29 106 0
  • Loading ...
1/29 trang

Thông tin tài liệu

Ngày đăng: 23/11/2016, 22:45

NGHIÊN CỨU TẠO CHỦNG ESCHERICHIA COLI CÓ KHẢ NĂNG SẢN XUẤT VANILLIN TỪ AXIT FERULICNGHIÊN CỨU TẠO CHỦNG ESCHERICHIA COLI CÓ KHẢ NĂNG SẢN XUẤT VANILLIN TỪ AXIT FERULICNGHIÊN CỨU TẠO CHỦNG ESCHERICHIA COLI CÓ KHẢ NĂNG SẢN XUẤT VANILLIN TỪ AXIT FERULICNGHIÊN CỨU TẠO CHỦNG ESCHERICHIA COLI CÓ KHẢ NĂNG SẢN XUẤT VANILLIN TỪ AXIT FERULICNGHIÊN CỨU TẠO CHỦNG ESCHERICHIA COLI CÓ KHẢ NĂNG SẢN XUẤT VANILLIN TỪ AXIT FERULIC BỘ GIÁO DỤC VÀ ĐÀO TẠO ĐẠI HỌC THÁI NGUYÊN BÁO CÁO TÓM TẮT ĐỀ TÀI KHOA HỌC VÀ CÔNG NGHỆ CẤP BỘ Tên đề tài: NGHIÊN CỨU TẠO CHỦNG ESCHERICHIA COLI CÓ KHẢ NĂNG SẢN XUẤT VANILLIN TỪ AXIT FERULIC Mã số: B2013-TN03-01 Chủ nhiệm đề tài: TS Dƣơng Văn Cƣờng Thái Nguyên, tháng 10 năm 2016 BỘ GIÁO DỤC VÀ ĐÀO TẠO ĐẠI HỌC THÁI NGUYÊN BÁO CÁO TÓM TẮT ĐỀ TÀI KHOA HỌC VÀ CÔNG NGHỆ CẤP BỘ Tên đề tài: NGHIÊN CỨU TẠO CHỦNG ESCHERICHIA COLI CÓ KHẢ NĂNG SẢN XUẤT VANILLIN TỪ AXIT FERULIC Mã số: B2013-TN03-01 Xác nhận tổ chức chủ trì Chủ nhiệm đề tài TS Dƣơng Văn Cƣờng Thái Nguyên, tháng 10 năm 2016 ĐỀ TÀI KHOA HỌC VÀ CÔNG NGHỆ CẤP BỘ NGHIÊN CỨU TẠO CHỦNG ESCHERICHIA COLI CÓ KHẢ NĂNG SẢN XUẤT VANILLIN TỪ AXIT FERULIC Mã số: B2013-TN03-01 Chủ nhiệm: TS Dương Văn Cường DANH SÁCH NHỮNG NGƢỜI THAM GIA THỰC HIỆN ĐỀ TÀI STT Họ tên TS Dương Văn Cường ThS Bùi Tuấn Hà TS Nguyễn Văn Duy ThS Lương Thị Thu Hường Ths Nguyễn Thị Tình Nội dung nghiên cứu đƣợc giao Đơn vị công tác Khoa Công nghệ sinh học Công nghệ thực phẩm, Trường Đại học Nông Lâm Thái Nguyên KS Ma Thị Trang - Chủ nhiệm đề tài - Thiết kế vector biểu - Thử nghiệm quy trình lên men - Tách dòng xác định trình tự gene gltA, fcs ech - Phân tích định tính định lượng sản phẩm vanillin tạo thành HPLC - Xác định điều kiện nuôi cấy tối ưu - Cảm ứng biểu gene đích - So sánh hệ vector/vật chủ để tìm hệ thống cho sản lượng cao - Biến nạp vector biểu chứa gene đích vào tế bào chủ Viện Khoa học sống, Đại học Thái Nguyên KS Vũ Hoài Nam MỤC LỤC DANH MỤC CÁC BẢNG vi DANH MỤC CÁC TỪ, CỤM TỪ VIẾT TẮT viii THÔNG TIN KẾT QUẢ NGHIÊN CỨU ix INFORMATION ON RESEARCH RESULTS xii PHẦN 1: MỞ ĐẦU PHẦN 2: TỔNG QUAN TÀI LIỆU PHẦN 3: MỤC TIÊU, ĐỐI TƢỢNG, PHẠM VI, CÁCH TIẾP CẬN, NỘI DUNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 3.1 Mục tiêu nghiên cứu 3.2 Đối tượng vật liệu nghiên cứu 3.2.1 Các chủng vi sinh vật 3.2.2 Các vector tách dòng biểu 3.2.3 Mồi khuếch đại gen gltA, fcs ech 3.2.4 Hóa chất, thiết bị 3.3 Phạm vi nghiên cứu 3.4 Cách tiếp cận 3.5 Nội dung nghiên cứu 3.6 Phương pháp nghiên cứu PHẦN 4: KẾT QUẢ VÀ THẢO LUẬN 4.1 Tách dòng giải trình tự gene mã hóa enzyme xúc tác đường sinh tổng hợp vanillin từ axit ferulic 4.1.1 Tách dòng gene gltA từ E coli DH5α 4.1.2 Tách dòng gene ech từ P fluorescens VTCC-B-668 4.1.3 Tách dòng gene fcs từ Amycolatopsis sp HR104 4.2 4.3 Thiết kế hai vector biểu chứa gen gltA, ech, fcs 4.4 Sinh tổng hợp vanillin từ axit fefulic sử dụng E coli tái tổ hợp làm tế bào chủ 4.4.1 Ảnh hưởng nồng độ axit ferulic đến sinh trưởng E coli 4.4.2 Xác định axit ferulic tồn dư vanillin tổng hợp hệ thống pET22 4.5 Ảnh hưởng điều kiện nuôi cấy lên suất sinh tổng hợp vanillin 4.5.1 Ảnh hưởng thời gian nuôi cấy 4.5.2 So sánh môi trường LB, M9 2YT 4.5.3 Ảnh hưởng nồng độ chất cảm ứng IPTG 4.6 So sánh hiệu suất sinh tổng hợp vanillin hai hệ vector pET22 pRSET 10 4.7 Lên men E coli sinh tổng hợp vanillin thu hồi sản phẩm 11 4.7.1 So sánh hai quy trình lên men 11 4.7.2 Thu hồi sản phẩm vanillin 11 4.8 So sánh hiệu suất sinh tổng hợp vanillin hệ thống pET22-GEF với nghiên cứu tương đồng giới 12 PHẦN 5: KẾT LUẬN VÀ KIẾN NGHỊ 14 5.1 Kết luận 14 5.2 Kiến nghị 14 TÀI LIỆU THAM KHẢO 15 DANH MỤC CÁC BẢNG Bảng 3.1: Trình tự mồi khuếch đại gen Bảng 4.1 So sánh hiệu suất sinh tổng hợp vanillin nghiên cứu với nghiên cứu tương đồng giới 13 DANH MỤC HÌNH Hình 2.1: Con đường sinh tổng hợp vanillin từ acid ferulic Hình 4.1 Cấu trúc hai vector tái tổ hợp Hình 4.2: Ảnh hưởng nồng độ axit ferulic ban đầu với sinh trưởng E coli tái tổ hợp mang vector pET22-GEF Hình 4.3: Phân tích HPLC động học chuyển hóa axit ferulic thành