Nghiên cứu cấu trúc di truyền một số dòng Citrus Tristeza Virus gây bệnh trên cây ăn quả chi Citrus ở Việt Nam

74 12 0
  • Loading ...
1/74 trang

Thông tin tài liệu

Ngày đăng: 23/11/2016, 21:00

LI CM N Tụi xin by t lũng bit n sõu sc ti TS Lõm i Nhõn ó tn tỡnh hng dn, giỳp tụi sut quỏ trỡnh thc hin ti Tụi cng xin by t lũng bit n chõn thnh ti GS.TS Lờ Trn Bỡnh, PGS.TS Chu Hong H ó to iu kin giỳp v úng gúp nhng ý kin quý bỏu tụi hon thnh bn lun Tụi xin by t lũng bit n ti cỏc thy, cụ Ban Giỏm Hiu trng HSP H Ni 2, Ban Ch nhim khoa Sinh KTNN trng HSP H Ni 2, Phũng T chc cỏn b, Phũng Sau i hc trng HSP H Ni ó to mi iu kin thi gian tụi hc chng trỡnh thc s Trong thi gian thc tụi cng nhn c s giỳp tn tỡnh ca Th.S ng Th Hng, Tp th cỏn b Phũng Cụng ngh t bo thc vt, Vin Cụng ngh sinh hc Nhõn dp ny tụi xin chõn thnh cm n s giỳp quý bỏu ú Tụi xin chõn thnh cm n gia ỡnh v bn bố nhng ngi ó luụn ng viờn, gúp ý cho tụi thi gian qua H Ni, thỏng 10 nm 2010 La Vit Hng MC LC LI CM N LI CAM OAN MC LC DANH MC BNG DANH MC HèNH DANH MC T VIT TT M U 1 Tớnh cp thit ca ti Mc tiờu nghiờn cu Nhim v nghiờn cu i tng v phm vi nghiờn cu NI DUNG CHNG TNG QUAN TI LIU 1.1 Ngun gc, phõn b v giỏ tr ca cõy cú mỳi 1.2 Nhng bnh thng gp cõy cú mỳi 1.2.1 Bnh vng lỏ thi r 1.2.2 Bnh hộo v cht cõy nm Clitocybe tabessens 1.2.3 Bnh vng lỏ Greening 1.2.4 Bnh Tristeza 1.2.4.1 Triu chng v phõn b ca bnh 1.2.4.2 C ch lan truyn v trung gian truyn bnh 10 1.2.4.3 Virus Citrus Tristeza 11 1.2.4.4 Chun oỏn v phũng chng bnh 13 1.3 Mt s k thut sinh hc phõn t 15 1.3.1 K thut RT-PCR 15 1.3.2 K thut PCR 15 1.3.3 K thut bin np plasmide vo E.coli 16 1.3.4 K thut tỏch dũng 17 1.3.5 K thut PCR trc tip t khun lc 19 1.3.6 K thut xỏc nh trỡnh t nucleotide 19 1.3.7 X lớ s liu 20 CHNG VT LIU V PHNG PHP NGHIấN CU 22 2.1 Vt liu nghiờn cu 22 2.1.1 Vt liu thc vt 22 2.1.2 Húa cht v thit b 22 2.2 Phng phỏp nghiờn cu 23 2.2.1 S thớ nghim 23 2.2.2 Phng phỏp nghiờn cu 23 CHNG KT QU V THO LUN 31 3.1 Thit k mi 31 3.2 Tỏch RNA tng s 32 3.3 Nhõn dũng cỏc on gen 33 3.4 Tỏch dũng gen v xỏc nh trỡnh t gen 34 3.4.1 To plasmide tỏi t hp 34 3.4.2 Bin np vector tỏi t hp vo t bo kh bin E.coli DH5 35 3.4.3 Chn lc plasmide tỏi t hp bng phng phỏp colony-PCR 36 3.4.4 Tỏch plasmide v ct kim tra gen bng enzyme gii hn 37 3.4.5 Xỏc nh trỡnh t cỏc on A, F, P ca CTV cỏc mu CT, HG, 38 HN v VL KT LUN V KIN NGH 45 Kt lun 45 ngh 45 TI LIU THAM KHO 46 PH LC 52 LI CAM OAN Tụi xin cam oan õy l cụng trỡnh nghiờn cu ca riờng tụi Cỏc s liu, kt qu nghiờn cu lun l trung thc v cha c cụng b DANH MC BNG Bng 1.1 Thnh phn dinh dng ca cam, quýt, chanh v bi Bng 1.2 Hm lng vitamin qu cam, chanh, quýt, bi (mg/100g) Bng 2.1 Thnh phn mụi trng LB c, lng Bng 2.2 Chu k nhit cho phn ng tng hp cDNA Bng 2.3 Thnh phn phn ng PCR khuch i gen Bng 2.4 Chu k nhit cho phn ng PCR khuch i gen Bng 2.5 Thnh phn phn ng gn gen vo vector Bng 2.6 Thnh phn phn ng PCR c trỡnh t nucleotide Bng 2.7 Chu k nhit cho phn ng PCR c trỡnh