Nghiên cứu ứng dụng mPCR để xác định phân týp của HIV1 ở Hà Nội Viêng Chăn (2007 2011)

24 12 0
  • Loading ...
1/24 trang

Thông tin tài liệu

Ngày đăng: 29/11/2016, 10:48

Nghiên cứu ứng dụng mPCR để xác định phân týp của HIV1 ở Hà Nội Viêng Chăn (2007 2011)Nghiên cứu ứng dụng mPCR để xác định phân týp của HIV1 ở Hà Nội Viêng Chăn (2007 2011)Nghiên cứu ứng dụng mPCR để xác định phân týp của HIV1 ở Hà Nội Viêng Chăn (2007 2011)Nghiên cứu ứng dụng mPCR để xác định phân týp của HIV1 ở Hà Nội Viêng Chăn (2007 2011)Nghiên cứu ứng dụng mPCR để xác định phân týp của HIV1 ở Hà Nội Viêng Chăn (2007 2011)Nghiên cứu ứng dụng mPCR để xác định phân týp của HIV1 ở Hà Nội Viêng Chăn (2007 2011) 1 ĐẶT VẤN ĐỀ HIV gồm có týp sinh học HIV-1 HIV-2, HIV1 lan tràn gây đại dịch phạm vi toàn cầu HIV-1 có đặc tính đa dạng di truyền cao phân thành nhóm (Groups), phân týp (Subtypes), dạng phân týp (Sub-subtypes) dạng tái tổ hợp (Circuling recombinant forms - CRFs) HIV-1 gồm có nhóm: M, O, N P, nhóm N O thấy Tây Trung Phi Nhóm P phát Cameroon nhóm Nhóm M có tính đa dạng di truyền cao phổ biến nhất, lây lan nhanh phạm vi toàn cầu Nhóm M chia làm 10 phân týp gồm: A, B, C, D, E, F, G, H, J K có phân týp hay gặp từ A đến G Ngoài phát khoảng 51 dạng tái tổ hợp nhiều biến thể chưa xác định phân týp Điều đặc biệt phân týp phân bố mang tính trội cho vùng địa lý khác đồ toàn cầu phân týp lại có tính trội theo đường lây truyền định, kết thu từ vùng Sahara châu Phi cho phân týp A, C, D E HIV-1 thích nghi lây truyền qua đường tình dục khác giới, phân týp B lại hiệu truyền qua đường này; Bắc Mỹ, Tây Âu, Đông Nam Á phân týp B lại hiệu truyền qua tiêm chích ma tuý cá nhân đồng tính; Thái Lan, phân týp B trội đối tượng tiêm chích ma túy, phân týp E trội trường hợp lây nhiễm qua đường tình Vì nghiên cứu phân bố phân týp, dạng tái tổ hợp HIV-1 có giá trị giám sát dịch tễ học tầm khu vực toàn cầu liên quan đến chiến lược dự phòng, phát triển vaccine thích hợp cho khu vực, làm sở cho việc lựa chọn liệu pháp kháng virus, triển vọng phát triển vaccine dự phòng liệu cho nghiên cứu sau thiết lập đồ dịch tễ phân týp HIV-1 lưu hành tầm quốc gia khu vực Hiện có nhiều phương pháp xác định phân týp HIV, multiplex PCR (mPCR) hay gọi PCR đa mồi kỹ thuật dùng xác định nhiều phân týp HIV-1 tube phản ứng với nhiều vòng phản ứng, mPCR kỹ thuật có nhiều ưu điểm, phù hợp với điều kiện Việt Nam Lào Vì tiến hành đề tài: “Nghiên cứu ứng dụng mPCR để xác định phân týp HIV-1 Hà Nội Viêng Chăn (2007- 2011) ” với mục tiêu: Tối ưu hóa qui trình multiplex PCR để xác định phân týp chủ yếu HIV-1 khu vực Hà Nội Viêng Chăn Xác định phân týp chủ yếu HIV-1 đối tượng khu vực Hà Nội Viêng Chăn kỹ thuật multiplex PCR NHỮNG ĐÓNG GÓP MỚI VỀ MẶT KHOA HỌC Đây đề tài nghiên cứu phân týp HIV-1 Lào Nghiên cứu đề xuất qui trình thích hợp cho việc xác định phân týp HIV-1 áp dụng Lào multiplex PCR phù hợp điều kiện Kết nghiên cứu cho thấy phân týp dạng tái tổ hợp CRF01-AE HIV-1 phân týp chủ yếu hai khu vực (98,57 % khu vực Hà Nội 85% khu vực Viêng Chăn) Khu vực Viêng Chăn có tỷ lệ phân týp HIV phức tạp đa dạng hơn, dạng CRF01-AE có phân týp A, B, C phát với tỷ lệ thấp (0,7 % - 2,14%) đối tuợng nghiện chích ma túy gái mại dâm CẤU TRÚC CỦA LUẬN ÁN Luận án gồm 118 trang, đặt vấn đề trang, tổng quan 26 trang, đối tượng phương pháp nghiên cứu 36 trang, kết nghiên cứu 31 trang, bàn luận 18 trang, kết luận trang, 33 bảng, 03 biểu đồ, sơ đồ 06, 25 hình, 160 tài liệu tham khảo phụ lục 3 Chƣơng TỔNG QUAN 1.1 Tình hình nhiễm HIV/AIDS 1.1.1 Tình hình nhiễm HIV Việt Nam Theo Bộ y tế Việt Nam, trường hợp phát vào năm 1990 Thành phố Hồ Chí Minh Qua số liệu giám sát cho thấy dịch HIV/AIDS xuất 100% tỉnh, thành phố từ năm 1998, đến cuối năm 2011 có 98% số quận, huyện, thị xã 77% số xã, phường, thị trấn có người nhiễm HIV báo cáo 1.1.2 Tình hình nhiễm HIV Lào Theo trung tâm phòng chống HIV/AIDS Bệnh lây truyền qua đường tình