Fish Sci (2010) 76:549–559 DOI 10.1007/s12562-010-0254-2 ORIGINAL ARTICLE Fisheries Effect of trawling with traditional and ‘T90’ trawl codends on fish size and on different quality parameters of cod Gadus morhua and haddock Melanogrammus aeglefinus Hanne Digre • Ulrik Jes Hansen • Ulf Erikson Received: 22 July 2009 / Accepted: 21 April 2010 / Published online: 12 June 2010 Ó The Japanese Society of Fisheries Science 2010 Abstract The effect of trawling on fish size and on different quality parameters of cod (Gadus morhua) and haddock (Melanogrammus aeglefinus) was evaluated after conducting 16 valid hauls using two trawls in a double rig fitted with a traditional and a novel ‘T90’ codend, respectively The total catch volume during the fishing period was 47.6 metric tons, with an average catch per codend of 1.5 (range 0.5–2.9) tons The mean haul duration was h The catch was assessed according to fish size, mortality, external damage, initial white muscle pH and development of rigor mortis Fillet quality (colour, blood spots, gaping) was assessed after week of freeze-storage Our results showed there was no difference between the two types of nets in terms of catch volume, but significantly slightly bigger fish were caught with T90 than with the traditional trawl net (p \ 0.05) Haddock caught with the traditional trawl net had more external injuries related to the trawl gear than haddock caught with the T90 gear (p \ 0.05) The gaping frequency for cod caught with the traditional trawl net tended to be higher than cod caught with the T90 gear, but the difference was not significant (p = 0.07) No other differences in fish quality between fish caught in the trawl nets were observed Keywords Cod Á Fish quality Á Fish size Á Haddock Á Trawling Á T90 codend H Digre (&) Á U J Hansen Á U Erikson SINTEF Fisheries and Aquaculture, 7465 Trondheim, Norway e-mail: Hanne.Digre@Sintef.no H Digre Department of Biotechnology, The Norwegian University of Science and Technology, 7491 Trondheim, Norway Introduction Seafood products have often suffered from an inherent loss of quality caused by the fishing gear, retrieval from the water, and handling on deck Due to the nature of the industry, it is rather difficult to industrialise the production to provide for more gentle fish handling routines In addition, seafood is often stored onboard for a comparatively long storage time until it can be landed and delivered to the fish processors or consumers In 2003, approximately 8,000 metric tons (4% of the total catch volume) of Atlantic cod landed in Norway had suffered serious physical damage, with the result that 1,900 metric tons were down-graded, losing economic value (F Gregersen, unpublished data 2005) Increasing the utilisation of each catch while also concurrently raising the quality of the catch will result in higher prices for the products and contribute to more sustainable fisheries in the present situation, whereas focus is currently being directed towards a better exploitation of the resources New technologies which improve quality may further contribute to moving the industry towards quality, rather than quantity only Only a few attempts have been made to alter the trawl gear to improve the quality of the catch The focus has been on the codend, with particular attention being directed towards reducing the turbulence that is seen in full-scale usage Recent investigations have demonstrated that a drastic reduction in the movements of the codend can be achieved just by turning the direction of the netting 90° (T90) in relation to how it is normally used in traditional trawl assembly (U J Hansen, unpublished data 2004; Fig 1) This effect is due to changes in the configuration of the knots in the netting—the knots are further apart with the 90° shift in direction than in netting stretched in the normal direction In effect, a T90 codend has a much larger 123 550 Fig Trawl netting stretched in the direction of normal use (top) and turned 90° (bottom) cross-sectional area, and it is practically free of all movement Theoretically, these features increase the possibility improving the catch quality A typical processing line onboard a present-day trawler comprises the following unit operations: (1) the trawl net is pulled up a steep trawl slip, then over another upper edge before the catch is gathered into the trawl deck; (2) the nets are emptied in a tank; (3) the gills are cut, with subsequent bleeding, gutting, deheading and packing Although not widely studied, it has nevertheless been shown that catching methods and subsequent onboard handling may affect fish quality [1–8] The fish are often exhausted, injured or killed as a result of inadequate catching methods, transfer from sea-to-vessel methods, or on-deck handling routines The hauling process can damage a substantial part of the catch because of the pressure on the codend when it is being hauled towards the boat In many cases, the cause of death is anoxia where fish are left in the open air on the deck The catching process leads to elevated levels of plasma cortisol [9, 10], glucose [11], lactate, [11–14] haematocrit, Na?, K?, and Cl-, whereas blood pH decreases [11] The more strenuous the stress-related activity the fish are subjected to, the more rapid the muscle ATP depletion [7, 10] and severe muscle activity causes early rigor mortis onset [10, 14] Cole et al [7] showed that in terms of low initial flesh pH (7.1), high blood lactate and depleted ATP stores, handlining of blue cod Parapercis colias was the most fatiguing 123 Fish Sci (2010) 76:549–559 capture method when compared with commercial potting, modified potting and rested harvested fish Chopin et al [15] showed that stress during capture may vary between different gear types Auclair [2] evaluated the effects of the gillnet and trawl in the cod fishery and found that gillnetted fish were of a lower quality than trawl-caught fish This author also found that the bacterial contamination increased with increased fishing times, namely, 4, 12, 24 and 48 h, with significant differences after 24 h for both fishing methods The use of the gillnet also caused flesh discoloration due to bleeding, and fish were lost to predators and parasites Chopin et al [15] showed that the severity and degree of injuries increased with the time of entrapment for trammel net-caught sea bream The quality of Atlantic cod caught by otter trawl was investigated by Botta and Bonnell [5], who concluded that the initial quality of the cod was usually very good and that the reduction of the quality was a result of catch volumes being too large ([5 tons during a single tow), delayed bleeding ([1 h), storage method and time ([6 days) Adequate bleeding is considered to be necessary for a good product quality Botta et al [16] studied different bleeding/gutting procedures on the sensory quality of fresh raw Atlantic cod caught by a trawler (2–3 h tow lengths; catch amounts 2.3–13.6 tons) and