t nucleotide Bng 3.1 Trỡnh t cỏc cp mi c hiu cho CTV Bng 3.2 H s tng ng v trỡnh t nucleotide on A gia CT, HG, HN v VL Bng 3.3 H s tng ng v trỡnh t nucleotide on F gia CT, HG, HN v VL Bng 3.4 H s tng ng v trỡnh t nucleotide on P gia CT, HG, HN v VL DANH MC HèNH Hỡnh 1.1 Triu chng virus Citrus Tristeza gõy Hỡnh 1.2 Ry mm, trung gian truyn bnh Tristeza Hỡnh 1.3 (A) T chc genome ca CTV kiu di (CTV9R), (B) nh hin vi in t õm bn nucleocapsid Hỡnh 3.1 Kt qu in di RNA tỏch t mu lỏ trờn gel agarose 1% Hỡnh 3.2 Kt qu in di sn phm RT-PCR trờn gel agarose 0,8%; M: marker 1kb Hỡnh 3.3 Kt qu in di kim tra sn phm tinh sch PCR; M: Marker kb Hỡnh 3.4 S cu to vector pBT Hỡnh 3.5 Khun lc mu xanh trng sau nuụi qua ờm 370C trờn mụi trng LB c Hỡnh 3.6 Kt qu in di sn phm colony-PCR vi cp mi pUC18 trờn gel agarose 1% cỏc mu CT, HG, HN v VL, M: Marker kb Hỡnh 3.7 Kt qu in di kim tra sn phm ct plasmide pBT tỏi t hp bng enzyme gii hn i vi mu HG, HN, CT v VL; M: Marker kb Hỡnh 3.8 Kt qu so sỏnh trỡnh t nucleotide on A gia cỏc mu CT, HG, HN v VL Hỡnh 3.9 Cõy phỏt sinh chng loi xõy dng trờn c s so sỏnh trỡnh t on gen A ca CT, HG, HN v VL vi cỏc trỡnh t tng ng cụng b trờn GenBank Hỡnh 3.10 Kt qu so sỏnh trỡnh t nucleotide on F gia cỏc mu CT, HG, HN v VL Hỡnh 3.11 Cõy phỏt sinh chng loi xõy dng trờn c s so sỏnh trỡnh t on gen F ca CT, HG, HN v VL vi cỏc trỡnh t tng ng cụng b trờn GenBank Hỡnh 3.12 Kt qu so sỏnh trỡnh t nucleotide on P gia cỏc mu CT, HG, HN v VL Hỡnh 3.13 Cõy phỏt sinh chng loi xõy dng trờn c s so sỏnh trỡnh t on gen P ca CT, HG, HN v VL vi cỏc trỡnh t tng ng cụng b trờn GenBank DANH MC T VIT TT àg microgram àl microlitre àm micrometer bp base pair BYV Beet yellows virus cDNA Complementary DNA CS Cng s CP/NCP Protein v (Coat protein/Nucleocapsid Protein) CCM Cõy cú mỳi CTV Citrus tristeza virus CT Cn Th (mu thu ti tnh Cn Th) DDBJ Ngõn hng d liu gen Nht Bn thuc Trung tõm thụng tin sinh hc cú a ch truy cp: www.ddbj.nig.ac.jp DEPC Diethyl pyro Carbonate DNA Deoxyribonucleic acid EDTA Ethylene Diamine Tetra-acetic Acid ELISA K thut hp th dch liờn kt vi enzyme (Enzyme-linked immunosorbent assay) EMBL Phũng Sinh hc phõn t Chõu u thuc Vin Thụng tin Sinh hc Chõu u cú a ch truy cp: www.ebi.ac.uk HSP70 Heat shock protein 70- protein sc nhit HG H Giang (mu thu ti tnh H Giang) HN H Ni (Mu thu ti H Ni) IPTG Isopropylthio--D-galactoside Kb Kilobase LB Luria v Bertani M Marker (thang o kớch thc DNA) NCBI Trung tõm Thụng tin cụng ngh sinh hc quc gia ca Hoa K cú a ch truy cp: www.NCBI.nlm.nih.gov ng Nanogram nm Nanometer ORF Open reading frames - khung c m PNAS Proceedings of the National Academy of Sciences of the United States of America (K yu Vin Khoa hc Quc gia Hoa K) PCR Polymerase Chain Reaction (Phn ng chui polymerase) PCS Polycloning site - vựng nhõn dũng a im ct PMF Polymethoxylated flavones RNA Ribonucleic acid RNase Ribonuclease RT- PCR Reverse transcription polymerase chain reaction (phn ng PCR phiờn