dục - Bộ y tế Lào, trường hợp nhiễm HIV Lào phát vào năm 1990 Tính đến đầu năm 2012, qua điều tra phạm vi nước phát 4.942 trường hợp nhiễm HIV, 3.650 trường hợp bị AIDS 1.290 trường hợp tử vong liên quan AIDS Tỷ lệ nhiễm trung bình 0,2% người độ tuổi từ 15- 49 tuổi, ước tính số nhiễm HIV năm khoảng 10.350 trường hợp, Savannakhet 34% có tỷ lệ nhiễm HIV cao so với tổng số nước, Viêng Chăn 33% thứ tỉnh Champasak 9% HIV/AIDS có xu hướng gia tăng theo năm 1.2 Các phân týp HIV Hiện nay, HIV đươc chia thành týp: HIV-1 HIV-2, HIV-1 chia thành nhóm: M, N, O, P nhóm M lại chia thành 10 phân týp: A, B, C, D, E, F, G, H, J K Phổ biến phân týp từ A đến G; phân týp H, J, K gặp Ngoài có khoảng 51 dạng tái tổ hợp công nhận, nhiều biến thể chưa xác định phân týp Nghiên cứu phân bố phân týp HIV, thực chất đồng nghĩa với tìm hiểu biến đổi di truyền HIV cấp độ khu vực toàn cầu cần thiết, không để tìm hiểu nguồn gốc giám sát dịch tễ học HIV, mà giám sát xuất biến mới, nội phân týp thay đổi đặc tính sinh học chúng để đảm bảo cho chẩn đoán, liệu pháp kháng virus dự đoán phát triển vaccine HIV/AIDS toàn cầu 1.3 Đặc điểm phân týp HIV-1 số khu vực 1.3.1 Đặc điểm phân týp HIV-1 châu Phi 1.3.2 Đặc điểm phân týp HIV-1 châu Âu 1.3.3 Đặc điểm phân týp HIV-1 châu Mỹ 1.3.4 Đặc điểm phân týp HIV-1 Trung Đông 1.3.5 Đặc điểm phân týp HIV-1 Liên Bang Nga 1.3.6 Đặc điểm phân týp HIV-1 châu Úc 1.3.7 Đặc điểm phân týp HIV-1 châu Á 1.3.8 Đặc điểm phân týp HIV-1 Việt Nam 1.3.9 Đặc điểm phân týp HIV-1 Lào Hiện chưa có nghiên cứu phân týp HIV Lào 1.4 Một số kỹ thuật xác định phân týp HIV-1 1.4.1 Kỹ thuật ELISA phát kháng thể peptide đặc hiệu HIV-1 Ưu điểm: nghiên cứu với số lượng mẫu lớn, kỹ thuật không phức tạp Nhược điểm: hay có phản ứng chéo nên độ tin cậy thấp 1.4.2 Kỹ thuật Heteroduplex Mobility Assay (HMA): Ưu điểm: phát gen kháng thuốc, phát hiện tượng đồng nhiễm phân týp, áp dụng với số mẫu lớn, giá thành vừa phải Nhược điểm: hay có phản ứng chéo đòi hỏi kỹ thuật viên chuyên sâu 1.4.3 Kỹ thuật giải trình tự gen (Sequancing) Được coi phương pháp chuẩn mực Tuy nhiên phương pháp tiến hành phức tạp, nhiều thời gian, đòi hỏi thiết bị hoá chất đắt tiền nhân viên đào tạo bản, chuyên sâu 1.6.4 Kỹ thuật multiplex PCR hay mPCR (PCR đa mồi) Ưu điểm phương pháp dễ thực hiện, thời gian nhanh, áp dụng với số lượng mẫu lớn, kết xác, giá thành thấp Nhược điểm không phát dạng đột biến tái tổ hợp Đây phương pháp phù hợp cho việc xác định phân týp HIV quốc gia phát triển kỹ thuật lựa chọn cho nghiên cứu phân týp HIV-1 Lào, nơi chưa có điều kiện triển khai kỹ thuật giải trình tự gen Chƣơng ĐỐI TƢỢNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1 Đối tƣợng Các mẫu máu có HIV (+) từ đối tượng nghiên cứu xét nhiệm khẳng định HIV dương tính với chiến lược theo khuyến cáo WHO từ hai khu vực Hà Nội (Việt Nam) Viêng Chăn (Lào) Các đối tượng nghiên cứu khu vực gồm nhóm nghiện chích ma túy (NCMT), gái mại dâm (GMD) đối tượng khác (Khác) Bảng 2.1: Các ký hiệu cho đối tƣợng nghiên cứu theo khu vực Nhóm đối tượng (NĐT) Khu vực Hà Nội Khu vực Viêng Chăn Tổng số Nhóm A: A1 đến A50 Nghiện chích ma túy (NCMT) 50 50 100 Nhóm B: B1 đến B50 Gái mại dâm (GMG) 50 50 100 Nhóm C: C1 đến C40 Đối tượng khác (Khác) 40 40 80 140 140 280 Tổng số Khi vào mã nghiên cứu ghép thêm ký hiệu khu vực để phân biệt (A01 khu vực Hà Nội ký hiệu HNA01, A01 khu vực Viêng Chăn ký hiệu VCA01…) Cỡ mẫu nghiên cứu áp dụng theo công thức (WHO, 1991), n  Z12 / p  (1  p) d2 Trong đó: Z1- /2 = 1,96 với độ tin cậy α ≥ 95% p: Tỉ lệ phân týp trội trường hợp HIV (+), khoảng 90% d: Sai số tuyệt đối mong muốn (d = 0,05) n: Cỡ mẫu tối thiểu cần đạt Căn công thức trên, cỡ mẫu tìm 140 cho khu vực (tổng số 280 cho hai khu vực) 2.2 Vật liệu thiết bị nghiên cứu 2.2.1 Các sinh phẩm hoá chất 2.2.2 Các máy thiết bị 2.2.3 Các mồi dùng nghiên cứu Tham khảo tác giả Fumihiro (2005), sau: 2.2.3.1 Phản ứng PCR1: Dùng cặp mồi chung để