showed that time before gutting ([1 h) was more important than the bleeding/gutting methods Similar results were obtained by Kelly [17] and Valdimarsson et al [3] Wagner [18] evaluated the external appearance and consistency of cod caught using trawls and found that the quality was reduced with increased hauling time and number of fish in the trawl net Botta et al [4] compared the effect of season and catching method (gillnet, handline, longline and trap) on the quality of cod and showed that the catching method had an impact on fillet colour, discoloration, bruising and overall quality grades of cod They concluded that the catching methods had a greater impact than season on the quality of fresh cod Furthermore, muscle pH is lower and the condition factor is generally higher in fish caught by gillnet compared with fish caught by longline [19] Hattula et al [6] studied the effect of gillnetting, poundnetting and trawling on the mortality and quality of herring Mortality increased when the trawling time increased from to h Rigor mortis started earlier, and the nucleotide decomposition proceeded further in gillnet-caught fish than in fish caught by the other methods, indicating a loss of freshness due to stress in the ¨ zyurt et al [8] showed that quality and catching process O shelf life of pike perch (Sander lucioperca) were affected by catching methods, with the acceptable shelf life being days longer for pike perch caught by longline and harpoon than gillnetted fish The objectives of this study were to compare a T90 codend and a traditional trawl net in terms of fish injuries, Fish Sci (2010) 76:549–559 fish size, handling stress and fillet quality and to obtain more knowledge about how trawling impacts cod and haddock quality Materials and methods Fishing gear Cod and haddock were captured using a traditional and the novel ‘T90’ codends by a typical North Atlantic factory trawler (M/T J Bergvoll, length 57 m, BT 1499, HP 3900) in November 2004 The vessel was selected due to its ability to operate two trawls simultaneously This was ideal for the aim of the study since the simultaneous use of the two trawls would exclude a number of variables and make the assessments more directly comparable The trawls used were identical traditional cod trawls, but fitted with different codends They were of the type Alfredo no (Refa-Frøystad Group, Tromsø, Norway) that is standardly used by several trawlers in the North Atlantic The codend on one side was a standard codend and on the other side, it was of the new (T90) design (Figs 1, 2) Both trawls were fitted with the sorting grid which is specified by the Norwegian authorities in the Technical Regulations for the whitefish fishery in the Barents Sea (SDBS website: http://www.lovdata.no/for/sf/fi/xi-20000310-0271.html) 551 The sorting grids (flexigrids) were mounted as a whole unit between the belly of the trawl and the extension piece in front of the codend The standard codend had an extension piece and codend made from standard diamond mesh materials, while the T90 codend differed by having a large part made from netting turned 90° (Fig 3) Normally, a joining ratio of 2:3 is recommended to join the turned meshes from the T90 material to the standard diamond mesh Because the aforementioned regulation specifies the use of selection grids in cod trawls and also specifies the number of meshes in the circumference, the joining ratio in this case was a compromise—104 meshes were joined to 80 in the case of the T90 The extension piece and codend were made from 6- and 8-mm double-braided polyamide, respectively The rear-most 4.8 m of the T90 codend was made from knotless netting in an attempt to create the best conditions for the preservation of fish quality Knotless netting has a much smoother inside surface than doublebraided knotted netting It should be mentioned that the T90 concept does not apply to knotless netting Both trawls were fitted with the usual top and bottom side chafers The nets were closed by weaving the top and bottom panel meshes together with a cod line, which results in a long transversal knot that has been seen in model tests to further reduce the movements of the catch The trawls were both fitted with acoustic monitoring instruments to measure the distance between the doors and the filling rate of the codends Fish capture Seventeen hauls were conducted during the period 20–24 November 2004 in the Nordkapp Bank in the Barents Sea (71°N/24–27°E) The bank is located north of the coast of Finnmark in northern Norway A trawl was badly damaged in one haul, and that haul was not included in further analyses The total catch for the 16 valid hauls was 47.6 metric tons, with an average catch of 2.98 tons (range 1.06–4.85 tons) per haul (= codends) During the trials, effort was made to standardise the hauling conditions, but factors such as the bottom conditions or the weather conditions occasionally prevented us from fulfilling this criterion The mean haul duration was h (range 2.5–6.0 h), and the towing speed was kept close to 4.0 knots The fishing was conducted at depths between 238 and 370 m Data for each haul, including catch amount, are given in Table Processing line Fig Two models of codends made from normal netting (top) and T90 (bottom) demonstrate the difference due to the two configurations Photographs were taken in the flume tanks of SINTEF Fisheries and Aquaculture in Hirtshals, Denmark The processing line onboard consisted of the following operations: (1) the trawl net with the fish were hauled up on deck; (2) the nets were emptied in a tank without water; 123 552 Fig Specifications for the two different codends, including information on the material, number of meshes and stretched length, mesh size and cutting rate Fish Sci (2010) 76:549–559 No of meshes and Cutting Streched length rate Material Cutting No of meshes and rate Streched length Mesh size Mesh size Material Experimental 69.5# Standard 59.5# AN Grid section AN 8.40 m 9.66 m 140 mm PA double mm PA 69.5# double AN 9.66 m mm 138 mm Intermediate section 99.5# 18N 2B 14.00 m 60.0# 8.35 m AN Codend AN PET 30.0# knotless 9.4 mm 4.21 m 78.5# 10.90 m PA 138 mm double mm AN Legend: Normal T90 Knotless Polyethylene PET (2) the throats of the fish were cut (within h) and the fish were placed in a tank without water prior to being gutted, deheaded, frozen in blocks and stored in a freezing room at -21°C Total processing time from the time the catch was brought onboard until the fish were packed before freezing was typically around 2.5 h Fish sampling Immediately after the catch, cod and haddock were collected from the codends while still on deck Due to the tight schedule, it was not always possible to make all assessments of the fish from every haul A selection of the assessments of the fish was conducted from a random selection of the hauls Fish were selected at random, and the number of mortalities, visual assessment of external 123 Polyamide