mó ngc) TAE Tris - Acetate - EDTA Taq Thermus aquaticus v/p vũng/phỳt VL Vnh Long (mu thu ti tnh Vnh Long) X-gal 5-brom-4-chloro-3-indolyl--D-galactosidase M U Tớnh cp thit ca ti Cõy cú mỳi (CCM) l tờn gi chung ca nhúm cõy cam, quýt, bi, chanh cựng h Rutaceae [45] CCM gi mt v trớ quan trng cỏc loi 10 Bng 3.4 H s tng ng v trỡnh t nucleotide on P gia CT, HG, HN v VL Cõy phỏt sinh chng loi da trờn trỡnh t nucleotide on gen P gia cỏc mu CT, HG, HN v VL vi cỏc trỡnh t ó c cụng b trờn Genbank c trỡnh by Hỡnh 3.13 Hỡnh 3.13 Cõy phỏt sinh chng loi xõy dng trờn c s so sỏnh trỡnh t on gen P ca CT, HG, HN v VL vi cỏc trỡnh t tng ng cụng b trờn GenBank Kt qu trờn cõy phỏt sinh chng loi cho thy, hỡnh thnh hai nhúm, ú nhúm cú mt i din l Mexico, nhúm gm cỏc chng v dũng cũn li, bn dũng nghiờn cu ca Vit Nam thuc cựng mt nhúm, v cú quan h di truyn gn gi vi T30 (phõn lp t Hoa K) cỏc i din ny vi India (phõn lp t n ) v NuagA-Japan (phõn lp t Nht Bn) hỡnh thnh nờn 60 mt phõn nhúm nhúm 2, tỏch riờng vi phõn nhúm T36 (phõn lp t Hoa K) v Quaha-Egypt (phõn lp t Ai Cp) Trong ba on gen nghiờn cu, biờn bin ng ca on gen A l cao nht Vỡ vy, nghiờn cu a dng ca cỏc chng CTV thỡ nờn dựng on A ỏnh giỏ 61 KT LUN V KIN NGH Kt lun Cú th s dng cỏc cp mi CTV A-F/R, CTV F-F/R v CTV P-F/R nhõn dũng cỏc on gen A, F, P ca CTV trờn CCM bng phn ng RTPCR vi c hiu cao Cỏc on A, F, P ca CTV cỏc mu CCM thu ti cỏc tnh Cn Th, H Giang, H Ni v Vnh Long ó c tỏch dũng v xỏc nh trỡnh t V mc tng ng di truyn, trỡnh t nucleotide on gen F, P cú h s tng ng cao hn so vi h s tng ng ca trỡnh t nucleotide on A gia cỏc mu CT, HG, HN, VL V cõy phỏt sinh chng phõn loi, da trờn trỡnh t nucleotide ca on F thỡ HG, CT, HN, T30 (phõn lp t Hoa K), VL, NuagA-Japan, Mexico v India (n ) hỡnh thnh mt nhúm Vi trỡnh t nucleotide ca on A thỡ Cỏc dũng ca Vit Nam v T30 (phõn lp t Hoa K), NuagAJapan (phõn lp t Nht Bn), India (phõn lp t n ) hỡnh thnh mt nhúm khỏc bit vi nhúm Mexico, Quaha-Egypt (phõn lp t Ai Cp) v T36 (phõn lp t Hoa K) Da trờn trỡnh t nucleotide on gen P thỡ bn dũng nghiờn cu ca Vit Nam thuc cựng mt nhúm vi T30 (phõn lp t Hoa K), India (phõn lp t n ), NuagA-Japan (phõn lp t Nht Bn), T36 (phõn lp t Hoa K) v Quaha-Egypt (phõn lp t Ai Cp) Kin ngh 62 Tip tc hon thnh vic gii mó cỏc on gen cũn li b gen ca CTV ti Vit Nam nhm gúp thờm t liu khoa hc cho vic xỏc nh trỡnh t nucleotide ton b h genome ca virus Citrus Tristeza Vit Nam, t ú ỏnh giỏ tớnh a dng di truyn ca cỏc chng virus c chớnh xỏc v y hn TI LIU THAM KHO Ting Vit ng Hng Dt (2003), Cam, chanh, quýt, bi v k thut trng, Nxb Lao ng - Xó hi Phan Trng Hong, Nụng Vn Hi, Lờ Trn Bỡnh, Chu Hong H (2005), S dng enzyme XcmI thit k T-vector pBT phc v tỏch dũng v c trỡnh t gen, Tp Cụng ngh Sinh hc, 3(4): 459-463 Ngụ Ngc Lan, ng Th Hng, Lờ Trn Bỡnh, Chu Hong H (2008), Tỏch dũng v xỏc nh trỡnh t gen mó hoỏ protein v ca hai dũng virut Citrus Tristeza trờn cõy cam snh trng ti Vnh Long v trờn cõy quýt trng ti Cn Th, Tp