khuếch đại đoạn gen gp 41 đặc hiệu cho HIV-1, mồi có trình tự sau:  BECO5’(7938 - 7960): 5’GGCATCAAACAGCTCCAGGCAAG3’  BECO3’(8766 - 8791): 5’AGCAAAGCCCTTTCTAAGCCCTGTCT3’ Sản phẩm PCR vòng thứ có kích thước 853bp, DNA đích cho vòng phản ứng PCR2 2.2.3.2 Phản ứng PCR2.1: Vòng phản ứng để xác định phân týp B D, A E G, C, F; Sử dụng cặp mồi BE-ANCH mồi xuôi, mồi B-SPEC, E-SPEC, FSPEC, C-SPEC mồi ngược, có trình tự sau:  BE-ANCH(7963-7985): 5’TCCTGGCTGTGGAAAGATACCTA 3’  B-SPEC (8384 - 8403): 5’GTCCCCTCGGGGCTGGGAGG 3’  E-SPEC (8585): 5’GTCTCAGTCCCTTGAGACTGCTG 3’  C-SPEC(8615-8638): 5’AGACCCCAATACTGCACAAGACTT 3’  F-SPEC(8720-8744): 5’AACAGCTCTACCAGCTCTTTGCAAA3’ Khi sản phẩm PCR2.1 có kích thước 441 bp phân týp B D, để phân biệt hai phân týp cần tiến hành phản ứng PCR 2.3, với sản phẩm có kích thước 645 bp phân týp A E G, cần tiến hành phản ứng PCR 2.2, để phân biệt phân týp này, sản phẩm có kích thước 697 bp xác định phân týp C sản phẩn kích thước 778 bp phân týp F 2.2.3.3 Phản ứng PCR 2.2: Để xác định phân týp A, E, G, sử dụng cặp mồi có trình tự sau:  A5’(8094 - 8112): 5’GANAACATGACCTGGCTGC 3’  A3’(8693 - 8716): 5’TCTATAACCCTATCTGTCCAGCCA 3’  E5’(8181-8207): 5’CAGGAAAGGAATGAAAAGGATTTGTTA3’  E3’(8693 - 8713): 5’ATAACCCTATCTGTCCACCCC 3’  G5’(8131- 8757): 5’ACAATTACACATACCACATATACAGCC3’  G3’(8694 - 8716): 5’TCTATAACCCTATCTGTCCAGTT 3’ Sản phẩm PCR2.2 có kích thước 644 bp xác định phân týp A, kích thước 554 bp xác định phân týp E kích thước 607 bp xác định phân týp G 2.2.3.4 Phản ứng PCR 2.3: Để phân biệt phân týp D B, sử dụng cặp mồi D5’- D3’ có trình tự sau:  D5’(8037 - 8058): 5’ACCACTAATGTGCCCTGGAACT 3’  D3’(8356 - 8386): 5’AGGAGGGTCTGAAATGACAGA 3’ Sản phẩm PCR2.3 có kích thước 350 bp phân týp D, sản phẩm phân týp B 2.3 Phƣơng pháp nghiên cứu 2.3.1 Thiết kế nghiên cứu Sử dụng phương pháp nghiên cứu dịch tễ học cắt ngang phân tích labo để tối ưu hóa phản ứng mPCR tìm hiểu phân týp HIV-1 đối tượng nghiên cứu Sử dụng phiếu theo dõi để thu thập thông tin đối tượng nghiên cứu, phân tích tìm yếu tố liên quan 8 Các số liệu xử lý phương pháp thống kê y học để tìm ý nghĩa mối liên quan thông qua phần mềm Excel 2007 SPSS 13.0 Đối với biến định tính sử dụng kiểm định χ2, biến định lượng sử dụng kiểm định T-student; giá trị p < 0,05 xem có ý nghĩa thống kê Các bƣớc tiến hành xác định phân týp HIV-1 2.3.2 Tách chiết acid nucleic (RNA DNA) Do RNA không bền, lưu giữ lâu thực với nhiều mẫu đồng thời nên nhóm nghiên cứu lựa chọn phương pháp tách DNA từ khối bạch cầu (Buffy coat) Quy trình chiết xuất tinh DNA kit QIAGEN 9 2.3.3 Các bước tối ưu chu trình nhiệt thành phần phản ứng mPCR 2.3.3.1 Tối ưu hoá nhiệt độ gắn mồi thích hợp Chuẩn bị ống phản ứng giống thành phần, ứng với mốc nhiệt độ máy PCR gradient nhiệt, chạy đồng thời điều kiện khác nhiệt độ, chọn nhiệt độ cho phản ứng với kết rõ nhất, băng phụ; kết lặp lại tối thiểu lần để kiểm tra 2.3.3.2 Tối ưu hóa thời gian trì nhiệt độ gắn mồi Chọn ngẫu nhiên mẫu chứng âm để chuẩn bị 16 ống phản ứng giống hệt thành phần ứng với mốc thời gian 30 giây, 45 giây, 60 giây, 90 giây, mẫu đặt ống phản ứng theo mốc thời gian mẫu chứng âm, sau tiến hành chạy phản ứng mPCR với nhiệt độ gắn mồi tối ưu tìm đặt mốc thời gian gắn mồi: 30 giây,45 giây, 60 giây, 90 giây 2.3.3.3 Tối ưu hóa nồng độ MgCl2 Chuẩn bị ống phản ứng (tương ứng với nồng độ MgCl2), ký hiệu từ đến ống chứng âm, thành phần giống nhau, điều chỉnh lượng nước khử ion cho đủ tổng thể tích 25 µl tùy theo lượng MgCl2 cho vào phản ứng Nồng độ MgCl2 (50mM) thử mức độ từ đến 3,5 µl cụ thể 1; 1,5; 2; 2,5; 3; 3,5µl /25µl thể tích phản ứng 2.3.4 Chạy kiểm tra quy trình sau tối ưu Chạy lại 10 mẫu chọn sau tối ưu hóa quy trình, đạt 10 mẫu tiến hành cho toàn mẫu nghiên cứu lại; chưa đạt tiếp tục tối ưu lại theo trình tự 2.3.5 Giải trình tự gen đối chiếu kết với kỹ thuật mPCR Để khẳng định kết kỹ thuật mPCR, chọn số mẫu ngẫu nhiên đại diện cho tất các phân