PA damage, and fish size were determined Mortality rates were assessed for both species from Haul and 11 (cod, n = 83; haddock, n = 84) Visual assessments of external damage were done on cod (n = 520) and haddock (n = 481) from eight hauls (Hauls 1, 3, 4, 5, 7, 8, 11 and 13) To evaluate the fish size, we measured the length of individual cod (n = 3,803) and haddock (n = 5,165) from eight different hauls (Hauls 4, 5, 7, 8, 11, 12, 13 and 15) The fish were subsequently collected from the processing line after the throats were cut, and measurements of initial white muscle pH, body temperature, weight, fork length and rigor status were conducted on cod (weight 2.4 ± 0.1 kg, fork length 61 ± cm; n = 102) and haddock (weight 1.7 ± 0.1 kg, fork length 50 ± cm; n = 97) from five different hauls (Hauls 1, 3, 7, 12 and 15), approximately within 60 after the fish were landed on deck Fish Sci (2010) 76:549–559 553 Table Catching data for each haul, fishing conditions and catch amounts for traditional and T90 codend trawl nets Haul no Date November 2004 Haul duration (h) Wind speed (m/s) Fishing depth (m) 20 12 296–270 765 497 268 1,262 20 6 265–240 2,018 1,688 330 3,706 21 5.5 238–241 2,847 2,006 841 4,853 21 284–258 1,793 1,990 -197 3,783 21 256–275 1,799 1,923 -124 3,722 21 10 277–243 2,114 2,044 70 4,158 22 10 252–256 1,799 1,760 39 3,559 22 280–283 1,261 1,955 -694 3,216 22 292–283 – – – – 10 11 23 23 2.5 10 254–245 240–320 596 1,068 573 1,059 23 1,169 2,127 12 23 12 370–358 1,993 1,989 3,982 13 23 339–347 1,532 1,541 -9 3,073 14 23 5.5 308–309 1,015 1,850 -835 2,865 15 24 5.5 13 365–311 1,236 1,408 -172 2,644 16 24 18 342–250 1,279 1,176 103 2,455 17 24 25 250–260 572 483 89 1,055 23,687 23,942 -255 47,629 Total T90 (kg fish) Traditional trawl net (kg fish) Catch difference T90 vs trad (kg) Total catch (kg) Cod (n = 40) and haddock (n = 40) from Haul were collected at random from the processing line before the fish were frozen The fish were packed in Styrofoam boxes, frozen onboard (-21°C), transported to our laboratory and stored at -21°C for 8–9 days The fish were then thawed at 2–4°C in a cold room for days and filleted (skin-on) by hand, following which muscle pH, fillet colour and visual assessments of blood spots and gaping were carried out (day 10 and 11 postmortem for haddock and cod, respectively) Table Scoring system used for visual evaluation of injuries on whole fish onboard Analyses Pressure injuries The mortality rate was estimated by cessation of gill movements and by gently touching the mid-line and the tail immediately after the catch landed onboard to see if the fish responded Visual assessments of injuries on whole fish were conducted using a scoring system for different parameters: gear injuries, scale loss, pressure injuries and bruises (skin discolorations) A score was devised ranging from up to based on descriptive terms for each parameter (Table 2) The body temperature was measured in the white muscle between the mid-line and the dorsal fin, and in filleted fish the temperature was measured in the flesh A Testo 110 thermometer (Lenzkirch, Germany) was used The pH was measured directly in the white muscle between the mid-line and the dorsal fin using a shielded glass electrode (WTW SenTix 41) connected to a portable pH meter (model WTW Parameter Gear injuries Scale-loss Bruises (discoloration on the skin) Score Description No visible marks Visible marks on the surface of the fish No scale-loss Some scale-loss of part of the fish (\50%) Whole fish has lots of scale-loss ([50%) No injuries Some minor injuries on part of the fish (\2) Whole fish has injuries ([2) No discolorations Some minor discoloration on parts of the fish Whole fish has lots of discoloration 315i; WTW, Weilheim, Germany) During the measurements, the instrument was frequently calibrated using pH 4.01 and pH 7.00 buffers Frequent cleaning of electrodes was needed to obtain consistent results The rigor mortis progression during ice storage was determined using the Rigor Status Method [0 = pre- or postrigor; = rigor onset (first sign of stiffness, for instance, 123 554 Fish Sci (2010) 76:549–559 in the neck or tail region); = rigor (a larger area is clearly in rigor); = whole fish in rigor; = stronger rigor; = very strong rigor (the fish is extremely stiff, rod-like)] [20] Evaluation was done by touching the fish to evaluate muscle tension and by carefully lifting the fish a few centimetres above the ice to judge the degree of stiffness of the fish The gaping frequency was subjectively assessed using a score of to according to the number of slits in the fillet [21] Visual assessments of the number of fillet blood spots according to a subjective scoring system from to was used, where = no blood spots, = 1–4 small spots and = large blood spots or several small ([4) The colour (L*, a* and b*, International Commission of Illumination (CIE) 1976 colour space; hue; chroma] of the flesh was measured using the Minolta Chroma Meter CR200 (Minolta, Osaka, Japan) The instrument readings cover an area of mm in diameter The hue angle (0°/360° = red hue, 240° = blue hue) and chroma (colour intensity or saturation) were calculated as: hue = 360 - tan-1 (b*/a*) where a* \ and b* \ 0, and as chroma = (a*2 ? b*2)‘ The measurements were carried out on the white muscle between the mid-line and the second dorsal fin at three different locations along the fillet The instrument was calibrated using a standard white plate Statistics To test significance on the effect of trawl gear and haul number on the different parameters (pH, temperature, weight, length, L*, a*, b*, hue and chroma), a two-way analysis of variance (ANOVA) was used A one-way ANOVA was used to test significance between the two trawl gears and between different catch amounts For the non-parametric results (mortality, injuries, gaping and blood spots) the Mann–Whitney test was used Significant differences were defined as p \ 0.05 All values are reported as mean values ± standard error of means (SEM) Fig Fork lengths of cod and haddock from the two trawl nets *Significant difference between the trawl nets Mean ± standard error of the mean (SEM) (n = 122–530) and haddock caught with the T90 codend were on average 1.5 and 0.5 cm longer (fork length), respectively, than cod and haddock caught with the traditional codend (p \ 0.05) Mortality and injuries Results Catch amount and fish size During the trip a total of 47,600 kg of gutted fish was landed from 16 different hauls (Table 1) The two codends contributed the same amount of total catch, namely, 24 tons fish from each trawl gear The average length of cod and haddock from the various hauls is given in Fig In terms of fish length between fish caught in the two trawl nets, cod from Hauls 4, 7, and 13 and haddock from Hauls and were significantly different In total, cod 123 The mortality of cod caught by the two trawl nets, evaluated immediately after the catches were brought