Cụng ngh Sinh hc 6(4A): 671-678 Lờ Thng, Quyn ỡnh Thi, Nguyn Mng Hựng, Nguyn Hunh Minh Quyờn, Nguyn Chớ Thnh (2007), Cụng ngh sinh hc phõn t: nguyờn lý v ng dng ca ADN tỏi t hp (bn dch ting Vit t Molecular Biotechnology Principles and applications of recombinant DNA, 3thedition), Nxb Khoa hc v K thut, H Ni 63 Quyn ỡnh Thi, Nụng Vn Hi (2008), Cụng ngh Sinh hc: Nhng k thut PCR v ng dng phõn tớch DNA, 2, Nxb Khoa hc t nhiờn v Cụng ngh, Vin Khoa hc Cụng ngh Vit Nam Trn Thng Tun, Lờ Thanh Phong, Dng Minh, Trn Vn Ho v Nguyn Bo V (1994), Cõy n trỏi ng bng sụng Cu Long, 1, S Khoa Hc v Mụi Trng An Giang Trn Th Tc (1997), S tay ngi lm vn, Nxb Nụng nghip H Ni Ting Anh Albiach-Marti M.R, Mawassi M, Gowda S, Satyanarayana T, Hilf M.E, Shanker S, Almira E.C, Vives M.C, Lopez C, Guerri J, Flores R, Moreno P, Garnsey S.M, Dawson W.O (2000), Sequences of Citrus tristeza virus separated in time and space are essentially identical, J.Virol, 74: 6856-6865 Albiach-Marti M.R, Robertson C, Gowda S, Tatineni S, Belliure B, Garnsey S.M, Folimonova S.Y, Moreno P, Dawson W.O (2010), The pathogenicity determinant of Citrus tristeza virus causing the seedling yellows syndrome maps at the 3'-terminal region of the viral genome, Mol Plant Pathol 11(1): 55-67 10 Ayllún M.A, Lúpez C, Navas-Castillo J, Mawassi M, Dawson W.O, Guerri J, Flores R, Moreno P (1999), New defective RNAs from Citrus Tristeza Virus: evidence for a replicase-driven template switching mechanism in their generation, Journal of General Virology, 80 (3): 817-838 64 11 Alzhanova D.V, Napuli A.J, Creamer R, Dolja V.V (2001), Cell-tocell movement and assembly of a plant closterovirus: roles for the capsid proteins and Hsp70 homolog, EMBO J, 20(24): 69977007 12 Bhavakul K, Intavimolsri S, Vichit-rananda S, Kratureuk C, Prommintara M (1981), The current citrus disease situation in Thailand with emphasis on citrus greening, Proc Int.soc citri-cult, 1: 464-466 13 Bar-Joseph M, Garnsey S.M, Gonsalves D, Moscovitz M, Purcifull D.E, Clark M.F, Loebenstein G (1979), The use of enzyme-linked immunosorbent assay for detection of citrus tristeza virus, Phytopathology, 69: 190-194 14 Bar-Joseph M, Lee R.F (1989), Citrus tristeza virus, AAB Descriptions of Plant Viruses, 353 15 Cambra M, Gorris M.T, Marroquớn C, Romn M.P, Olmos A, Martinez M.C, Hermoso de Mendoza A, Lúpez A, Navarro L (2000), Incidence and epidemiology of Citrus tristeza virus in the Valencian Community of Spain, Virus Research, 71: 85-95 16 Cambra M, Camarasa E, Gorris M.T, Garnsey S.M, Gumpf D.J, Tsai M.C (1993), Epitope diversity of isolates of citrus tristeza virus (CTV) in Spain, In: P Moreno, J da Graỗa and L.W Timmer (Eds), Proc 12th Inter Conf Organ Citrus Virol., IOCV Riverside, pp: 33-38 17 da Graca J.V (1991), Citrus greening disease, Annu Rev Phytopathol, 29: 109-136 18 Garnier M, Danel N, Bov J.M (1984), The greening organism is a gram negative bacterium, pp: 115-124 65 19 Gago-Zachert