Sự phát sáng Vibrio harveyi cấy đĩa petri khoảng 12h sau cấy ria 58 Phụ lục 2: Sơ đồ sàng lọc chủng vi khuẩn ức chế phát quang sinh học liên quan đến quorum sensing Vibrio harveyi 30 mẫu đất, bùn thu thập từ vùng có độ mặn cao (Nam Định, Ninh Bình), phân lập 299 chủng vi khuẩn Thử nghiệm đĩa 96 giếng Sáng mạnh (287 chủng) Sáng yếu/ Không sáng (12 chủng) Ức chế sinh trưởng (10 chủng) Ức chế phát quang sinh học (2 chủng) 59 Phụ lục 3: Trình tự 16S rDNA Vibrio parahaemolyticus XTS1 (phần đƣợc giải trình tự) kết so sánh trình tự GenBank NCBI ACGATGGCTAATACCGCATGATGCCTACGGGCCAAAGAGGGGGA CCTTCGGGCCTCTCGCGTCAGGATATGCCTAGGTGGGATTAGCTAGTTG GTGAGGTAAGGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGG ATGATCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAG GCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCAT GCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGTCGTG AGGAAGGTGGTAGTGTTAATAGCACTATCATTTGACGTTAGCGACAGAA GAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTG CGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTTGT TAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAATTGCATTTGAAA CTGGCAGACTAGAGTACTGTAGGAGGGGGTAGAATTTCAGGTGTAGCG GTGAAATGCGTAGAGATCTGAAGGAATACCGGTGGCGAAGGCGGCCCC CTGGACAGATACTGACACTCAGAT Kết so sánh trình tự với độ tƣơng đồng 99% 60 ... Thu NGHIÊN CỨU KHẢ NĂNG SỬ DỤNG VI SINH VẬT ĐỂ ỨC CHẾ QUÁ TRÌNH QUORUM SENSING CỦA CÁC VI KHUẨN VIBRIO GÂY BỆNH TRÊN ĐỘNG VẬT THUỶ SẢN Chuyên ngành : Vi sinh vâṭ hoc̣ Mã số : 60420107 LUẬN VĂN... khả sử dụng vi sinh vật để ức chế trình quorum sensing vi khuẩn Vibrio gây bệnh động vật thuỷ sản" Chƣơng TỔNG QUAN TÀI LIỆU 1.1 Tổng quan vi khuẩn Vibrio 1.1.1 Đặc điểm chung chi Vibrio Vibrio... Nguồn chủng vi sinh vật sử dụng nghiên cứu Nguồn vi sinh vật để phân lập chủng có khả ức chế quorum sensing Để phân lập các chủng vi sinh vật có khả ức chế quá trình quorum sensing,
- Xem thêm -

Xem thêm: Luận văn nghiên cứu khả năng sử dụng vi sinh vật để ức chế quá trình Quorum Sensing của các vi khuẩn Vibrio gây bệnh trên động vật thủy sản, Luận văn nghiên cứu khả năng sử dụng vi sinh vật để ức chế quá trình Quorum Sensing của các vi khuẩn Vibrio gây bệnh trên động vật thủy sản, Luận văn nghiên cứu khả năng sử dụng vi sinh vật để ức chế quá trình Quorum Sensing của các vi khuẩn Vibrio gây bệnh trên động vật thủy sản

Gợi ý tài liệu liên quan cho bạn

Từ khóa liên quan

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay
Nạp tiền Tải lên
Đăng ký
Đăng nhập