onboard, was 2.4%, with no significant difference between the nets For haddock caught by T90 and traditional trawl nets, the mortality was 7.1 and 14.3%, respectively, but the difference was not significant In both nets, haddock had a higher mortality rate than cod (p = 0.03) More than 94% of both species exhibited various extents of scale loss, and 20–30% of the fish had some kind of injuries caused by the fishing gear (Table 3) Bruises were found on approximately 20% of both cod and haddock, while pressure injuries were found on 3–5 and 9% of the Fish Sci (2010) 76:549–559 555 Table Mean cod and haddock mortalities and injuries as percentages of the whole catch with T90 and traditional trawl nets Parameter Cod T90 Mortality 2.3 ± 2.3* Haddock Traditional 2.5 ± 2.5* 21.0 ± 2.6 T90 Traditional 7.1 ± 4.0* 14.3 ± 5.5* 21.8 ± 2.6A 30.9 ± 3.0B Gear injuries 28.3 ± 2.7 Scale loss Pressure injuries 96.3 ± 1.1 94.4 ± 1.5 98.4 ± 0.8 99.1 ± 0.6 5.5 ± 1.4* 3.2 ± 1.1* 8.5 ± 1.8* 8.6 ± 1.8* Bruises 21.3 ± 2.5 16.5 ± 2.4 19.8 ± 2.5 23.6 ± 2.8 Values are given at the mean ± standard error of the mean (SEM); n = 40–43 (mortality), n = 233–272 (injuries) Different letters (A, B) denote significant differences between the trawl nets * Significant differences between the species (p \ 0.05) total catch of cod and haddock, respectively Haddock were found to have a significantly higher scale-loss scores and a higher degree of pressure injuries than cod Moreover, haddock caught with the traditional trawl net exhibited more gear injuries than haddock caught with the T90 trawl (p \ 0.05; Fig 5) There were no significant differences between the two trawl nets in terms of external damages of cod caught Catch amount had a significant impact on the degree of injuries (Table 4) When the catch amounts were [2,000 kg, cod showed a higher degree of pressure injuries and bruises, while gear injuries were lower (p \ 0.05) The relationship between catch amount and injuries were not so pronounced for haddock At catch amounts [2,000 kg, haddock had more pressure injuries (p \ 0.05), while gear injuries and scale-loss were higher when the catch amount was \2,000 kg (p \ 0.05) No relationship between catch amounts and bruises were observed for haddock A general observation was that haddock was more vulnerable to catch handling than cod, as both the mortality and some of the injuries were higher for haddock than cod (p \ 0.05) Initial muscle-pH and rigor mortis The mean white muscle pH of cod and haddock from all the hauls and from the two trawl nets were 7.3 ± 0.2 and 6.8 ± 0.2, respectively There was no significant difference between the trawl nets, but for cod the initial muscle pH showed significant difference between some of the hauls (Table 5) Cod from Haul had significantly lower initial pH value compared with cod from Haul 12 and 15 However, there were significant differences between the species and initial muscle pH (p \ 0.001) The mean body temperature ranged from 6.0 to 7.5°C according to sea temperatures (Table 5) Fig Effect of using T90 and traditional trawl nets to catch fish on external damage (gear injuries, scale-loss, pressure injuries and bruises) of cod and haddock *Significant difference between the two trawl nets (p \ 0.05) Mean ± SEM (n = 233–272) Rigor mortis assessments for both species are shown in Fig Rigor onset started within h after catching Firm rigor (score [2) was evident in 63% of the fish after 10 h postharvest; after 20 h postharvest, 100% of both species were in peak rigor No significant differences in the rate of rigor development were observed between the two trawl nets Haddock seemed to enter rigor a little later than cod, but rigor peaked at the same time in both fish None of the dead fish showed visible signs of rigor when the catch was brought on board Fillet quality After 10 days (haddock) and 11 days (cod) postmortem, the ultimate pH values for cod (pH 6.9 ± 0.2) and haddock (pH 6.5 ± 0.1) were significantly different (p \ 0.05) (Table 6) The mean gaping score for both species was low (Table 6), and there was no difference between the two trawl nets for both species However, the gaping score for cod fillets caught with the traditional trawl net tended to be 123 556 Fish Sci (2010) 76:549–559 Table Mean cod and haddock injuries as percentages of catch Cod catch (kg) Haddock catch (kg) Parameter n \1,000 59 1,000–2,000 380 [2,000 81 \1,000 41 Gear injuries 28.8 ± 0.1A 27.1 ± 0.0A 11.1 ± 0.0B 17.1 ± 6.0AB Scale-loss 91.5 ± 0.0 Pressure injuries Bruises 95.8 ± 0.0 A 6.8 ± 0.0 33.9 ± 0.0A 100 ± 0.0 A 12.2 ± 5.2 26.8 ± 7.0 A 96.3 ± 0.0 A 1.8 ± 0.0 14.0 ± 0.0B B 14.8 ± 0.0 32.1 ± 0.0A 1,000–2,000 355 [2,000 85 30.7 ± 2.5A 11.8 ± 3.5B 99.7 ± 0.3 A 94.1 ± 2.6B 3.9 ± 1.0 19.4 ± 2.1 A 25.9 ± 4.8A 28.2 ± 4.9 Values are given at the mean ± SEM Different letters (A, B) denote significant differences between the catch amount for each species (p \ 0.05) Table Pooled initial cod and haddock white muscle pH and body temperatures from five different hauls Haul Catch amount (kg) n Initial muscle pH Body temperature (°C) Cod 1,262 4,853 3,559 7.2 ± 0.0AB* A 6.8 ± 0.1A 35 7.2 ± 0.0 * 7.5 ± 0.0B 21 AB 6.6 ± 0.0A B 7.2 ± 0.0 * 12 3,982 20 7.3 ± 0.0 * 6.0 ± 0.1C 15 2,644 20 7.3 ± 0.0B* 6.6 ± 0.0A 1,262 34 6.8 ± 0.0* 7.0 ± 0.1A 4,853 6.7 ± 0.1* 7.3 ± 0.1A 3,559 19 6.8 ± 0.0* 6.7 ± 0.1B 12 3,982 20 6.9 ± 0.0* 6.2 ± 0.1C 15 2,644 20 6.8 ± 0.0* 6.6 ± 0.1B Haddock Fig Development of rigor mortis of cod (n = 102) and haddock (n = 97) caught with T90 and traditional trawl nets Data from five different hauls are pooled Mean ± SEM The measurements were carried out within 60 after the catch was brought on deck Mean ± SEM Since there were no significant differences between the two trawl nets, the data were pooled Different letters (A, B) denote significant differences between the haul numbers Table Gaping, blood spots and ultimate pH in thawed fillets of cod and haddock caught with T90 and traditional trawl nets * Significant differences between the species (p \ 0.05) Quality parameter higher than for cod caught with the T90 gear, but the difference were not significant (p = 0.07) Blood spots were observed in 33 and 28% of cod and haddock fillets, respectively, with a score \0.6 for both species (Table 6) Again, no differences between the two trawl nets for either species nor between the species were observed (p [ 0.05) The L*, a*, b*, hue and chroma values measured on fillets of cod and haddock are shown in Table There were no significant differences between the two trawl nets for either species, and the data were therefore pooled However, there was a difference between the species in the lightness (L* value) of the fillets (p \ 0.05), with the haddock being darker than the cod Cod 123 T90 Traditional trawl net Gaping (score 0–5) 0.1 ± 0.1 0.4 ± 0.2 Blood spots (score 0–2) Ultimate pH 0.6 ± 0.2 6.9 ± 0.0* 0.4 ± 0.1 6.9 ± 0.0* Haddock Gaping (score 0–5) 0.5 ± 0.2 0.7 ± 0.2 Blood