týp xác định kỹ thuật mPCR tiến hành giải trình tự xác định phân týp để đối chiếu, không phù hợp giải trình tự toàn mẫu kiểm tra lại mPCR, 10 phù hợp sử dụng kết mPCR cho phân tích 2.4 Địa điểm thời gian nghiên cứu 2.4.1 Địa điểm nghiên cứu: Học viện Quân y, Viện Vệ sinh dịch tễ trung ương 2.4.2 Thời gian nghiên cứu: 10/2007 đến tháng 10/2011 Chƣơng KẾT QUẢ 3.1 Tối ƣu hóa qui trình multiplex PCR để xác định phân týp HIV-1 khu vực Hà Nội Viêng Chăn 3.1.1 Lựa chọn quy trình phản ứng PCR Kết 10 mẫu áp dụng theo quy trình tác giả Fumihiro: M (-) 645 bp 500 bp 10 Ghi M:Marker 100bp (-): Chứng âm 1-10: Các mẫu từ1 đến 10 Hình 3.1: Ảnh điện di sản phẩm PCR2.1 trước tối ưu quy trình Qui trình Fumihiro áp dụng nguyên điều kiện phòng xét nghiệm đạt 50% hiệu phát 11 3.1.2 Kết tối ưu hoá quy trình mPCR xác định phân týp HIV-1 3.1.2.1 Kết tìm nhiệt độ gắn mồi thích hợp M (-) Ghi M:Marke 100bp (-): Chứng âm 1: 54,80C (+) 500 bp 554 bp 2: 56,80C (+) 3: 58,80C (+) 4: 60,80C (+) 5: 62,50C (++) 6: 63,90C (+++) 7: 65,10C (++) 8: 680C (+) Hình 3.2: Ảnh điện di kết PCR2.2 tối ưu nhiệt độ gắn mồi Với dải gradient nhiệt từ 54,80C đến 680C kết mPCR đánh giá tốt nhiệt độ 63,90C cho phản ứng PCR 2.1 2.2 3.1.2.2 Kết tìm thời gian trì nhiệt độ gắn mồi Tiến hành mPCR với nhiệt độ gắn mồi 63,90C với thời gian gắn mồi 30 giây, 45 giây, 60 giây, 90 giây Kết tối ưu hoá thời gian trì nhiệt độ tóm tắt sau: 30 giây (-) 45 giây (-) 60 giây 90 giây (-) (-) M Ghi M: Marker 100bp 554 bp (-): Chứng âm 1: mẫu số 2: mẫu số 500 bp 3: mẫu số Hình 3.3: Ảnh điện di kết PCR tối ưu hoá thời gian trì nhiệt độ gắn mồi 12 Tại mốc thời gian 60 giây mẫu có band DNA đặc hiệu rõ 3.1.2.3 Kết tối ưu hoá nồng độ MgCl2 Thiết lập phản ứng mPCR giống hệt nhau, nhiệt độ gắn mồi 63,90C, thời gian trì 60 giây, khác nồng độ MgCl Kết tìm nồng độ MgCl2 tối ưu 2,5μl (50mM) M (-) 500 bp 554 bp Ghi M:Marker 100bp (-): Chứng âm 1: 1μl (+) 2: 1,5μl (+) 3: 2μl (++) 4: 2,5μl (+++) 5: 3μl (++) 6: 3,5μl (-) 500dibp Hình 3.4: Ảnh điện kết PCR tối ưu nồng độ MgCl2 Tại nồng độ 2,5μl ứng với ống số có band DNA đặc hiệu rõ 3.1.3 Quy trình xác định phân týp HIV-1 đối tượng nhiễm khu vực Hà Nội khu vực Viêng Chăn Trong trình tối ưu lại phản ứng cho phù hợp với điều kiện thực tế, nhóm nghiên cứu nhận thấy sử dụng cặp mồi xác định phân týp A, E, G sau PCR1 hầu hết mẫu có kết mà phải dùng đến vòng sau, tiết kiệm nhiều hóa chất thời gian công sức Vì nhóm nghiên cứu đưa qui trình phù hợp cho mẫu khu vực Hà Nội Viêng Chăn sau: 13 (*) Phân biệt tiếp PCR 2.2; (**) Kết biết PCR 2.0 Biểu đồ 3.1: Tóm tắt quy trình phản ứng mPCR sản phẩm PCR phân biệt phân týp HIV-1 mồi đặc hiệu sau tối ưu nghiên cứu Về chi tiết, qui trình thực theo bước sau: 3.1.3.1 PCR1: Dùng cặp mồi BECO5’, BECO3’để khuếch đại đoạn gen gp 41 đặc hiệu cho HIV-1 3.1.3.2 PCR2.0: Để xác định phân týp A, E, G với mồi 5’A-3’A, 5’E-3’E, 5’G-3’G 3.1.3.3 PCR2.1: PCR2.1 để xác định phân týp B, D, C, F (nếu A, E, G xuất băng DNA chung kích cỡ 645bp) với 14 mồi BEANCH mồi xuôi, mồi B-SPEC, E-SPEC, F-SPEC, CSPEC mồi ngược DNA khuôn sản phẩm PCR1 3.1.3.4 PCR2.2: Tiến hành mẫu PCR 2.1 có băng DNA kích thước 441 bp, sử dụng cặp mồi 5’D-3’D để phân biệt týp B D, DNA khuôn sản phẩm PCR1 Sản phẩm PCR2.2 có kích thước 350 bp phân týp D, sản phẩm tạo phân týp B Chu trình luân nhiệt cho phản ứng PCR sau: Bước biến tính ban đầu 950C phút; 35 chu kỳ luân nhiệt (mỗi chu kỳ bước) gồm: 950C 45 giây, 63,90C phút, 720C 1,5 phút; Bước tổng hợp cuối kéo dài bổ sung 720C 10 phút, sau giữ 40C 3.2 Kết xác định phân týp HIV-1 khu vực Hà Nội Viêng Chăn 3.2.1 Kết xác định phân týp HIV-1 khu vực Hà Nội Viêng Chăn mPCR Bảng 3.1: Kết xác định phân týp HIV-1 mPCR Kết xác định phân týp Xác định đƣợc Phân týp E Phân týp A Phân týp B Phân týp C Chƣa xác định n= 280 262/280 257/280 1/280 1/280 3/280 18/280 Tỷ lệ (%) 93,57 91,78 0,36 0,36 1,07 6,43 3.2.2 Kết giải trình tự gen đối chiếu