vanillin chủng E coli BL21(DE3) tái tổ hợp mang vector pET22-GEF Hình 4.4: Ảnh hưởng thời gian nuôi cấy tới khả sinh trưởng sinh tổng hợp vanillin chủng E coli tái tổ hợp Hình 4.5: So sánh khả sinh trưởng sinh tổng hợp vanillin E coli tái tổ hợp môi trường LB, M9 2YT Hình 4.6: Ảnh hưởng nồng độ IPTG đến sinh tổng hợp vanillin 10 Hình 4.7 So sánh hiệu suất sinh tổng hợp vanillin từ chất axit ferulic sử dụng chủng E coli tái tổ hợp mang vector pET22-GEF pRSET-GEF 10 Hình 4.8 So sánh hiệu suất sinh tổng hợp vanillin hai phương pháp lên men 11 Hình 4.9 Tinh thể vanillin thu nhận sau chiết xuất 11 DANH MỤC CÁC TỪ, CỤM TỪ VIẾT TẮT 4-CL ATP Bp CCl4 CoA ĐHQGH DNA DNA-PK DNA-PK dNTP E coli EDTA HCLC IPTG Kb LB NCBI PCR SDS TAE TCA VAO X-gal : 4-hydroxycinnamate-CoA ligase : Adenosine triphosphate : Base pair : Carbon tetrachloride : Coenzyme Acetoacetyl : Đại học quốc gia Hà Nội : Deoxyribonucleic acid : DNA protein kinase : DNA protein kinase : Deoxyribonucleotide triphosphate : Escherichia coli : Etilenduamin tetraacetic acid : 4-hydroxycinnamate CoA-hydratase/lyase : Isopropy Thyogalactoside : Kilo base : Lauria Broth : NationCenter for Biotechnology Information : Polymerase Chain Reaction : Sodium doecyl sulfat : Tris acetate EDTA : Tricarboxylic acid : Vanillyl alcohol oxidase : 5-bromo-4chloro-3indoly-β-D-galactoside Mẫu 21 Thông tin kết nghiên cứu đề tài khoa học công nghệ cấp BỘ GIÁO DỤC VÀ ĐÀO TẠO ĐẠI HỌC THÁI NGUYÊN THÔNG TIN KẾT QUẢ NGHIÊN CỨU Thông tin chung: - Tên đề tài: Nghiên cứu tạo chủng Escherichia coli có khả sản xuất vanillin từ axit ferulic - Mã số: B2013-TN03-01 - Chủ nhiệm đề tài: TS Dương Văn Cường - Tổ chức chủ trì: Đại học Thái Nguyên - Thời gian thực hiện: Từ 01/2013 đến 06/2016 Mục tiêu: Sử dụng công cụ kỹ thuật di truyển để cải biến E coli tự nhiên BL21(DE3) tạo chủng tái tổ hợp có khả sinh tổng hợp vanillin từ chất axit ferulic Tính sáng tạo: Đề tài nghiên cứu nước tạo chủng vi khuẩn E coli tái tổ hợp mang ba gen mã hóa cho ba enzyme xúc tác đường sinh tổng hợp axit ferulic thành vanillin Kết nghiên cứu: - Đã tách dòng giải trình tự thành công ba gen mã hóa đường sinh tổng hợp vanillin từ axit ferulic, bao gồm: o Gen gltA mã hóa enzyme citrate synthase từ E coli DH5α chịu trách nhiệm chuyển hoá acetyl-CoA thành CoA o Gen fcs mã hóa enzyme feruloyl-CoA synthase từ Amycolatopsis sp HR104 (DSM 9991) chịu trách nhiệm chuyển hóa axit ferulic thành feruloyl-CoA o Gen ech mã hóa enzyme enoyl-CoA hydratase/aldolase từ P fluorescens VTCCB-668 chịu trách nhiệm chuyển hóa feruloyl-CoA thành vanillin - Đã thiết kế thành công hai vector biểu mang operon đa cistron (multicistronic operon) chứa gene gltA-ech-fcs: o Vector pRSET-GEF o Vector pET22-GEF - Đã biến nạp vector biểu vào E coli BL21(DE3) cảm ứng biểu gen đích mã hóa enzyme chuyển hóa axit ferulic thành vanillin - Đã phân tích hiệu suất sinh tổng hợp vanillin E coli tái tổ hợp phương pháp HPLC Hệ thống pET22-GEF pRSET-GEF đạt hiệu suất 1.44 g/L 1.17 g/L - Đã xác định điều kiện thích hợp cho sinh tổng hợp vanillin: o Nồng độ axit ferulic: g/L o Thời gian nuôi cấy: 36 h o Môi trường nuôi cấy: LB o Nồng độ chất cảm ứng IPTG: 0.5 mM - Đã thiết lập quy trình lên men E coli sinh tổng hợp vanillin từ axit ferulic có hiệu suất đạt 1.42 ± 0.13 (sử dụng bình tam giác) 1.53 ± 0.06 (sử dụng hệ thống Labfors) - Đã thu hồi 100 gram vanillin từ dịch lên men E coli Sản phẩm: 5.1 Sản phẩm đào tạo: Đào tạo sau đại học: 01 luận văn thạc sỹ ngành Sinh học thực nghiệm - Học viên Ma Thị Trang Tên luận văn: “Nghiên cứu tạo chủng Escherichia coli có khả sản xuất vanillin từ axit ferulic” Đào tạo đại học: 03 khóa luận tốt nghiệp đại học ngành Công nghệ Sinh học - Sinh viên Lê Thị Quỳnh Hoa Tên khóa luận: “Thiết kế vector biểu gen mã hóa enzyme sinh tổng hợp vanillin E coli” - Sinh viên Nguyễn Thị Thu Hường Tên khóa luận: “Tách dòng xác định trình tự gene gltA mã hóa cho enzyme citrate synthase từ vi khuẩn E coli” - Sinh viên Hoàng Thị Thúy Quỳnh Tên khóa luận: “Tách dòng giải trình tự gene mã hóa enzyme feruloyl-coa synthase từ chủng Amycolatopsis sp HR104” 5.2 Sản phẩm khoa học: 02 