spots (score 0–2) 0.3 ± 0.1 0.3 ± 0.1 Ultimate pH 6.5 ± 0.0* 6.5 ± 0.0* The fish were evaluated after 10 days (haddock) and 11 days (cod) postmortem Values are given as the mean ± SEM, (n = 20) * Significant differences between species (p \ 0.05) No significant differences between the trawl nets were found Fish Sci (2010) 76:549–559 557 Table Cod and haddock fillet colour as L*, a*, b*, hue and chroma values after 10 days (haddock) and 11 days (cod) postmortem Colour Cod Haddock L* 50.2 ± 0.4* 48.5 ± 0.3* a* -1.4 ± 0.1 -1.4 ± 0.0 b* -3.3 ± 0.2 -2.9 ± 0.2 Hue 295.4 ± 1.4 298.1 ± 1.6 3.6 ± 0.2 3.3 ± 0.2 Chroma Values are given as the mean ± SEM (n = 40 As there were no significant differences between the two trawl nets or both fish species, the data were pooled * Significant differences between species (p \ 0.05) Discussion Even if the size of the fish did not differ much between the two trawl nets, the T90 caught significantly slightly larger fish than the traditional trawl net for both species (Fig 4) It was not possible to clarify whether this difference was due to better selectivity, possibly as a result of more open meshes and a larger cross-sectional area in the T90 codend (Fig 1), which have been documented in the Baltic cod fishery [22, 23] According to the impact of the trawl gears on injuries, the T90 caused fewer gear injuries to haddock The positive properties of the T90, with its larger cross-section, reduced flow and turbulence, appeared to reduce the damage on the more delicate fish species—in this case, haddock Similar effects were not seen for cod This is not in accordance to unpublished results of U.J Hansen, L.H Knudsen, P Nielsen and E.M Andersen (1996) who reported that cod caught with a T90 codend had 28% fewer injuries than cod caught with a traditional trawl net It can be argued that the reduced movement of codend is not a direct measurement of the ability to preserve fish quality and reduce injuries However, there is strong evidence from studies on the survival of fish after escape from the trawl that the fish are more damaged from rubbing against the netting in the trawl than from the act of penetrating the netting and escapement [24, 25] The damage is seen as pressure marks and other bruises to the flesh as well as damage to the skin, especially in the head and tail regions A possible explanation for these observations is that the fish are thrown around in the incessant turbulent flow inside the codend and are scraped against the knots in the net Nevertheless, regardless of codends, trawling had negative impacts on injuries on both fish species; in particular, various degrees of scale loss were observed on almost all fish The mortality rate was different between cod and haddock, with haddock having the highest mortality rate (Table 3) This is in accordance to McCracken [26], who found a greater mortality among haddock than Atlantic cod when both were captured by otter trawl for tagging purposes and towed for approximately 30 at speeds between 140 and 200 cm/s Beamish [13] found that the mortality varied from to 42% in haddock caught by otter trawl during a 30-min tow and a recovery period for 12 h The majority of deaths occurred during the first hour after catch It is possible that a number of other factors affected the fish quality, positively or negatively, in our experiment and thereby diminished the effect of the different codends Such factors could include the selectivity devises (flexigrids), the codend attachments (protection bags) and the thick twines used in the trawl nets The proportion of injured fish was in some cases higher when the catch size was larger (Table 4) However, the catches in this were rather small (Table 1) Wagner [18] reported that in his study the quality of the cod, expressed as external appearance and consistency, deteriorated as trawling time and catch size increased, while Hattula et al [6] did not find any effect of catch size (100–3,500 kg) on the quality of herring However, in both of these studies, the shorter the duration of the trawling, the larger the proportion of fish alive after being caught Botta and Bonnell [5] showed that the reduction in the quality of Atlantic cod caught by otter trawl was primarily due to external factors, such as delayed bleeding, storage method and time as well as catch size Catching more than tons per haul decreased the overall grade of the cod The initial pH of cod was comparatively high considering the presumed handling stress the fish were subjected to during the catching process (Table 5) The differences observed between three of the hauls were probably due to catch amount in the hauls (p = 0.03) The haul with the cod with the lowest initial muscle pH had the highest catch amount, 2.8 tons The initial pH of haddock was lower than that of cod, with no difference between trawl nets, hauls or catch amounts Our results therefore indicate that haddock is more susceptible to handling stress than cod Low pH at the time of killing is widely recognised as an indicator of handling stress, as reported in salmon [27], eel [28] and turbot [29] Typical initial muscle pH values reported for exhausted cod is about 7.0 [30–32], which is lower than that reported for our cod, namely, pH 7.2–7.3 (Table 5) Surprisingly, this means that the cod in our experiment were just partially affected by capture stress In previous studies, initial pH values for rested harvested farmed cod were reported to vary between 7.3 [30], 7.4 [32] and 7.9 [31] Rigor mortis is highly influenced by the ATP-content in the muscle, and below a critical level, actin and myosin make an irreversible bond and muscle enters rigor mortis [33] None of the fish showed visible signs of rigor when 123 704 ordinary muscle of chub mackerel increased rapidly and exceeded that seen in the dark muscle after four days of ice storage Moreover, lipid oxidation of yellowtail dark muscle was closely related to the darkening of the meat color and the development of a rancid off-odor during the early stages of ice storage The aim of the present study was to evaluate the difference in lipid oxidation rates between ordinary and dark muscles of skipjack tuna during the early stages of ice storage The effects of the application of known antioxidants, including sodium ascorbate and TroloxÒ, on lipid oxidation as well as on myoglobin oxidation were also determined Fish Sci (2010) 76:703–710 Fatty acid analysis Materials and methods Accurately weighed tricosanoic acid methyl ester (\98% purity, Nu-Chek Prep Inc., Elysian, MN, USA) was added to the TL as an internal standard, and the mixture was saponified by mol/L KOH in methanol and subsequently methylated with 14% BF3–CH3OH to obtain fatty acid methyl esters (FAMEs) The FAMEs were analyzed with a Shimadzu GC-14B gas chromatograph (Kyoto, Japan) equipped with a Supelcowax-10TM open tubular capillary column (0.25 mm i.d 30 m, 0.25 lm in film thickness, Supelco, Bellefonte, PA, USA) The