với kết kỹ thuật mPCR 10 mẫu mPCR có kết xác định phân týp E mang giải trình tự vùng gen gp41 để đối chiếu kiểm chứng kết mPCR 15 Bảng 3.2: Kết đối chiếu phân týp HIV-1 10 mẫu mPCR có kết phân týp E Ký hiệu G1 G2 G3 G4 G5 G6 G7 G8 G9 G10 Mẫu HN A04 HNA31 HNA46 HNB34 HNB39 HNB50 HNC31 HNC33 HNC35 HNC40 Giải trình tự CRF01-AE CRF01-AE CRF01-AE CRF01-AE CRF01-AE CRF01-AE CRF01-AE CRF01-AE CRF01-AE CRF01-AE mPCR 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E Với 10 mẫu kết mPCR ứng với vị trí qui ước phân týp E phân tích giải trình tự cho thấy phân týp tái tổ hợp CRF01-AE Như tiến hành mPCR cho kết vị trí qui ước phân týp E hiểu thực chất phân týp tái tổ hợp CRF01-AE Sau kiểm chứng kết phân týp E mPCR, mẫu lại có kết khác gồm 01 mẫu phân týp A, 01 mẫu phân týp B 03 mẫu phân týp C giải trình tự kiểm chứng 16 Bảng 3.3: Kết đối chiếu phân týp HIV-1 05 mẫu mPCR có kết khác phân týp E Như kết giải trình tự xác nhận phù hợp chẩn đoán kỹ thuật mPCR xác định phân týp HIV-1 Bảng 3.4: Kết xác định phân týp HIV-1 mPCR đối tƣợng nghiên cứu khu vực Hà Nội Viêng Chăn 17 Bảng 3.5: Tỷ lệ phân bố phân týp HIV-1 nhóm nghiên cứu *CXĐ: chưa xác định phân týp mPCR Bảng 3.6: Tỷ lệ phân bố phân týp HIV-1 nhóm nghiên cứu khu vực Hà Nội Viêng Chăn 18 Chƣơng BÀN LUẬN 4.1 Tối ƣu hóa quy trình mPCR để xác định phân týp chủ yếu HIV-1 đối tƣợng nhiễm khu vực Hà nội Viêng Chăn 4.1.1 Lựa chọn phương pháp tách DNA RNA Độ tinh DNA hay RNA yến tố định thành công kỹ thuật sinh học phân tử nói chung kỹ thuật PCR nói riêng đặc biệt kỹ thuật mPCR, việc lựa chọn phương pháp tách DNA RNA chiến lược phụ thuộc vào nhiều yếu tố điều kiện cụ thể định Tuy tách chiết RNA dễ đạt độ tinh khiết cao cho phản ứng PCR RNA tự dễ bị phân hủy, RNAases tồn tất mô dịch thể thể nên việc tách chiết RNA tự virus cần phải thực sớm trước sau lấy mẫu máu Điều khiến cho việc áp dụng với cỡ mẫu lớn, vận chuyển xa khó khả thi Tách chiết DNA thao tác dễ dàng hơn, bảo quản mẫu đơn giản hơn, điều quan trọng DNA ổn định điều kiện môi trường, cho phép lưu giữ vận chuyển thời gian lâu hơn, kết phản ứng PCR với DNA HIV-1 tách từ khối bạch cầu tương đương kết phản ứng PCR với RNA đích từ huyết Vì tập thể hướng dẫn nghiên cứu sinh lựa chọn phương pháp tách DNA HIV-1 từ khối bạch cầu để nghiên cứu phân týp HIV-1 4.1.2 Lựa chọn quy trình phản ứng mPCR Quy trình tác giả Fumihiro năm 2005 sử dụng thành công sau nhiều tác giả khác áp dụng thành công sơ sở để nhóm nghiên cứu lựa chọn Tuy nhiên phòng xét nghiệm lại có trang bị khác cấu hình máy, điều kiện thực hiện, sở hạ tầng nên áp dụng nguyên mà cần điều chỉnh thông số cho phù hợp với điều kiện mình, trình gọi tối ưu hóa phản ứng cho phù hợp với điều kiện thực 19 phòng xét nghiệm Ban đầu áp dụng nguyên quy trình tác giả Fumihiro với 10 mẫu, cho thấy hiệu xác định phân týp thấp, PCR2.1 xác định 5/10 mẫu xuất băng DNA đặc hiệu với kích thước 645 bp phân týp A E G Để xác định phân týp cần phải tiến hành phản ứng PCR2.2 Với phản ứng PCR 2.2 cho kết 7/10 mẫu xuất băng DNA đặc hiệu với kích thước 554 bp xác định phân týp E Với kết thu từ hai vòng phản ứng chưa đạt kỳ vọng, để đạt mục tiêu nghiên cứu chọn phản ứng PCR2.1 PCR2.2 tác giả Fumihiro tối ưu lại số tiêu Khi tối ưu lại, nhóm nghiên cứu thử nghiệm với 25l thể tích phản ứng giúp tiết kiệm hóa chất 4.1.3 Kết tìm nhiệt độ gắn mồi thích hợp Tối ưu hóa nhiệt độ gắn mồi cho phản ứng mPCR, thực máy Thermol Cycler có chức gradient nhiệt Kết cho thấy với phản ứng PCR 2.1 sử dụng cặp mồi đặc hiệu BEANCH, mồi xuôi, mồi B-SPEC, E-SPEC, F-SPEC, CSPEC nhiệt độ gắn mồi tốt 63,90C Phản ứng PCR 2.2 với cặp mồi 5’A-3’A, 5’E-3’E, 5’G-3’G cho xác định phân týp A, E, G đánh giá tốt với nhiệt độ 63,90C 4.1.4 Kết tìm thời gian trì nhiệt độ gắn mồi Thời gian trì nhiệt nhiệt độ gắn mồi thông số quan trọng Theo quy chuẩn phản ứng PCR mồi có độ dài từ 18-30 bp cần thời gian trì gắn mồi từ 30 giây đến 90 giây Kết