báo khoa học - Ma Thị Trang, Lương Thị Thu Hường, Lê Thị Quỳnh Hoa, Dương Văn Cường (2015), “Tách dòng, giải trình tự thiết kế vector biểu gien mã hóa enzym tổng hợp vanillin từ axit ferulic”, Tạp chí Nông nghiệp Phát triển nông thôn, tập 11, Tr 274-283 - Dương Văn Cường, Lê Thị Quỳnh Hoa (2016), “Sinh tổng hợp vanillin từ axit ferulic sử dụng E coli tái tổ hợp”, Tạp chí Nông nghiệp Phát triển nông thôn, tập 94, Tr 68-75 PHẦN 1: MỞ ĐẦU Vanillin (3-methoxy-4-hydroxybenzaldehyde) chất thơm quan trọng sử dụng phổ biến giới công nghiệp thực phẩm, đồ uống, nước hoa, dược phẩm dinh dưỡng [4] Mức độ tiêu thụ vanillin hàng năm giới vào khoảng 12000 Vanillin sản xuất chủ yếu từ nguồn tách chiết vỏ loài lan Vanilla planifolia tổng hợp nhân tạo từ eugenol, lignin… Trong đó, vanillin tách chiết từ thực vật đáp ứng 1% nhu cầu thị trường, lại tổng hợp hóa học Giá trị kinh tế vanillin tự nhiên từ Vanilla planifolia có giá lên tới 4000 đôla kilogam, trái lại vanillin nhân tạo vào khoảng 15 đôla kilogam [5] Sự khác biệt lớn giá trị vanillin tự nhiên với vanillin tổng hợp kích thích mối quan tâm ngành công nghiệp hương liệu để sản xuất vanillin tự nhiên Một số vi sinh vật có khả phân hủy acid ferulic để tạo vanillin Điểu yếu sinh vật tự nhiên sau tổng hợp vanillin lại bị phân hủy thành hợp chất khác trình lên men số xạ khuẩn thườnggặp khó khăn dịch nuôi cấy có độ nhớt cao sinh trưởng hệ sợi nấm bào tử E coli không gặp phải nhược điểm Trong nguồn chất sử dụng để sinh tổng hợp vanillin, acid ferulic quan tâm chất có nhiều thành tế bào thực vật hai mầm nên thu từ phế phụ phẩm nông nghiệp Từ luận điểm trên, đề tài thiết kế nhằm tạo chủng E coli tái tổ hợp chứa gene đường sinh tổng hợp vanillin từ axit ferulic có khả sản xuất vanillin tự nhiên từ axit ferulic PHẦN 2: TỔNG QUAN TÀI LIỆU Nghiên cứu tổng kết 91 tài liệu liên quan đến vấn đề nghiên cứu nước, bao gồm: (1) Giới thiệu vanillin, nguồn gốc, đặc tính sinh học, vai trò vanillin sản xuất công nghiệp đời sống (2) Các đường sinh tổng hợp vanillin (3) phương pháp sản xuất vanillin (4) tiềm ứng dụng công nghệ DNA tái tổ hợp sản xuất vanillin - - - - Hình 2.1: Con đường sinh tổng hợp vanillin từ acid ferulic Con đường sinh tổng hợp vanillin theo thiết kế đề tài minh họa hình 2.1 Để tổng hợp vanillin theo đường tái tổ hợp cần tách dòng gene mã hóa cho enzyme có khả phân giải chất thành vanillin từ vi sinh vật biết, sau đưa gene vào vector biểu hiện, biến nạp vào tế bào vật chủ thích hợp cho phép biểu Các gen mã hóa enzyme sinh tổng hợp vanillin xác định gene fcs mã hóa enzyme feruloyl-coA synthetase gene ech mã hóa enzyme enoyl-CoA hydratase/aldolase Vi khuẩn E coli lựa chọn mang gene mã hóa enzyme sinh tổng hợp vanillin, nhiên tế bào E coli mang vector tái tổ hợp chứa gene fcs ech điều kiện có acid ferulic tạo vanillin có tượng tích lũy acety-CoA tế bào Hiện tượng làm giảm nồng độ vanillin tạo thành thiếu hụt CoA cho phản ứng chuyển hóa acid ferulic thành feruloyl-CoA, dẫn đến dư thừa chất gây ức chế phản ứng Để khắc phục vấn đề cần bổ sung thêm gen gltA mã hóa cho enzyme citrate synthase có vai trò tăng cường tiêu thụ acetyl-CoA để tạo nhiều CoA từ giúp chuyển hóa tối đa lượng acid ferulic Như để tăng cường hiệu suất sản xuất vanillin E coli cần kết hợp ba gen fcs, ech, gltA hệ thống vector biểu điều kiện nuôi cấy tối ưu hóa PHẦN 3: MỤC TIÊU, ĐỐI TƢỢNG, PHẠM VI, CÁCH TIẾP CẬN, NỘI DUNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 3.1 Mục tiêu nghiên cứu Mục tiêu đề tài sử dụng kĩ thuật di truyền để tạo chủng vi khuẩn E coli tái tổ hợp chứa gene đường sinh tổng hợp vanillin từ axit ferulic có khả sản xuất vanillin tự nhiên từ axit ferulic 3.2 Đối tƣợng vật liệu nghiên cứu 3.2.1 Các chủng vi sinh vật Chủng Pseudomonas fluorescens VTCC-B-668 cung cấp phòng Bảo tàng giống chuẩn Vi sinh vật – Viện Vi sinh vật công nghệ sinh học, ĐHQGHN Chủng Amycolatopsis sp HR104 cung cấp Ngân hàng giống chuẩn Đức DSMZ (mã số chủng DSM 9991) Chủng vi khuẩn E coli DH5α cung cấp hãng Thermo Scientific Chủng vi khuẩn E coli BL21(DE3) cung cấp hãng Invitrogen 3.2.2 Các vector tách dòng biểu - Vector tách dòng