S, Costa N, Semorile L, Grau O (1999), Sequence variability in p27 gene of Citrus Tristeza Virus (CTV) revealed by SSCP analysis, Electron J Biotechnol, 2: 16-25 20 Garnsey S.M, Permar T.A, Cambra M, Henderson C.T (1993), Direct tissue blot immunoassay (DTBIA) for detection of citrus tristeza virus (CTV), In: P.Moreno, J Da Graỗa and L.W Timmer (Eds), Proc 12th Inter Conf Organ Citrus Virol., IOCV Riverside, pp 39-50 21 Gottwald T.R, Cambra M, Moreno P, Camarasa E, Piquer J (1996), Spatial and temporal analyses of citrus tristeza virus in Eastern Spain, Phytopathology, 86: 45-55 22 Gottwald T.R, Garnsey S.M, Cambra M, Moreno P, Irey M, Borbún J (1997), Comparative effects of aphid vector species on increase and spread of citrus tristeza virus, Fruits, 52, 397-404 23 Karasev A.V, Boyko V.P, Gowda S, Nikolaeva O.V, Hilf M.E, Koonin E.V, Niblett C.L, Cline K, Gumpf D.J, Lee R.F, Garnsey S.M, Dawson W.O (1995), Complete sequence of the citrus tristeza virus RNA genome, Virology, 208: 511-520 24 Koen T.J, Langenegger W (1970), Effect of greening virus on the macro element content of citrus leaves, Farming S.Afr, 45(12): 65 25 Lee R.F, Bar-Joseph M (2000), Tristeza, In: Compendium of citrus diseases L.W Timmer, S.M Garnsey, J.H Graham (Eds), APS Press, pp: 61-63 26 Martinez A.L, Wallace J.M (1969), Citrus greening disease in the Philippines, Proc 1st Int Citrus Symp, 3: 1427-1431 27 Mawassi M, Mietkiewska E, Gofman R, Yang G, Bar J.M (1996), Unusual sequence relationships between two isolates of citrus tristeza virus, Journal of General Virology, 77: 2359-2364 66 28 McClean A.P.D, Schwarz R.E (1970), Greening or blotchy mottle disease of citrus, Phytophylactica, 2, 177-194 29 Moreno P, Guerri J, Ballester-Olmos J.F, Albiach R, Martớnez M.E (1993), Separation and interference of strains from a citrus tristeza virus isolate evidenced by biological activity and double-stranded RNA (dsRNA) analysis, Plant Pathol, 42: 35-41 30 Pappu H.R, Karasev A.V, Anderson E.J, Pappu S.S, Hilf M.E, Febres V.J, Eckloff R.M, McCaffery M, Boyko V, Gowda S, Dolja V.V, Koonin E.V, Gumpf D.J, Cline K.C, Garnsey S.M, Dawson W.O, Lee R.F, Niblett C.L (1994), Nucleotide sequence and organization of eight 3' open reading frames of the citrus tristeza closterovirus genome, Virology, 199: 35-46 31 Permar T.A, Garnsey S.M, Gumpf D.J, Lee R (1990), A monoclonal antibody that discriminates strains of citrus tristeza virus, Phytopathology, 80: 224-228 32 Rubio L, Ayllún M.A, Kong P, Fernỏndez A, Polek M, Guerri J, Moreno P, Falk B.W (2001), Genetic variation of Citrus Tristeza Virus isolates from California and Spain: evidence for mixed infections and recombination, Journal of Virology, 75(17): 8054-8062 33 Saponari M, Manjunath K, Yokomi R.K (2008), Quantitative detection of Citrus tristeza virus (CTV) in Citrus and Aphids by Realtime Reverse Transcription-PCR (TaqManđ), J Virol Meth, 147:43-53 34 Satyanarayana T, Gowda