quả, với nhiệt độ gắn mồi 63,90C khoảng thời gian trì 60 giây, mẫu cho kết băng DNA đặc hiệu rõ 4.1.5 Kết tối ưu hoá nồng độ MgCl2 Trong trình tối ưu hoá nồng độ MgCl2, ống phản ứng cho nồng độ MgCl2, thông thường từ đến 3,5μl (50Mm) thử 20 nghiệm Kết cho thấy lượng MgCl2 cho vào ống phản ứng 2,5μl (50Mm) chọn cho phản ứng 4.1.6 Kiểm tra qui trình tối ưu Trong trình tối ưu lại phản ứng cho phù hợp với điều kiện thực tế, nhóm nghiên cứu nhận thấy sử dụng cặp mồi xác định phân týp A, E, G sau PCR1 hầu hết mẫu có kết mà phải dùng đến vòng sau, tiết kiệm nhiều hóa chất thời gian công sức Vì nhóm nghiên cứu đưa qui trình phù hợp cho mẫu khu vực Hà Nội Viêng Chăn sau: Bước đầu nhân gen đích gp41 phản ứng PCR1 với cặp mồi BECO5’ BECO3’ làm sở cho phân tích tìm phân týp HIV-1 Ở vòng phản ứng tiếp theo, Fumihiro dùng phản ứng PCR2.1 với cặp mồi B-SPEC, C-SPEC, E-SPEC, F-SPEC cho phân týp B D, C, A, E, G F Nhưng thực tế Việt Nam, Lào gặp B, D, F nên PCR 2.1 hay bị âm tính Tham khảo số công bố phân týp Việt Nam, Thái Lan nước xung quanh theo số công bố trước hay gặp phân týp E (CRF01-AE), chuyển cặp mồi A5’-A3’ đặc hiệu cho phân týp A, cặp mồi E5’- E3’đặc hiệu cho phân týp E cặp mồi G5’- G3’đặc hiệu cho phân týp G cho phản ứng PCR 2.0 trước thực PCR 2.1 Fumihiro Kết cho thấy hiệu suất tăng rõ rệt, tiết kiệm thời gian, công sức hóa chất Chỉ số trường hợp âm tính với phân týp A, E, G thực tiếp PCR 2.1 với cặp mồi B-SPEC, C-SPEC, E-SPEC, F-SPEC để tìm bổ sung phân týp B, C, D F Riêng trường hợp phân týp B D PCR 2.1 có chung băng 441bp cần đến phản ứng PCR2.2 sử dụng với cặp mồi D5’D3’ Nếu kết băng 350bp phân týp D, không xuất băng phân týp B Thành phần hỗn hợp chung cho phản ứng PCR với thể tích 21 25μl tối ưu thành công sau: Buffer Taq X10 (Invitrogen) 2,5μl, dNTP mix (10mM) (Invitrogen) 0,5μl, MgCl2 (50mM) 2,5 μl, mồi (10 pmol) loại tương ứng cho vòng PCR 0,5 μl, Taq DNA-polymerase (Invitrogen) 0,2 μl, DNA đích μl bổ xung thêm nước khử ion vừa đủ 25 μl thể tích Như mục tiêu 1: “Tối ưu hóa qui trình multiplex PCR để xác định phân týp chủ yếu HIV-1 khu vực Hà Nội Viêng Chăn” hoàn thành Khi so sánh với qui trình ban đầu tác giả Fumihiro, qui trình tối ưu có ưu điểm sau: Tiết kiệm sinh phẩm, dụng cụ tiêu hao tổng thể tích ống phản ứng 25μl (so với ban đầu 50μl) Hiệu suất xác định phân týp cao điều chỉnh thứ tự vòng phản ứng mô tả dẫn đến tiết kiệm nhiều sinh phẩm, dụng cụ tiêu hao, thời gian công sức, giảm kinh phí giá thành, cho kết nhanh 4.2 Ứng dụng quy trình mPCR xác định phân týp HIV-1 đối tƣợng khu vực Hà Nội Viêng Chăn Sau tìm qui trình tối ưu nêu trên, nhóm nghiên cứu áp dụng cho toàn 280 mẫu thu thập khu vực Hà Nội Viêng Chăn Kết cho thấy, quy trình xác định phân týp 262/280 mẫu (đạt hiệu suất 93,57%) Trong từ phản ứng PCR 2.0 xác định 257/280 mẫu (91,78%) có băng DNA kích thước 554bp theo qui ước phân týp E 1/280 mẫu (1,07%) có băng DNA kích thước 644bp tương ứng với phân týp A Sau sản phẩm PCR2.1 có mẫu (1,07%) có băng DNA với kích thước 697 bp tương ứng với phân týp C mẫu (1,07%) có băng DNA kích thước 441bp không xuất sản phẩm PCR 2.2 nên theo qui ước phân týp B Còn 18/280 mẫu (6,43%) chưa xác định phân týp kỹ thuật mPCR phân týp khác nhóm khác không thuộc phạm vi phát cặp mồi nghiên cứu dạng tái tổ hợp Tuy nhiên kết đạt hiệu suất cao 22 phản ứng mPCR tính đa dạng di truyền phức tạp phân týp HIV-1 so sánh với tác giả khác Với kết trên, nghiên cứu áp dụng cho nghiên cứu Lào phân týp HIV-1 chưa có điều kiện triển khai phương pháp khác.Do chứng dương với phân týp HIV-1 nên nhóm nghiên cứu lấy sản phẩm PCR vòng phản ứng sau xác định phân týp mang giải trình tự để kiểm tra kết kỹ thuật mPCR cách chọn ngẫu nhiên 10 mẫu xác định phân týp E (phân týp chiếm số lượng chủ yếu) Kết giải trình tự máy ABI System 3130XL, xử lý qua phần mềm Bio Edit, sau phân tích số liệu công cụ Viral Genotyping công cụ Blast so sánh với trình tự phân