pTZ57R/T (Thermo Scientific) - Vector biểu pRSET-A pET22b(+) (Invitrogen) 3.2.3 Mồi khuếch đại gen gltA, fcs ech Chúng sử dụng cặp mồi thiết kế dựa vào trình tự gen công bố NCBI Bảng 3.1: Trình tự mồi khuếch đại gen Tên mồi Trình tự gltA-F 5'TGAGCTCAGAAGGATATACATATGGCTGATACAAAA3' gltA-R 5'AAAGCTTTTAACGCTTGATATCGCTTT3' Ech-F 5'AGAATTCAGGAGGGCATCGCCATGAGCAACTACGA3' Ech-R 5'GCGAGCTCTCAGCGTTTATACGCCTGCAG3' Fcs-F 5'TAATGCGCAACCAGGGTCTG3' Fcs-R 5'ACCGTCACAGAGTAGCCGCA3' 3.2.4 Hóa chất, thiết bị Đề tài sử dụng loại hóa chất tinh khiết chuyên dụng sinh học cung cấp hãng cung cấp hóa chất uy tín từ nước Đức, Tây Ban Nha, Thụy Điển Một số sản phẩm cung cấp hãng Thermo Scientific enzyme T4 ligase, kit tách chiết DNA từ gel MEGA- spinTM Agarose Gel Extraction Kit, enzyme giới hạn, enzyme Taq DNA polymerase… Các thiết bị sử dụng nghiên cứu bao gồm thiết bị chuyên dụng đại phòng thí nghiệm Sinh học phân tử công nghệ gen Viện Khoa học sống, Đại học Thái Nguyên 3.3 Phạm vi nghiên cứu Địa điểm: Viện Khoa học sống, Đại học Thái Nguyên Thời gian: Đề tài thực từ tháng 1/2013 đến tháng 06/2016 3.4 Cách tiếp cận Chúng tiếp cận cách tách dòng ba gene gltA, fcs ech từ số chủng vi sinh vật cho hiệu suất tổng hợp vanillin cao dựa vào tài liệu báo cáo trước đó, điển hình Amycolatopsis sp P fluorescens Ba gene đưa vào vector biểu pET22b(+) pRSET-A để cảm ứng sinh tổng hợp vanillin từ chất axit ferulic 3.5 Nội dung nghiên cứu Tách dòng gene Thiết kế vector biểu mang genes gltA, ech fcs Đưa vector vào tế bào chủ, cảm ứng biểu gene đích Phân tích vanillin sản phẩm tạo thành Xác định hệ thống vector/vật chủ tối ưu Xác định điều kiện nuôi cấy thích hợp Thử nghiệm tối ưu quy trình lên men 3.6 Phƣơng pháp nghiên cứu Các phương pháp sinh học phân tử Đề tài sử dụng số kỹ thuật sinh học phân tử tách dòng thiết kế vector biểu bao gồm: - Tách chiết DNA tổng số từ vi sinh vật - Điện di gel agarose - PCR - Cắt DNA enzyme giới hạn - Nối DNA enzyme T4 ligase - Thu nhận DNA từ gel agarose - Biến nạp E coli sốc nhiết - Giải trình tự DNA - Cảm ứng biểu IPTG - Phân tích SDS-Page Phương pháp phân tích vanillin Vanillin sản phẩm tạo thành từ axit ferulic xúc tác enzyme feruloyl-CoA synthase enoyl-CoA hydratase/aldolasedo E coli tái tổ hợp tạo phân tích định tính định lượng phương pháp HPLC Phương pháp lên men thu nhận vanillin thành phẩm Lên men E coli sinh tổng hợp vanillin bổ sung chất axit ferulic thực theo hai phương pháp nuôi lắc bình tam giác sử dụng hệ thống lên men Labfos Vanillin sản phẩm thu nhận theo phương pháp Krueger có cải tiến PHẦN 4: KẾT QUẢ VÀ THẢO LUẬN 4.1 Tách dòng giải trình tự gene mã hóa enzyme xúc tác đƣờng sinh tổng hợp vanillin từ axit ferulic 4.1.1 Tách dòng gene gltA từ E coli DH5α Gene gltA tách dòng từ vi khuẩn E coli DH5α xác định trình tự có kích thước 1284 bp Vị trí cắt enzyme giới hạn đầu gene bảo toàn Kết phân tích NCBI BLAST cho thấy trình tự gene gltA tách dòng có độ tương đồng 100% với trình tự gene gltA E coli sp K-12 MC4100 mã số HG7388671 Trình tự gene gltA dịch mã in silico cho thấy gene dịch mã thành công, đảm bảo cho biểu gene E coli 4.1.2 Tách dòng gene ech từ P fluorescens VTCC-B-668 Kết giải trình tự gen ech plasmid pTZ-ech cho thấy ba mở đầu ATG ba kết thúc TGA bảo toàn, kích thước đoạn gen 831 bp với kích thước gen ech dùng để thiết kế mồi, vị trí cắt enzyme giới hạn đầu gene giữ nguyên không đột biến Như vị trí quan trọng thiết kế mồi bảo toàn sở đảm bảo cho công việc thành công gen ech biểu vi khuẩn E coli 4.1.3 Tách dòng gene fcs từ Amycolatopsis sp HR104 Gene fcs có độ dài 1476 bp có ba mã mở đầu (ATG) mã kết thúc (TGA) bảo toàn Dịch mã in silico gene fcs tách dòng không xuất mã kết thúc gene Gene fcs tách dòng từ Amycolatopsis sp HR104 tương đồng 99% với chủng Amycolatopsis sp HR167 Genebank (mã số AJ290449.1) Như tách dòng thành công gene fcs sử dụng để thiết kế vector biểu 4.2 4.3 Thiết kế hai vector biểu chứa gen gltA, ech, fcs Các phương pháp sinh học phân tử sử dụng để tạo vector tái tổ hợp mang gen gltA, ech, fcs tảng vector pET22b(+) pRSET-A Kết thu hai vector tái tổ hợp có cấu trúc sau: T7 terminator HindIII (174) gltA pBR322 origin ech pET22-GEF EcoRI (2331) 9420 bp fcs lacI BamHI (4121) T7 promoter Vector pET-GEF Vector pRSET-GEF Hình 4.1: Cấu trúc hai vector tái tổ hợp 4.4 Sinh tổng hợp vanillin từ axit fefulic sử dụng E coli tái tổ hợp làm tế bào chủ 4.4.1 Ảnh hưởng nồng độ axit ferulic đến sinh trưởng E coli Nồng độ axit ferulic cao gây ảnh hưởng xấu đến sinh trưởng E coli [3], [5] Để tối ưu hóa suất sinh tổng hợp vanillin từ axit ferulic trước hết phải xác định nồng độ axit ferulic tối đa bổ sung vào môi trường nuôi cấy mà không ảnh hưởng đến sinh trưởng tế bào Dải nồng độ axit ferulic ban đầu lựa chọn thử nghiệm nằm khoảng g/L đến g/L theo số nghiên cứu trước [3], [5] Axit ferulic bổ sung vào dịch nuôi cấy OD260nm đạt 0.6 nuôi tiếp 36 tiếng, khoảng thời gian nuôi cấy sinh tổng hợp vanillin tối đa [3] Hình 4.2: Ảnh hưởng nồng độ axit ferulic ban đầu với sinh trưởng E coli tái tổ hợp mang vector pET22-GEF Kết hình 4.2 cho thấy nồng độ axit ferulic g/L nồng độ cao sử dụng mà gây ảnh hưởng đến sinh trưởng tế bào E coli Kết phù hợp với công bố trước [3] Nồng độ g/L axit ferulic lựa chọn cho bước tối ưu hóa 4.4.2 Xác định axit ferulic tồn dư vanillin tổng hợp hệ thống pET22 Dòng E coli tái tổ hợp chủng BL21(DE3) mang vector pET22-GEF sử dụng để sinh tổng hợp vanillin từ acid ferulic Kết thể hình 4.3 Hình 4.3: Phân tích HPLC động học chuyển hóa axit ferulic thành vanillin chủng E coli BL21(DE3) tái tổ hợp mang vector pET22-GEF (I) chất ferulic axit vanillin chuẩn; (II) chuyển hóa axit ferulic (FA) thành vanillin (VA) sau 12 nuôi cấy; (III) chuyển hóa FA thành VA sau 36 nuôi cấy.Axit ferulic (3 g/L) IPTG (1 mM) bổ sung vào dịch nuôi cấy thời điểm 4h OD600nm đạt 0.4 Kết hình 4.3 cho thấy đỉnh tương ứng với hai chất chuẩn ferulic acid vanillin thể rõ ràng Hình 4.3.II III cho thấy lượng acid ferulic bổ sung vào dịch nuôi cấy bị giảm theo thời gian sử dụng làm chất để chuyển hóa thành vanillin Lượng vanillin sản phẩm tạo thành tăng tương ứng theo thời gian Kết cho thấy hệ thống sinh tổng hợp vanillin từ chất axit ferulic sử dụng tế bào E coli tái tổ hợp thiết kế hoạt động thành công 4.5 Ảnh hƣởng điều kiện nuôi cấy lên suất sinh tổng hợp vanillin Các điều kiện nuôi cấy có ảnh hưởng đến hiệu suất sinh tổng hợp vanillin từ axit ferulic Chúng thử nghiệm số điều kiện bao gồm loại môi trường nuôi cấy, nồng độ chất cảm ứng thời gian nuôi cấy 4.5.1 Ảnh hưởng thời gian nuôi cấy Trong số nghiên cứu trước [3], [7] tác giả tìm thời gian nuôi cấy tối ưu cho sinh tổng hợp vanillin E coli tái tổ hợp 36 tiếng Tuy nhiên, hệ vector sử dụng nghiên cứu dựa pBAD pBluescript khác với hệ thống pRSET pET đề tài này, tiến hành đánh giá lại thời gian nuôi cấy tối ưu Hình 4.4: Ảnh hưởng thời gian nuôi cấy tới khả sinh trưởng sinh tổng hợp vanillin chủng E coli tái tổ hợp Kết hình 4.4 cho thấy mốc 12h sinh trưởng tế bào đạt mức cao nhiên lượng vanillin tạo thành thấp Từ 12h trở sinh trưởng tế bào giảm dần Tại thời điểm 36h sinh trưởng tế bào mức thấp hàm lượng vanillin tạo thành tích tụ đạt mức tối đa Nuôi thêm lên mốc thời gian 42h hàm lượng vanillin giảm mối tương quan lượng vanillin sinh tổng hợp với lượng vanillin bị phân hủy trở nên bất lợi sinh trưởng tế bào đạt mức thấp Kết đồng thuận với nghiên cứu trước [3], [7] Điều cho thấy yếu tố thời gian nuôi cấy không chịu chi phối hệ vector khác mà chất sinh học tế bào vật chủ, E coli, chất hóa học vanillin Thời gian nuôi 36h lựa chọn cho bước 4.5.2 So sánh môi trường LB, M9 2YT Các nghiên cứu trước cho thấy thành phần môi trường có ảnh hưởng tới sinh tổng hợp vanillin Trong nghiên cứu thử nghiệm loại môi trường bao gồm môi trường tiêu chuẩn LB, môi trường tối thiểu nghèo carbon M9 môi trường giàu dinh dưỡng 2YT Hình 4.5: So sánh khả sinh trưởng sinh tổng hợp vanillin E coli tái tổ hợp môi trường LB, M9 2YT Hình 4.5 cho thấy sinh trưởng E coli thấp môi trường tối thiểu M9 đồng thời tỉ lệ thuận với lượng vanillin tạo thành Tuy nhiên, môi trường giàu dinh dưỡng 2YT, sinh trưởng tế bào tốt hai môi trường LB M9 lượng vanillin tạo thành lại không LB Kết cho thấy môi trường cân dinh dưỡng LB phù hợp việc nuôi cấy