S, Boyko P.V, Albiach-Marti M.R, Mawassi M, Navas-Castillo J, Karasev V.A, Dolja V, Hilf E.M, Lewandowski J.D, Moreno P, Bar-Joseph M, Garnsey M.S, Dawson O.W (1999), An engineered closterovirus RNA replicon and analysis of heterologous terminal sequences for replication, PNAS, 96(13), pp 7433-7438 67 35 Suastika G, Natsuaki T, Terui H, Kano T, Ieki H, Okuda S (2001), Nucleotide sequence of Citrus tristeza virus seedling yellows isolate, Journal of General Plant Pathology, 67: 73-77 36 Sutic D.D, Fotd R.E, Tosaic M.T (1999), Handbook of plant virus disease, CRC press London, pp: 551 37 Svetlana Y.F, Alexey S.F, Satyanarayana T, William O.D (2008), Citrus Tristeza Virus: Survival at the Edge of the Movement Continuum, Journal of virology 82(13): 6546-6556 38 Timmer L.W, Garnsey S.M, Graham J.H (2000), Compendium of Citrus Diseases, APS press, pp: 92 39 van Lelyveld L.J, van Vuuren S.P (1988), Peroxidase activity as a marker in greening disease of citrus for assessment of tolerance and susceptibility, Journal of Phytopathology, 121(4): 357-362 Germany, F.R 40 Vives M.C, Rubio L, Lopez C, Navas-Castillo J, Albiach-Marti M.R, Dawson W.O, Guerri J, Flores R, Moreno P (1999), The complete genome sequence of the major component of a mild Citrus Tristeza Virus isolate, Journal of General Virol, 80: 811-816 41 Yang G, Mawassi M, Gofman R, Gafny R, Bar-Joseph M (1997), Involvement of a sub genomic mRNA in the generation of a variable population of defective citrus tristeza virus molecules, J Virol, 71:9800-9802 42 Yang Z.N, Mathews D.M, Dodds J.A, Mirkov T.E (1999), Molecular characterization of an isolate of Citrus Tristeza Virus that causes severe symptoms in sweet orange, Virus Genes, 19(2): 131-173 Ti liu tham kho t website 68 43 http://www.botany.hawaii.edu/faculty/carr/rut.htm 44 http://www.dost-bentre.gov.vn/cay-trai-ben-tre/cay-co-mui 45 http://en.wikipedia.org/wiki/Citrus 46 http://www.ictvdb.org/ICTVdB/00.017.0.01.008.htm 47 http://www.pnas.org/cgi doi 10.1073 pnas.0307747100 48 http://sonn.tayninh.gov.vn 49 http://teachline.ls.huji.ac.il/workshop/protocols/Colony_PCR 50 http://www.ykhoanet.com 69 PH LC Trỡnh t nucleotide on gen A ca CTV Cn Th TAATTTTACGGCTCGTTTCCCAATGTCGGCTTCAAGGTATGAGCATCATTATGA TGCAAGTATGAAAGGCGCCGGTTTGTCGTGGGTGCGGAAGAGTCAATTTCCGA ACGTTGAAGTTATACGCCGTCGAAGGAGCCGGGTAAGCGGTTCTTCGGCTGGT TTTCCGGACGCGAGTTTACAGGTTAGTTCAGACCGATCGTCGGAGTTTGTCCAA GCGGCTCCGATGTTGGATGAGGGTTCTTCGCCGCCTCGAGGAGTGTCCTCGCCC CGACGCGATCCTGTTGAAGGGTCGGGCTGGTATAGCGTGGGTTCTTCTAGTCG GTGCTCGAGTATTACTCGTGGGCAACGTTCCGCTGAACGTGGGAAGATCGGGG ATTTCAGTTTTCCGAGAGGCACTGTGTACAACGCACGCGTGGACGAGCGTGCT TATAAACGTGTCTTAAAGTTGCGTGACACGTCGGCGTCCTCCTTTCTTCGTATA GTTCTT Trỡnh t nucleotide on gen A ca CTV H Giang TAGTTTTACGGCTCGTTTCCCAATGTCGGCTTCGAGGTATGAGCATCATTACGA TGCAAGTATGAAAGGCGCCGGTTTGTCGTGGGTGCGGAAGAGTCTATTTCCGA ACGTTGAAGTTATACGCCGTCGAAGGAGCCGGACAAGCGGTTCTTCGGCTAGT TTTCGGGACGCGAGTTTACAGGTTAGTTCAGACCAACCGTCGGAGTTTGTCCA