týp biết trước ngân hàng gen Quốc tế (GenBank) Kết cho thấy 10 mẫu có băng tương ứng qui ước phân týp E mPCR cho kết giải trình tự đối chiếu phân týp tái tổ hợp CRF01-AE Tham khảo tài liệu phân týp E công bố gần cho biết hầu hết phân týp E không dạng đơn độc mà dạng kết hợp với phân týp A tạo nên kiểu tái tổ hợp CRF01-AE kiểu ngày phổ biến khu vực Đông Nam Á Cặp mồi xác định phân týp E mPCR kế thừa từ công bố Fumihiro năm 2002 nên gọi phân týp E thực chất CRF01-AE theo kết phân tích trình tự gen Kết kiểm chứng với giải trình tự gen cho thấy độ tin cậy mPCR nghiên cứu Ngoài phân týp E, kết mPCR có 01 mẫu xác định phân týp A, 01 mẫu xác định phân týp B 03 mẫu xác định phân týp C; Cả mẫu giải trình tự đối chiếu Kết giải trình tự hoàn toàn phù hợp với kết mPCR mà nhóm nghiên cứu thực Khi so sánh phân bố phân týp HIV-1 Hà Nội Viêng Chăn cho thấy (bảng 3.21), khu vực Hà Nội xác định 138/140 mẫu chiếm 98,57% phân týp E (CRF01-AE), có 2/140 mẫu 23 chưa xác định týp mPCR chiếm 1,43% Khu vực Viêng Chăn có 124/140 (88,57%) mẫu xác định phân týp HIV-1 119 mẫu xác định phân týp E (CRF01-AE) chiếm 85% Ngoài xuất phân týp khác phân týp E (CRF01-AE) gồm 03 mẫu (2,14%) xác định phân týp C, 01 mẫu (0,71%) phân týp A 01 mẫu (0,71%) phân týp B Như phân týp HIV-1 Viêng Chăn đa dạng Hà Nội chủ yếu phân týp E (CRF01-AE) phản ánh đặc điểm chung khu vực Đông Nam Á KẾT LUẬN Qua nghiên cứu ứng dụng multiplex PCR để xác định phân týp HIV-1 Hà Nội Viêng Chăn (2007- 2011) rút kết luận sau: Đã tối ƣu hóa đƣợc qui trình multiplex PCR để xác định phân týp chủ yếu HIV-1 khu vực Hà Nội Viêng Chăn nhƣ sau: *Thành phần hỗn hợp cho phản ứng với thể tích 25μl sau: BufferTaq X10 (Invitrogen) 2,5 μl, dNTP mix (10mM) (Invitrogen) 0,5 μl, MgCl2 (50mM) 2,5 μl, mồi (10 pmol) loại cho cac vòng phản ứng PCR 0,5 μl, Taq DNA-polymerase (Invitrogen) 0,2 μl, DNA đích μl bổ xung thêm nước khử ion vừa đủ 25 μl thể tích Với PCR vòng sau lấy 1μl sản phẩm PCR làm khuôn cho phân tích *Thứ tự tiến hành phản ứng mPCR phát phân týp HIV-1 sau: + PCR1 với cặp mồi BECO5’ BECO3’ để khuếch đại đoạn gen gp 41 đặc hiệu kích thước 853bp dùng làm đích cho vòng phản ứng 24 + PCR2.0 sử dụng cặp mồi (A5’- A3’), (E5 - E3’), (G5’- G3’) để phân biệt phân týp A, E G Sản phẩm có kích thước 644 bp phân týp A, 554 bp phân týp E 607 bp phân týp G + PCR2.1 sử dụng mồi BE - ANCH, B - SPEC, E-SPEC, F-SPEC, C-SPEC Sản phẩm kích thước 697 bp phân týp C, 778 bp phân týp F Kích thước sản phẩm 441 bp phân týp B D cần tiếp tục PCR 2.2 + PCR2.2 sử dụng cặp mồi D5’- D3’, sản phẩm có kích thước 350 bp phân týp D, sản phẩm phân týp B *Chu trình luân nhiệt chung cho vòng phản ứng mPCR (95 phút) (95oC/45giây - 63,9oC/1phút -72oC/1,5 phút) x 35 chu kỳ72oC/10 phút, sau giữ 4oC oC Xác định phân týp chủ yếu HIV-1 đối tƣợng khu vực Hà Nội Viêng Chăn kỹ thuật multiplex PCR Kỹ thuật mPCR xác minh kết giải trình tự gen ứng dụng xác định phân týp HIV-1 khu vực Hà Nội Viêng Chăn, kết 262/280 mẫu (93,57%) xác định phân týp; phân týp E (CRF01-AE) 257/280 (91,78%), phân týp A 1/280 (0,36%), phân týp B 1/280 (0,36%) phân týp C 3/280 (1,07 %) Có 18/280 mẫu (6,43%) chưa xác định phân týp mPCR Phân týp dạng tái tổ hợp CRF01-AE HIV-1 phân týp chủ yếu hai khu vực (98,57 % khu vực Hà Nội 85% khu vực Viêng Chăn) Khu vực Viêng Chăn có tỷ lệ phân týp HIV phức tạp đa dạng hơn, dạng CRF01-AE có phân týp A, B, C phát với tỷ lệ thấp (0,7 % - 2,14%) đối tuợng nghiện chích ma túy gái mại dâm [...]