E coli tái tổ hợp để sinh tổng hợp vanillin Môi trường LB lựa chọn cho thí nghiệm 4.5.3 Ảnh hưởng nồng độ chất cảm ứng IPTG Ở thí nghiệm trước sử dụng nồng độ IPTG mM theo đề xuất nhà cung cấp vector Trong thí nghiệm bố trí dãy nồng độ IPTG nhằm tìm nồng độ tối thiểu đáp ứng nhiệm vụ cảm ứng biểu gene đích gltA, ech fcs xúc tác sinh tổng hợp vanillin 10 Hình 4.6: Ảnh hưởng nồng độ IPTG đến sinh tổng hợp vanillin Kết hình 4.6 cho thấy lượng vanillin tạo thành cao đạt 1.6 g/L cảm ứng nồng độ IPTG mM Tuy nhiên, nồng độ IPTG 0.5 mM tạo thành lượng vanillin lên tới 1.52 g/L, vượt trội hoàn toàn so với mức 0.7 g/L nồng độ IPTG 0.2 mM Mức chênh lệch lượng vanillin sản phẩm cảm ứng nồng độ IPTG 0.5 mM mM không thật lớn, lượng IPTG cần dùng chênh lần Vì vậy, sử dụng nồng độ IPTG 0.5 mM cho bước 4.6 So sánh hiệu suất sinh tổng hợp vanillin hai hệ vector pET22 pRSET Dựa phân tích chuyển hóa chủng E coli BL21(DE3)/pET-GEF, tiến hành phân tích tương tự với chủng E coli BL21(DE3) tái tổ hợp mang vector pRSET-GEF Hiệu chuyển hóa axit ferulic thành vanillin hai hệ thống vector so sánh hình 4.7 Hình 4.7 So sánh hiệu suất sinh tổng hợp vanillin từ chất axit ferulic sử dụng chủng E coli tái tổ hợp mang vector pET22-GEF pRSET-GEF Hình 4.7 cho thấy hệ thống biểu tảng vector pET22b(+) có hiệu suất sinh tổng hợp vanillin đạt 1.44 g/L cao so với mức 1.17 g/L vector pRSET-A Hiệu suất sinh tổng hợp vanillin nghiên cứu cao mức 580 mg/L [7] gene gltA chưa sử dụng Dữ liệu góp phần khẳng định vai trò gene gltA sinh tổng hợp vanillin E coli tái tổ hợp gene giúp tái sử dụng acetylCoA theo chu trình [3] 11 4.7 Lên men E coli sinh tổng hợp vanillin thu hồi sản phẩm Các điều kiện lên men có ảnh hưởng đến suất sinh tổng hợp vanillin Chúng thử nghiệm hai quy trình lên men 4.7.1 So sánh hai quy trình lên men Hình 4.8: So sánh hiệu suất sinh tổng hợp vanillin hai phương pháp lên men Kết hình 4.8 cho thấy hiệu suất sinh tổng hợp vanillin hai phương pháp (1) sử dụng bình tam giác (2) sử dụng hệ thống Labfors đạt mức 1.42 ± 0.13 1.53 ± 0.06 Kết cho thấy hệ thống lên men Labfors cho hiệu suất lên men cao ổn định so với hệ thống sử dụng bình tam giác Tuy nhiên, phòng thí nghiệm có điều kiện hạn chế, việc sử dụng bình tam giác mắc lắc ổn nhiệt thông dụng để lên men E coli tái tổ hợp sinh tổng hợp vanilin lựa chọn hiệu 4.7.2 Thu hồi sản phẩm vanillin Vanillin dịch tinh chế theo phương pháp Krueger [2] có cải tiến Tinh thể vanillin thu nhận, nghiền mịn bảo quản 4oC Hình 4.9: Tinh thể vanillin thu nhận sau chiết xuất 12 4.8 So sánh hiệu suất sinh tổng hợp vanillin hệ thống pET22-GEF với nghiên cứu tƣơng đồng giới Mặc dù nghiên cứu đạt mục tiêu sinh tổng hợp vanillin từ chất axit ferulic E coli tái tổ hợp, nhiên để ứng dụng vào thực tiễn cần đầu tư nghiên cứu sâu để tăng hiệu suất chuyển hóa So sánh với nghiên cứu khác giới có mục tiêu sinh tổng hợp vanillin từ chất axit ferulic sử dụng vật chủ E coli tái tổ hợp, hiệu suất hệ thống pET22-GEF nghiên cứu mức trung bình Bảng 4.1 cho thấy chưa áp dụng biện pháp tăng cường, hệ thống biểu thiết kế mang gene ech, fcs gltA đạt mức 1.53 g/L cao đáng kể so với nghiên cứu khác sử dụng hai gen ech fcs thấp so với hệ thống mang đủ gen pTAHEF-gltA [3] Điều lý giải gen sử dụng hệ thống lấy từ sinh vật khác với hệ thống pTAHEF-gltA Như vậy, hướng nghiên cứu bao gồm việc tối ưu hóa codon gen ech gltA cho phù hợp với hệ biểu E coli tiếp tục tìm kiếm gen từ nguồn sinh vật khác Khi áp dụng biện pháp nhằm tăng cường hiệu suất sinh tổng hợp, hệ thống biểu cho thấy mức tăng đáng kể, gấp 2.5 đến lần Một bất lợi phương pháp E coli bị gây độc chất axit ferulic sản phẩm vanillin XAD-2 chất hấp thụ vanillin Sử dụng XAD-2 để hấp thụ vanillin khỏi môi trường nuôi cấy giúp giảm độc cho tế bào vật chủ E coli, nhờ tăng hiệu suất sinh tổng hợp [6] Dựa liệu này, dự kiến hiệu suất hệ thống pET22-GEF áp dụng XAD-2 để hấp thụ vanillin giảm độc cho E coli tăng lên cao mức 1.53 g/L Nhằm mục tiêu giải độc cho E coli, việc sử dụng chất hấp thụ áp dụng phương pháp tạo đột biến ngẫu nhiên NTG để sàng lọc chủng E coli kháng vanillin và/hoặc axit ferulic Sử dụng