oven temperature was kept at 140°C for and programmed to a final temperature of 240°C at a rate of 1°C/min The temperatures of both the injector and detector were kept at 250°C Helium was used as carrier gas at a column inlet pressure of kg/cm2 Chemicals and materials Determination of total lipid hydroperoxides Diphenyl-1-pyrenylphosphine (DPPP) was purchased from Dojindo Laboratories Co Ltd (Kumamoto, Japan) 2,6-Ditert-butyl-p-cresol (BHT) was obtained from Tokyo Kasei Kogyo Co Ltd (Tokyo, Japan) 1-Myristoyl-2-(12-((7nitro-2-1,3-benzoxadiazol-4-yl)amino)dodecanoyl)-sn-glycero-3-phosphocholine (NBD-labeled PC) was purchased from Avanti Polar Lipids Inc (Alabaster, AL, USA) TroloxÒ and sodium L-ascorbate were obtained from Aldrich Chem Co (Milwaukee, WI, USA) and SigmaAldrich (St Louis, MA, USA), respectively HPLC-grade methanol from Kokusan Chemical Co Ltd (Tokyo, Japan) and 1-butanol from Kishida Chemical Co Ltd (Osaka, Japan) were used after degassing All other chemicals were of analytical grade Total lipid hydroperoxides were analyzed by a flow injection analysis (FIA) system equipped with a fluorescent detection system using DPPP as a fluorescent reagent, as previously described [16] Briefly, a mL aliquot of NBDlabeled PC (4.82 nmol/mL in methanol) was added to a g portion of minced muscle as an internal standard, and TL were extracted and purified according to the Bligh and Dyer procedure [15] In brief, the homogenate was centrifuged at 17009g for at 4°C The lower layer was dehydrated by anhydrous sodium sulfate and filtered through a membrane filter (PTFE, 0.20 lm, Advantec Toyo Roshi Kaisha, Ltd., Tokyo, Japan) The filtrate obtained was made up to 10 mL of total volume with chloroform that had been distilled in glass beforehand A 20 lL portion of the sample solution was injected into the FIA system for the quantitative determination of total lipid hydroperoxide The changes in the total lipid hydroperoxide levels of skipjack tuna ordinary and dark muscles were then measured in each sample at 0, 18, 42 and 68 h Furthermore, changes in the total hydroperoxide contents in the ordinary muscles of skipjack tuna with added sodium ascorbate or TroloxÒ were measured at 0, 20, 48 and 68 h or at 0, 24, 48 and 72 h, respectively Fish sample preparation Five fresh skipjack tuna Katuwonus pelamis, which were landed within 12 h of being caught and kept in ice, were obtained at the fishing port of Misaki in Kanagawa Prefecture, Japan The skipjack tuna specimens weighing 1.5– 2.0 kg thus obtained were immediately stored on ice and transported to a laboratory within h Fish muscle specimens were separated into ordinary and dark muscles The separated muscle was thoroughly minced with a food processor (model MK-K50, National, Osaka, Japan), and sodium ascorbate was added at 5, 25, 250 and 500 ppm, or TroloxÒ at 2, 10 and 50 ppm, respectively, before it was stored on ice in polyethylene bags Lipid extraction Total lipids (TL) were extracted and purified according to the method of Bligh and Dyer [15] 123 Metmyoglobin analysis The metmyoglobin percentage of the total myoglobin present in the ordinary muscle was measured according to the procedure of Bito [17] Briefly, a portion (3 g) of minced muscle was transferred into a polypropylene centrifuge tube Ice-cooled distilled water (10 mL) was added to the tube and the contents were mixed gently with a TeflonÒ-coated magnetic stirring bar The mixtures were kept at 4°C for 10 and centrifuged at 17009g for Fish Sci (2010) 76:703–710 The supernatant was filtered through a No filter paper (Advantec Toyo Roshi Kaisha, Ltd., Tokyo, Japan) and the pH was adjusted to 6.8–7.0 by M NaOH The filtrate was filtered again through a membrane filter (Cellulose Acetate, 0.45 lm, Advantec Toyo Roshi Kaisha, Ltd., Tokyo, Japan), and a 100 lL portion of filtrate was passed to an HPLC equipped with a G3000SWXL TSKGEL HPLC column (300 7.8 mm i.d., Tosoh, Tokyo, Japan) to separate out the myoglobin A mobile phase of 10 mM phosphate buffer (pH 6.8) containing 0.2 M Na2SO4 was pumped with a Shimadzu model LC-10AS HPLC pump (Kyoto, Japan) at a flow rate of 1.0 mL/min The absorbency of the supernatant was measured at 540 nm (E540) and 503 nm (E503) with a Shimadzu model SPD-M10AVP photodiode array detector The percentage metmyoglobin was calculated using the absorption ratio (E540/E503) according to the formula for tuna myoglobin reported by Bito [17] The change in the percentage metmyoglobin formed in the ordinary muscles was measured in each sample every h from to 48 h Analysis of a-tocopherol Total lipids were extracted with chloroform and methanol according to the Bligh and Dyer procedure [15] 2,2,5,7,8Pentamethyl-6-hydroxychroman was added as an internal standard before lipid hydrolysate was prepared Lipid extract was evaporated to dryness in vacuo and dissolved in n-hexane for analysis A LiChrosorbÒ Si-60 silica-gel column (5 lm, 250 mm i.d., Merck, Darmstadt, Germany) was used as an analytical column, and a mobile phase of n-hexane:2-propanol (99.5:0.5, v/v) mixture was pumped with a Shimadzu model LC-9A HPLC pump at a flow rate of 1.0 mL/min The fluorescence intensity was monitored at 297 nm of excitation and at 327 nm of emission with a Shimadzu model RF-550 spectrofluorometric detector The fluorescence intensity was integrated with a Shimadzu Chromatopac C-R3A chromatographic integrator The detector signals were quantified using peak areas and a calibration curve previously obtained by analyzing authentic a-tocopherol (Eisai Co., Ltd Tokyo, Japan) in n-hexane under similar analytical conditions The change in a-tocopherol content in ordinary muscle was measured for one sample at 0, 24, 48 and 72 h Statistical analysis Chemical and instrumental analyses were carried out in triplicate, exceptin the analysis of a-tocopherol, in order to enable significantdifferences among mean values [18] to be ascertained A statistically significant difference between two mean values was declared for P \ 0.05 and P \ 0.01 [19] 705 Results Total lipid contents and fatty acid compositions The lipid contents of skipjack tuna ordinary and dark muscles were 1.9 ± 0.2 and 8.8 ± 1.3 g/100 g muscle, respectively The fatty acid compositions of ordinary and dark muscles of skipjack tuna are summarized in Table The predominant fatty acids were 16:0, 18:0, 18:1n-9, 20:5n-3 (EPA) and 22:6n-3 (DHA) in both ordinary and dark muscles The contents of PUFAs, including EPA and Table Fatty acid compositions in ordinary and dark muscles of skipjack tuna (mg/g muscle) Fatty acid Ordinary muscle Dark muscle day days day days 14:0 0.31 0.41 1.35 1.26 15:0 0.12 0.13 0.45 0.39 16:0 4.24 4.09 9.25 9.25 18:0 2.06 1.89 5.25 5.75 Total saturated 6.73 6.52 16.30 16.65 15:1n-6 0.34 0.27 0.35 0.05 16:1n-7 0.41 0.36 1.42 0.98 18:1n-9 1.29 1.32 3.45 2.84 18:1n-7 0.42 0.39 1.15 1.08 20:1n-7 22:1n-7 0.13 Tr 0.11 Tr 0.25 0.25 0.25 0.25 Total monoenoic 2.59 2.45 6.87 5.45 16:2n-6 0.12 