... cuối cùng kéo dài bổ sung 720C trong 10 phút, sau đó giữ ở 40C 3.2 Kết quả xác định phân týp HIV-1 ở khu vực Hà Nội và Viêng Chăn 3.2.1 Kết quả xác định phân týp HIV-1 khu vực Hà Nội và Viêng Chăn bằng mPCR Bảng 3.1: Kết quả xác định phân týp HIV-1 bằng mPCR Kết quả xác định phân týp Xác định đƣợc Phân týp E Phân týp A Phân týp B Phân týp C Chƣa xác định n= 280 262/280 257/280 1/280 1/280 3/280 18/280... trong xác định phân týp HIV-1 Bảng 3.4: Kết quả xác định phân týp HIV-1 bằng mPCR trên đối tƣợng nghiên cứu ở khu vực Hà Nội và Viêng Chăn 17 Bảng 3.5: Tỷ lệ phân bố phân týp HIV-1 trên các nhóm nghiên cứu *CXĐ: chưa xác định được phân týp bằng mPCR Bảng 3.6: Tỷ lệ phân bố phân týp HIV-1 trên các nhóm nghiên cứu ở khu vực Hà Nội và Viêng Chăn 18 Chƣơng 4 BÀN LUẬN 4.1 Tối ƣu hóa quy trình mPCR để xác định. .. CRF01-AE mPCR 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E 554 bp - phân týp E Với 10 mẫu trong kết quả mPCR ứng với vị trí qui ước là phân týp E khi phân tích bằng giải trình tự đều cho thấy đây là phân týp tái tổ hợp CRF01-AE Như vậy khi tiến hành mPCR cho kết quả ở vị... (88,57%) mẫu xác định được phân týp HIV-1 trong đó 119 mẫu xác định là phân týp E (CRF01-AE) chiếm 85% Ngoài ra còn xuất hiện các phân týp khác ngoài phân týp E (CRF01-AE) gồm 03 mẫu (2,14%) xác định là phân týp C, 01 mẫu (0,71%) là phân týp A và 01 mẫu (0,71%) là phân týp B Như vậy phân týp HIV-1 ở Viêng Chăn đa dạng hơn ở Hà Nội nhưng chủ yếu vẫn là phân týp E (CRF01-AE) phản ánh đặc điểm chung của khu... định phân týp HIV-1 ở khu vực Hà Nội và Viêng Chăn, kết quả 262/280 mẫu (93,57%) xác định được phân týp; trong đó phân týp E (CRF01-AE) là 257/280 (91,78%), phân týp A là 1/280 (0,36%), phân týp B là 1/280 (0,36%) và phân týp C là 3/280 (1,07 %) Có 18/280 mẫu (6,43%) chưa xác định được phân týp bằng mPCR Phân týp dạng tái tổ hợp CRF01-AE của HIV-1 là phân týp chủ yếu ở cả hai khu vực (98,57 % ở khu... ánh đặc điểm chung của khu vực Đông Nam Á KẾT LUẬN Qua nghiên cứu ứng dụng multiplex PCR để xác định phân týp của HIV-1 ở Hà Nội và Viêng Chăn (2007- 2011) chúng tôi rút ra kết luận sau: 1 Đã tối ƣu hóa đƣợc qui trình multiplex PCR để xác định các phân týp chủ yếu của HIV-1 ở khu vực Hà Nội và Viêng Chăn nhƣ sau: *Thành phần hỗn hợp cho một phản ứng với thể tích 25μl như sau: BufferTaq X10 (Invitrogen)... thành, cho kết quả nhanh 4.2 Ứng dụng quy trình mPCR xác định phân týp HIV-1 trên các đối tƣợng ở khu vực Hà Nội và Viêng Chăn Sau khi tìm được qui trình tối ưu như nêu trên, nhóm nghiên cứu đã áp dụng cho toàn bộ 280 mẫu thu thập được ở khu vực Hà Nội và Viêng Chăn Kết quả cho thấy, quy trình này đã xác định được phân týp 262/280 mẫu (đạt hiệu suất 93,57%) Trong đó ngay từ phản ứng PCR 2.0 đã xác định. .. xác định phân týp C; Cả 5 mẫu này đều được giải trình tự đối chiếu Kết quả giải trình tự hoàn toàn phù hợp với kết quả của mPCR mà nhóm nghiên cứu đã thực hiện Khi so sánh sự phân bố phân týp HIV-1 giữa Hà Nội và Viêng Chăn cho thấy (bảng 3.21), khu vực Hà Nội xác định được 138/140 mẫu chiếm 98,57% đều là phân týp E (CRF01-AE), có 2/140 mẫu 23 chưa xác định týp bằng mPCR chiếm 1,43% Khu vực Viêng Chăn. .. biến ở khu vực Đông Nam Á Cặp mồi xác định phân týp E trong mPCR được kế thừa từ công bố của Fumihiro năm 2002 nên vẫn gọi là phân týp E nhưng thực chất hiện nay là CRF01-AE theo kết quả phân tích trình tự gen Kết quả kiểm chứng với giải trình tự gen cũng cho thấy độ tin cậy của mPCR trong nghiên cứu Ngoài phân týp E, trong kết quả của mPCR còn có 01 mẫu xác định phân týp A, 01 mẫu xác định phân týp. .. là phân týp E được hiểu thực chất là phân týp tái tổ hợp CRF01-AE Sau khi kiểm chứng kết quả phân týp E của mPCR, 5 mẫu còn lại có kết quả khác gồm 01 mẫu phân týp A, 01 mẫu phân týp B và 03 mẫu phân týp C được giải trình tự kiểm chứng 16 Bảng 3.3: Kết quả đối chiếu phân týp HIV-1 của 05 mẫu mPCR có kết quả khác phân týp E Như vậy kết quả giải trình tự xác nhận sự phù hợp chẩn đoán của kỹ thuật mPCR
- Xem thêm -

Xem thêm: Nghiên cứu ứng dụng mPCR để xác định phân týp của HIV1 ở Hà Nội Viêng Chăn (2007 2011), Nghiên cứu ứng dụng mPCR để xác định phân týp của HIV1 ở Hà Nội Viêng Chăn (2007 2011), Nghiên cứu ứng dụng mPCR để xác định phân týp của HIV1 ở Hà Nội Viêng Chăn (2007 2011)

Mục lục

Xem thêm

Gợi ý tài liệu liên quan cho bạn

Nạp tiền Tải lên
Đăng ký
Đăng nhập