chủng sàng lọc làm tế bào vật chủ biểu giúp tăng cường tính chống chịu với chất sản phẩm, từ tăng hiệu suất sinh tổng hợp [6] hướng tới áp dụng quy trình lên men liên tục Trong nghiên cứu điều hướng trao đổi chất nói chung sinh tổng hợp vanillin nói riêng, chiến lược bất hoạt đường trao đổi chất cạnh tranh để dồn nguồn lực trao đổi chất cho sản phẩm đích Bất hoạt gen icdA mã hóa enzyme isocitrate dehydrogenase chu trình TCA làm tăng cường chuyển hóa acetyl-coA thành CoA áp dụng tăng hiệu suất sinh tổng hợp vanillin lên 2.6 lần [3] 13 Bảng 4.1: So sánh hiệu suất sinh tổng hợp vanillin nghiên cứu với nghiên cứu tương đồng giới STT Hiệu suất tổng hợp vanillin trƣớc sau áp dụng biện pháp tăng cƣờng Trƣớc Sau 580 mg/L Các gen sử dụng Nghiên cứu ech fcs [5] [7] 1.1 g/L ech fcs 1.53 g/L ech, fcs gltA Nghiên cứu 2.52 g/L Phương pháp tăng cường: Lên men đáp ứng bề mặt ech fcs [1] ech fcs [6] ech, fcs gltA [3] 2.9 g/L Phương pháp tăng cường: 1.0 g/L 1Chủng đột biến kháng vanillin NTG-VR1 Chất hấp thụ vanillin XAD-2 5.14 g/L 1.98 g/L Phương pháp tăng cường: Chủng đột biến icdA Chất hấp thụ vanillin XAD-2 14 PHẦN 5: KẾT LUẬN VÀ KIẾN NGHỊ 5.1 Kết luận - Đã tách dòng giải trình tự thành công ba gen mã hóa đường sinh tổng hợp vanillin từ axit ferulic - Đã thiết kế thành công hai vector biểu mang operon đa cistron (multicistronic operon) chứa gene gltA-ech-fcs: o Vector pRSET-GEF o Vector pET22-GEF - Đã biến nạp vector biểu vào E coli BL21(DE3) cảm ứng biểu gen đích mã hóa enzyme chuyển hóa axit ferulic thành vanillin - Phân tích hiệu suất sinh tổng hợp vanillin E coli tái tổ hợp phương pháp HPLC Hệ thống pET22-GEF pRSET-GEF đạt hiệu suất 1.44 g/L 1.17 g/L - Đã xác định điều kiện thích hợp cho sinh tổng hợp vanillin: o Nồng độ axit ferulic: g/L o Thời gian nuôi cấy: 36 h o Môi trường nuôi cấy: LB o Nồng độ chất cảm ứng IPTG: 0.5 mM - Thiết lập quy trình lên men E coli sinh tổng hợp vanillin từ axit ferulic có hiệu suất đạt 1.42 ± 0.13 (sử dụng bình tam giác) 1.53 ± 0.06 (sử dụng hệ thống lên men Labfors) - Đã thu hồi 100 gram vanillin từ dịch lên men E coli 5.2 Kiến nghị Tiếp tục nghiên cứu tăng cường suất sinh tổng hợp vanillin theo hướng sau: - Bất hoạt đường trao đổi chất cạnh tranh để dồn nguồn lượng vật chất cho đường sinh tổng hợp vanillin - Giảm độc cho tế bào vật chủ cách (1) sử dụng chất hấp phụ; (2) chọn lọc chủng đột biến kháng vanillin/axit ferulic - Thiết lập quy trình lên men hiệu lên men đáp ứng bề mặt lên men liên tục 15 TÀI LIỆU THAM KHẢO Barghini Paolo, Diana Di Gioia, Fabio Fava, Maurizio Ruzzi (2007), "Vanillin production using metabolically engineered Escherichia coli under non-growing conditions", Microb Cell Fact 6(13) Krueger Dana A., Harold W Krueger (1985), "Detection of fraudulent vanillin labeled with 13C in the carbonyl carbon", J Agric Food Chem, vol 33, pp 323-325 Lee Eun‐Gyeong, Sang‐Hwal Yoon, Amitabha Das, Sook‐Hee Lee, Cui Li, Jae‐Yean Kim, Myung‐Suk Choi, Deok‐Kun Oh, Seon‐Won Kim (2009), "Directing vanillin production from ferulic acid by increased acetyl-CoA consumption in recombinant Escherichia coli", Biotechnol Bioeng, vol 102(1), pp 200-208 Ranadive A S (1994), "Vanilla cultivation, curing, chemistry, technology and commercial products", Developments in food science, vol 34, pp 517-577 Yoon S H., C Li, Y M Lee, S H Lee, S H Kim, M S Choi, W T Seo, J K Yang, J Y Kim, S W Kim (2005), "Production of vanillin from ferulic acid using recombinant strains of Escherichia coli", Biotechnology and Bioprocess Engineering, vol 10(4), pp 378-384 Yoon S H., E G Lee, A Das, S H Lee, C Li, H K Ryu, M S Choi, W T Seo, S W Kim (2007), "Enhanced vanillin production from recombinant E coli using NTG mutagenesis and adsorbent resin", Biotechnol Prog 23(5), pp.1143-1148 Yoon S H., C Li, J E Kim, S H Lee, J Y Yoon, M S Choi, W T Seo, J K Yang, J Y Kim, S W Kim (2005), "Production of vanillin by metabolically engineered Escherichia coli", Biotechnol Lett 27(22), pp 1829-1832 [...]