AGCGGTTCCAATGTCGGATGAGGGTTCTTCACCGCCTCGAGGAGTTTCCTCGCC CCGACGCGATCGTGTTGAAGGGTCGGGCTGGTATAGCGTGGGTTCTCCTGGTC GGCACTCGGGTTCTACTCGTGGGCAACGTTCCACTGAACGTGGGAAGATTGGG GATTTCAGTTTTCCGAGTGGCACTGTGTACAACGCACGCGTGGACGAGCGTAC CTATAAACGTGTCTTAAAGTTGCGGGACACGTCGGCGTCCTCCTTTCTTCGCAT AGTTCTC Trỡnh t nucleotide on gen A ca CTV H Ni TAACTTTACGGCTCGGTTCCCTATGTCGGCTTCAAGGTATGAGCATCATTATGA TGCAAGTATGAAAGGCGCCGGTTTGTCATGGGTGCGGAAGAGTCGGTTTCCGA ATGTTGAAGTTATACGCCGTCGAAGGAGTCGGACGGGCGGTTCTTTGGCTAGC TTTCCGGACGCGAATCTACGGATTAATTCTGACCAACCGTCGGATTCTGTTCAG GCAGTTCCGGTGTCGGGTGAGAATTCTCAATCGTCTCGAGGAGCGTCTTCGCCC 70 CGACGTGGTCCTGTTGAAGGGTCGGGTTGGTATAAGGTGGGTTCTCCTAGTCAT CACTCGAGTGCCGCTCGTGGGCAACGTTCCACTGAACGTGGGAAGATTGGGGA TTTCAGTTTTCCGAGTGGCACTGTGTACAACGCACGCGTGGACGAGCGTGCTTA TAAACGTGTCTTAAAGTTGCGGGACACGTCGGCGTCCTCCTTTCTTCGTATAGT TCTT Trỡnh t nucleotide on gen A ca CTV Vnh Long TCATTTTACGGCTCGTTTTCCTGTGTCGGCGTCAAGGTACGAGCATCATTATGA TGCAAGTATGAAAAGCACCGGCTTGTCGTGGGTGCGGAAGAGTCAGTTTCCAA ACGTCGAAGTCATACGCCGTCGGAGGAGTCGGATAAGCGATTCTTCTGCTAAC CTTCCGGACGCGAATTTGCGGGCTAACTCTGACCAACCGTCGGAGCCTGTTCA AACGGTTTCGGTGCCGAATGAGAATTCTTCGCCATCTCGCGGGGTGTCTTCATC CCGACGTGATCCTGTCGAGGGGTCGGGTTGGTATAAGGTGGGCTCTCCTAGTC GGCGCTCGAGTACCGTTCGTGGGCAACGTTCCACCGAACGTGGAAAAATTGGG GATTTCAGCTTTCCAAGTGGTACCGTGTATAATGCACGTGTGGACGAGCGCGC TTACAAACGTGTCTTGAAGTTGCGGGACACGTCAGCGTCTTCCTTTCTTCGTAT AGTTCTG Trỡnh t nucleotide on gen F ca CTV Cn Th ATTGTTATGGTGCAGGTTTACGATGTGCCACTGCGAGAGTTGTGTAGAGCTATG GTGAGCAAGAAAACTTCGGTGTGTTATATGACCATGGTCACACCTGGCGAGTT GTTGGACGCTCGTGAGTCCTTCTTCATCAAAGAGTTGGACTGTTCGGTAGAGTT GGACGTTATCGCCGATAGGGTTGTTTACTGCTTTAACAATTCGGCGTACACGCA CGCGTATTCTACGATATGCGAATACATGCGTACTCCTTGTATGGTGGTGGATGG TTTTCTATTCACTATAGAGATGGTTTCGCTTAGATGCAGCGTTAATTATTATTGC ATCACCAAATCGCGGGTCTGTCCGAGAATTAGCGAGGTTAAACGACTACGCTA TCGTCGGTGTGATAGTGA Trỡnh t nucleotide on gen F ca CTV H Giang ATTGTTATGGTGCAGGTTTACGATGTGCCACTGCGAGAGTTGTGCAGAGCTAT GGTGAACAAGAAAACTTCGGTGTGTTATATGACCATGGTCACACCTGGCGAGT TGTTGGACGCTCGTGAGTCCTTCTTCATCAAAGAGTTGGACTGTTCGGTAGAGT 71 TGGACGTCGTCGCCGATAGGGTTGTTTACTGCTTTAACAATTCGGCGTACTCGC ACGCGTATTCCACGATACGCGAATACATGCGTACTCCTTGTGTGGTGGTGGAT GGTTTTCTGTTCACTATAGAGATGGTTTCGCTTAGATGCAGCGTTAATTACTAT TGCATCACCAAATCGCGGGTCTGTCCGAGAATTAGCGAGGTTAAACGACTACG CTATCGTCGGTGTGATAGTGA Trỡnh t nucleotide on gen F ca CTV H Ni ATTGTTATGGTGCAGGTTTACGATGTGCCACTGCGAGAGTTGTGTAGAGCTATG GTGAACAAGAAAGCTTCGGTGTGTTATATGACCATGGTCACACCTGGCGAGTT GTTGGACGCTCGTGAGTCCTTCTTCATCAAAGAGTTGGACTGTTCGGTAGAGTT GGACGTTATCGCCGATAGGGCTGTTTACTGCTTTAACAATTCGGCGTACACGCA CGCGTATTCCACGATACGCGAATACATGCGTACTCCTTGTGTGGTGGTGGATG GTTTTCTATTCACTATAGAGATGGTTTCGCTTAGATGCAGCGTTAATTATTATT GCATCACCAAATCGCGGGTCTGTCCGAGAATTAGCGAGGTTAAACGACTACGC TATCGTCGGTGTGATAGTGA Trỡnh t nucleotide on gen F ca CTV Vnh Long ATTGTTATGGTGCAGGTTTACGACGTGCCGTTGCGAGAATTGCGTAGAGCTAT GGTGAACAAGAAAGCTTCGGTGTGTTATATGACCGTGGTTACGCCTGGTGAGT TGTTGGACGCCCGTGAGTCCTTCTTCATCAAAGAGTTAGACTGTTCGGTGGAGT