0.12 0.27 0.26 16:3n-6 0.14 0.13 0.35 0.25 16:2n-4 0.23 0.21 0.62 0.63 16:3n-4 16:4n-3 0.17 0.23 0.16 0.23 0.15 0.15 0.15 0.15 18:2n-6 0.21 0.22 0.74 0.48 18:2n-4 0.14 0.14 0.21 0.22 18:3n-4 0.07 0.06 0.15 0.21 18:3n-3 0.12 0.12 0.25 0.15 18:4n-3 0.09 0.10 0.45 0.15 20:4n-6 0.64 0.54 0.95 0.55 20:5n-3 1.80 1.39 3.63 1.63 22:3n-3 0.32 0.34 0.71 0.45 22:5n-3 0.19 0.18 0.53 0.35 22:6n-3 7.81 5.76 18.73 9.85 12.28 9.70 27.89 15.48 Total n-6 1.45 1.28 2.66 1.59 Total n-3 10.56 8.12 24.45 12.73 n-6/n-3 Total fatty acid 0.14 21.60 0.16 18.67 0.11 51.06 0.12 37.58 Total polyenoic Tr, trace 123 Fish Sci (2010) 76:703–710 Lipid hydroperoxide (nmol/g muscle) 706 Effects of antioxidant addition on hydroperoxide formation 800 , Ordinary muscle * , Dark muscle 600 400 200 * * * 24 48 72 Storage time (h) Fig Changes in lipid hydroperoxide in ordinary and dark muscles of skipjack tuna during ice storage Significant differences (P \ 0.01) between ordinary and dark muscles are indicated by asterisks DHA, were markedly higher in the dark muscle compared to the ordinary muscle The PUFA content of skipjack tuna tended to decrease for both the ordinary and dark muscles throughout the storage period The PUFAs contents of skipjack tuna ordinary and dark muscles were 12.28 and 27.89 mg/g, respectively, at the beginning of ice storage, and these became 9.70 and 15.48 mg/g, respectively, after three days of ice storage The PUFA content ratio decreased rapidly in the dark muscle (44.5%) compared to the ordinary muscle (21.1%) after three days of ice storage Lipid oxidation of fish meat Changes in total lipid hydroperoxide in ordinary and dark muscles of skipjack tuna during ice storage are shown in Fig The total lipid hydroperoxide contents were higher in the dark muscles than in the ordinary muscles However, the total lipid hydroperoxide content in the ordinary muscle tended to increase throughout the storage period of 72 h 2500 Lipid hydroperoxide (nmol/g muscle) Fig Changes in lipid hydroperoxide in the ordinary muscle of skipjack tuna added with sodium ascorbate (a) and TroloxÒ (b) during ice storage Significant differences (P \ 0.05) of the sample muscles are represented with different superscripts (a–d) The effects of antioxidant addition on the total lipid hydroperoxide content during ice storage are illustrated in Fig There was no difference between the sample groups with added sodium ascorbate and the control group without sodium ascorbate in terms of the total lipid hydroperoxide content in the ordinary muscle for the first 20 h of ice storage (Fig 2A) After 20 h of storage, the total lipid hydroperoxide contents remarkably increased in the control group and the groups with an additional and 25 ppm of sodium ascorbate The total lipid hydroperoxide contents were significantly lower in the groups with an additional 250 and 500 ppm of sodium ascorbate compared to the control group With the addition of higher concentrations of sodium ascorbate, more effective prevention of hydroperoxide formation was observed Changes in the total lipid hydroperoxide contents observed in ordinary muscles of skipjack tuna with added TroloxÒ are shown in Fig 2b After 24 h of ice storage, the total lipid hydroperoxide content increased in a similar manner to the contents in the group with ppm TroloxÒ and the control group without TroloxÒ After 72 h of ice storage, the total lipid hydroperoxide content in the control group increased at a higher rate Meanwhile, the total lipid hydroperoxide contents were significantly lower in the groups with 10 and 50 ppm TroloxÒ than in the control group Thus, the addition of TroloxÒ suppressed initial lipid oxidation in the ordinary muscle during the ice storage period In particular, the accumulation of total lipid hydroperoxides was significantly suppressed in the group with 50 ppm TroloxÒ, even after 72 h of ice storage 2500 (a) a a a , control 2000 , ppm (b) , ppm , 250 ppm X, 500 ppm 1000 1500 a ab b b , 50 ppm b 1000 b b 500 a a ab 0 bc c 24 500 c c b 72 c c c c 48 c a Storage time (h) 123 a , 10 ppm , 25 ppm 1500 a , control 2000 24 48 d 72 Fish Sci (2010) 76:703–710 Fig Changes in the color of the minced ordinary muscle of skipjack tuna with added sodium ascorbate or TroloxÒ during ice storage for 36 h a, control; b, 250 ppm sodium ascorbate; c, 10 ppm TroloxÒ 707 12 h 0h a b c 24 h a b c a b c 36 h a b c Changes in the color of fish meat Formation of metmyoglobin % Metmyoglobin Changes in the color tone of the ordinary muscle during ice storage are shown in Fig The color of the ordinary muscle with 250 ppm sodium ascorbate or 10 ppm TroloxÒ changed slightly after 36 h of ice storage In contrast, the ordinary muscles of the control group changed from light pink to dark brown after 36 h Changes in the content of a-tocopherol The effects of the addition of sodium ascorbate and TroloxÒ on a-tocopherol oxidation in skipjack tuna a a a b b c , control , 250 ppm ascorbic bi acid id 80 , 10 ppm Trolox® a 60 a 40 b b b c a a a 20 b b b b c c b c b Metmyoglobin formation increased sharply in the control group, and all the myoglobin had turned into metmyoglobin after 30 h of ice storage (Fig 4) The percentage of metmyoglobin in the ordinary muscle with added sodium ascorbate increased markedly and accounted for 40% of the myoglobin at 18 h of ice storage Thus, the oxidation of myoglobin to metmyoglobin was controlled by the addition of sodium ascorbate In ordinary muscle with added TroloxÒ, the rate of metmyoglobin formation increased slowly during ice storage Furthermore, the percentage of metmyoglobin remained below 50% in both groups with added sodium ascorbate and TroloxÒ a 100 12 18 24 30 36 42 48 Storage time (h) Fig Changes in the percentage of metmyoglobin in the ordinary muscles of skipjack tuna added with sodium ascorbate and TroloxÒ during storage for 48 h Significant differences (P \ 0.05) of the sample muscles are represented with different superscripts (a–c) ordinary muscle are shown in Fig The a-tocopherol content gradually decreased and had almost declined to zero at 72 h of ice storage in the control group In contrast, the a-tocopherol content remained unchanged in the groups with 250 ppm sodium ascorbate and 10 ppm TroloxÒ, even after 72 h of ice storage These results indicate that the addition of sodium ascorbate and TroloxÒ to the ordinary muscle controls the oxidation of a-tocopherol effectively 123 Fish Sci (2010) 76:703–710 α-Tocopherol content (μg/g muscle) 708 , control , 250 ppm ascorbic acid , 10 ppm Trolox ® 24 48 72 Storage time (h) Fig Changes in a-tocopherol contents in the ordinary muscles of skipjack tuna added with sodium ascorbate and TroloxÒ during ice storage for 72 h Discussion This study showed that the total hydroperoxide content in dark muscle is higher than that in ordinary muscle These results concur with those obtained by Nakamura et al [20], who reported that the levels of lipid peroxides were higher in the physiologically