... VI, CÁCH TIẾP CẬN, NỘI DUNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 3.1 Mục tiêu nghiên cứu Mục tiêu của đề tài là sử dụng kĩ thuật di truyền để tạo ra chủng vi khuẩn E coli tái tổ hợp chứa các gene của con đường sinh tổng hợp vanillin từ axit ferulic có khả năng sản xuất ra vanillin tự nhiên từ axit ferulic 3.2 Đối tƣợng và vật liệu nghiên cứu 3.2.1 Các chủng vi sinh vật Chủng Pseudomonas fluorescens VTCC-B-668 được... vanillin, acid ferulic được quan tâm vì chất này có nhiều trong thành tế bào của thực vật hai lá mầm nên có thể thu từ các phế phụ phẩm nông nghiệp Từ các luận điểm trên, đề tài này được thiết kế nhằm tạo chủng E coli tái tổ hợp chứa các gene của con đường sinh tổng hợp vanillin từ axit ferulic có khả năng sản xuất ra vanillin tự nhiên từ axit ferulic 2 PHẦN 2: TỔNG QUAN TÀI LIỆU Nghiên cứu tổng kết...5.3 Sản phẩm ứng dụng: - 01 quy trình tạo chủng vi khuẩn E coli tái tổ hợp mang vector biểu hiện chứa các gene gltA, fcs và ech - 02 chủng E coli BL21(DE3) tái tổ hợp có khả năng sinh tổng hợp vanillin từ axit ferulic mang các vector pRSET-GEF và pET22-GEF - 01 quy trình lên men E coli sinh tổng hợp vanillin từ axit ferulic - 100 gram vanillin 6 Phƣơng thức chuyển giao,... quả nghiên cứu: Đề tài tạo ra một phương pháp sản xuất vanillin chủ động từ cơ chất axit ferulic bằng vi khuẩn E coli tái tổ hợp Sản phẩm của đề tài có thể áp dụng ở những đơn vị có những trang thiết bị cơ bản gồm tủ lạnh âm sâu (để duy trì chủng giống), hệ thống lên men và một số thiết bị, hóa chất để chiết xuất vanillin Ngày 27 tháng 10 năm 2016 Tổ chức chủ trì (ký, họ và tên, đóng dấu) Chủ nhiệm đề. .. liên quan đến vấn đề nghiên cứu trong và ngoài nước, bao gồm: (1) Giới thiệu về vanillin, nguồn gốc, đặc tính sinh học, vai trò của vanillin trong sản xuất công nghiệp và đời sống (2) Các con đường sinh tổng hợp vanillin (3) các phương pháp sản xuất vanillin (4) tiềm năng ứng dụng công nghệ DNA tái tổ hợp trong sản xuất vanillin - - - - Hình 2.1: Con đường sinh tổng hợp vanillin từ acid ferulic Con đường... trúc hai vector tái tổ hợp 7 4.4 Sinh tổng hợp vanillin từ axit fefulic sử dụng E coli tái tổ hợp làm tế bào chủ 4.4.1 Ảnh hưởng của nồng độ axit ferulic đến sinh trưởng E coli Nồng độ axit ferulic cao gây ảnh hưởng xấu đến sinh trưởng của E coli [3], [5] Để tối ưu hóa năng suất sinh tổng hợp vanillin từ axit ferulic trước hết phải xác định được nồng độ axit ferulic tối đa bổ sung vào môi trường nuôi cấy... tiêu sinh tổng hợp vanillin từ cơ chất axit ferulic bằng E coli tái tổ hợp, tuy nhiên để có thể ứng dụng vào thực tiễn cần được đầu tư nghiên cứu sâu hơn để tăng hiệu suất chuyển hóa So sánh với các nghiên cứu khác trên thế giới có cùng mục tiêu sinh tổng hợp vanillin từ cơ chất axit ferulic sử dụng vật chủ E coli tái tổ hợp, hiệu suất của hệ thống pET22-GEF của nghiên cứu này ở mức trung bình Bảng... sinh tổng hợp vanillin từ acid ferulic Kết quả thể hiện trên hình 4.3 Hình 4.3: Phân tích HPLC động học sự chuyển hóa axit ferulic thành vanillin ở chủng E coli BL21(DE3) tái tổ hợp mang vector pET22-GEF (I) cơ chất ferulic axit và vanillin chuẩn; (II) sự chuyển hóa axit ferulic (FA) thành vanillin (VA) sau 12 giờ nuôi cấy; (III) sự chuyển hóa FA thành VA sau 36 giờ nuôi cấy .Axit ferulic (3 g/L) và IPTG... để hấp thụ vanillin giảm độc cho E coli có thể tăng lên cao hơn mức 1.53 g/L Nhằm mục tiêu giải độc cho E coli, ngoài việc sử dụng chất hấp thụ còn có thể áp dụng phương pháp tạo đột biến ngẫu nhiên bằng NTG để sàng lọc chủng E coli kháng vanillin và/hoặc axit ferulic Sử dụng chủng được sàng lọc làm tế bào vật chủ biểu hiện giúp tăng cường tính chống chịu với cơ chất và sản phẩm, từ đó có thể tăng... quy trình lên men E coli sinh tổng hợp vanillin từ axit ferulic có hiệu suất đạt 1.42 ± 0.13 (sử dụng bình tam giác) và 1.53 ± 0.06 (sử dụng hệ thống lên men Labfors) - Đã thu hồi được 100 gram vanillin từ dịch lên men E coli 5.2 Kiến nghị Tiếp tục nghiên cứu tăng cường năng suất sinh tổng hợp vanillin theo các hướng sau: - Bất hoạt con đường trao đổi chất cạnh tranh để dồn nguồn năng lượng và vật chất
- Xem thêm -


Gợi ý tài liệu liên quan cho bạn

Từ khóa liên quan

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay
Nạp tiền Tải lên
Đăng ký
Đăng nhập