TGGACGCTGTCGCCGATAGGGTTGTTTACTGCTTTAACAATTCAGCGTATACGC ATACCTATTCTACGATATGCGAATACATGCGTACTCCTTGTGTGGTGGTGGATG GTTTTCTGTTTACCATAGAGATGGTTTCACTCAGATGTAGCGTTAACTATTATT GTATCACCAAATCGCGGGTTTGTCCGAGAATCAGCGAGGTTAAACGGTTACGC TATCGTCGGTGTGATAGTGA Trỡnh t nucleotide on gen P ca CTV Cn Th GTGTTAACGATTACATAAGCCTTTTGGCTAAGGTTGGCGCAGTTGTGGAACGTT TATGCGATCCCAGCGTAACTCTCACGGAAGTGATGGACGAAATTAATGACTTT AACTCGTTCCTCGCTTTGGTGCACTCTATGAAGTCGGACATGAACGGAGACCA TCAGGATGGTCACCATGAGATGGGCGAACACAAGTCTCGGTTGTTGTGCAATA TAGAGGCGAAACTGCGAGTACTTCTCGACATCATAAGACGTCGGTTCACTCGC 72 GAAAAACTGCTCTGTACCAGTGCTACAGACGTCATGGGCTTCTTCGTCATGAG GTACATGAGTTCTAGTCACACCAGTTTTGAGTCCGTAATGCGTACGGAATTGA AGTTAGTGGTTAAGGCGGTGCTGTCAGATTTATCCCGCACGCATAAACTAGAT TTTAGTGAGCGAGCCTTTGCGGCTTACGGTATCCTTTTACAAAAGGGTGCCGTG GCAACCGTTTGTGGTCAGTTTGACATTAACTTAGTTTC 10 Trỡnh t nucleotide on gen P ca CTV H Giang GTGTTAACGATTACATAAGCCTTTTGGCTAAGGTTGGTTCAGTTGAGGAACGTT TATGCGATCCCAGCGTAACTCTCACGGAAGTGATGGACGAAATTAATGATTTT AACTCGTTTCTCGCTTTGGTGCACTCTATGAAGTCGGACATGAACGGCGATCAT CAGGATGGTCACCATGAGATGGGTGAACATAAGTCTCGGTTGTTGTGCAATAT AGAGGCGAAACTGCGAGTGCTTCTCGACATCATAAGACGTCGGTTTACTCGCG AAAAACTGCTCTGTACCAGTGCTACAGATGTCGTGGGCTTCTTCGTCGTGAGGT ACATGAGTTCTAATCACACTAGTTTCGATACCGTAATGCGAACGGAACTGAAG TTAGTGGTTAAAGCTGTGCTGTCGGAATTATCCCGCACGCATAAACTAGATTTT AGCGAGCGAGCCTTTGCGGCTTACGGTATCCTTTTGCAAAAGGGTACCGTGGC AACCGTTTGCGGTCAGTTTGACATTAATTTAGTTTC 11 Trỡnh t nucleotide on gen P ca CTV H Ni GTGTTAACGATTACATAAGCCTTTTGGCTAAGGTTGGTTCAGTTGTGGAACGTT TATGCGATCCCAGCGTAACTATCACGGAAGTGATGGACGAAATTAATGATTTT AACTCGTTTCTCGCTTTGGTGCACTCTATGAAGTCGGACATGAACGGCGATCAT CAGGATGGTCACCACGAGGTGGGTGAACACAAGTCTCGATTGTTGTGCAATAT AGAGGCGAAACTGCGAGTACTTCTCGACATCATAAGACGTCGGTTCACTCGCG ATAAACTGCTCTGTACCAGTGCTACAGACGTCATGGGCTTCTTCGTCGTGAGGT ACATGAGTTCTAGTCACACCAGTTTCGAGTCCGTGATGCGAACGGAATTGAAG TTAGTGGTTAAAGCGGTACTGTCGGATTTGTCCCGCACGCATAAGCTAGATTTT AGCGAGCGAGCCTTTGCAGCTTACGGTATCCTTTTACAAAAGGGTGCTGTAGC AACCGTTTGCAGTCAGTTTGACATTAATTTAGTTTC 12 Trỡnh t nucleotide on gen P ca CTV Vnh Long GTGTTAACGATTACATAAGCCTTTTGGCTAAGGTTAGTTCAGTTGTGGAACGTT TATGCGATCCCAGCGCAACTCTCACGGAAGTGATGGACGAAATTAATGATTTT 73 AACTCGTTTCTCGCTTTGGTGCACTCTATGAAGTCGGACATGAACGGCGATCAT CAGGATGGTCACCATGAGATGGGTGAACATAAGTCTCGGCTGTTGTGCAATAT AGAGGCGAAACTGCGAGTGCTTCTCGACATCATAAGACGTCGGTTTACTCGCG AAAAACTGCTCTGTACCAGTGCTACAGATGTCGTGGGCTTCTTCGTCGTGAGGT ACATGAGTTCTAGTCACACTAGTTTCGAAACCGTAATGCGAACGGAACTGAAG TTAGTGGTTAAAGCTGTGCTGTCGGAATTATCCCGCACGCATAAACTAGATTTT AGCGAGCGAGCCTTTGCGGCTTACGGTATCCTTTTGCAAAAGGGTACCGTGGC AACCGTTTGCGGTCAATTTGACATTAATTTA 74
- Xem thêm -

Xem thêm: Nghiên cứu cấu trúc di truyền một số dòng Citrus Tristeza Virus gây bệnh trên cây ăn quả chi Citrus ở Việt Nam, Nghiên cứu cấu trúc di truyền một số dòng Citrus Tristeza Virus gây bệnh trên cây ăn quả chi Citrus ở Việt Nam, Nghiên cứu cấu trúc di truyền một số dòng Citrus Tristeza Virus gây bệnh trên cây ăn quả chi Citrus ở Việt Nam

Gợi ý tài liệu liên quan cho bạn

Nạp tiền Tải lên
Đăng ký
Đăng nhập