active tissues of fish such as liver and dark muscle compared to ordinary muscle just after sacrifice However, the total lipid hydroperoxide quickly accumulates in not only dark muscle but also ordinary muscle of skipjack tuna These results coincide with those obtained from Pacific saury, Japanese Spanish mackerel and chub mackerel in our previous study [14], in which ordinary muscles of yellowtail, amberjack and other white-muscle fish contained low levels of hydroperoxide On the other hand, the ordinary muscles of chub mackerel and skipjack tuna contain higher levels of hydroperoxide This difference in the rate of total lipid hydroperoxide formation in ordinary muscles may be due to the different heme protein contents of different fish species Formation of metmyoglobin through the oxidation of myoglobin, predominantly in dark muscle, usually accelerates lipid oxidation and leads to the generation of greater amounts of lipid hydroperoxide Thus, the lipid oxidation associated with metmyoglobin formation may have caused the development of the rancid off-odor and fishy smell in dark muscle On the other hand, the color of ordinary muscle with a lower myoglobin content changed from pink to brown after 24 h of ice storage, and a rancid off-odor developed after 30 h of ice storage (data not shown) The faster rate of lipid oxidation observed in ordinary muscle of skipjack tuna than in the ordinary muscles of other fish species, as observed in the present study, may be due to higher contents of myoglobin and hemoglobin in the muscle Matsuura and Hashimoto [12] reported that the contents of myoglobin and hemoglobin in the ordinary muscles of yellowtail are 30 mg/100 g muscle, and that myoglobin accounts for 100% However, the total amounts 123 of myoglobin and hemoglobin in the ordinary muscles of skipjack tuna are higher, amounting to 139–173 mg/100 g muscle, and myoglobin accounts for 62–86% of the hemeproteins [21] Therefore, it is postulated that myoglobin and hemoglobin in the ordinary muscles of skipjack tuna act as catalysts of lipid oxidation There have been a number of reports on the catalyzing activity of myoglobin and hemoglobin in lipid oxidation [22–26] Antioxidants are usually used to prevent undesirable oxidative changes in fresh meat and various foodstuffs Some researchers have reported that ascorbic acid have no preventative effects on lipid oxidation, and that it even promotes oxidation [22, 27, 28] The function of the ascorbic acid added to the meat is affected by a lot of factors, including the presence of unsaturated fatty acid, enzymes, metal ions, and the storage conditions In the present study, the addition of and 25 ppm sodium ascorbate did not have any preventative effect on lipid oxidation Sodium ascorbate acted as a prooxidant at lower concentrations and as an antioxidant at higher concentrations when added to beef muscle [29] The addition of 500 ppm sodium ascorbate was more effective at suppressing lipid oxidation than the addition of 250 ppm sodium ascorbate in the present study, implying that the antioxidative effects of sodium ascorbate are concentration dependent It has been reported that the addition of sodium ascorbate prevents lipid oxidation and color changes in ground beef [30] In the present study, promising antioxidative effects of TroloxÒ compared to sodium ascorbate were observed (Fig 3) These results coincide well with those obtained by Cort et al [31], who reported that the comparative antioxidant activities of certain antioxidants in a bulk soybean oil system in a thin layer decreased in the order of tert-butylhydroquinone (TBHQ) = TroloxÒ [ ascorbyl palmitate (AP) [ butylated hydroxytoluene (BHT) [ butylated hydroxyanisole (BHA) [ a-tocopherols For chicken fat, the antioxidant activity decreased as follows: TBHQ = TroloxÒ [ BHA [ BHT [ a-tocopherols [ AP In this study, TroloxÒ was excellent at preventing myoglobin oxidation to metmyoglobin, as well as a-tocopherol degradation Antioxidative effects of TroloxÒ, particularly those against lipid and myoglobin oxidation, have been reported in muscles [24, 32, 33] The present study proved that the addition of 10 and 50 ppm TroloxÒ was most effective at preventing lipid oxidation However, the rates of formation of hydroperoxide and myoglobin were faster in the group with ppm TroloxÒ than in the control group The radicals generated from oxidized TroloxÒ may act as a prooxidant, and the accumulation of lipid hydroperoxide accelerated when ppm TroloxÒ were added, compared to the accumulation seen for the control group The concentrations of ascorbic acid and TroloxÒ that could control initial lipid oxidation in ordinary muscles of Fish Sci (2010) 76:703–710 skipjack tuna were 250 and 10 ppm, respectively As a result, the addition of a-tocopherol controls oxidation by donating a hydrogen atom to a peroxyl radical in the chain reaction and so eventually terminating the reaction a-Tocopherol contents did not decrease in the groups with added antioxidants, probably because the a-tocopherol radical was reduced by sodium ascorbate and TroloxÒ Sodium ascorbate and TroloxÒ delayed the accumulation of lipid hydroperoxide compared to the control groups in the present study, suggesting that sodium ascorbate and TroloxÒ act as scavengers of free radicals under hydrophilic conditions in fish muscles during the early stages of metmyoglobin formation The autoxidation of myoglobin, which is abundant in muscle tissues, produces methemoglobin with the ferric states of a heme iron The interaction of hydrogen peroxide with metmyoglobin or methemoglobin generates activated heme proteins in which the ferryl species, considered to be more selective than the hydroxyl radical, could initiate lipid oxidation in muscle foods Thus, the mechanism of lipid oxidation by hemoproteins involves the activation of the iron catalyst by the formation of ferryl iron, which can initiate lipid oxidation by hydrogen abstraction to produce a lipid radical along with a protein Thus, in the present study, it was concluded that adding ascorbic acid and TroloxÒ to skipjack tuna muscle cytosol effectively inhibits the oxidation promoted by ferryl irons in membranes Acknowledgments This study was supported in part by a grant from the Fisheries Agency, Ministry of Agriculture, Forestry and Fisheries of Japan References Faustman C, Cassens RG (1990) The biochemical basis for discoloration in fresh meat: a review J Muscle Foods 1:217–243 Liu Q, Lanari MC, Schaerer DM (1995) A review of dietary vitamin E supplementation for improvement of beef quality J Anim Sci 73:3131–3140 Risvik E (1994) Sensory properties and preferences Meat Sci 36:67–77 Frankel EN (1984) Lipid oxidation: mechanisms, products and biological significance J Am Oil Chem Soc 61:1908–1917 Benzie IFF (1996) Lipid peroxidation: a review of causes, consequences, measurement and dietary influences Int J Food Sci Nutr 47:223–261 Ke PJ, Ackman RG, Linke BA (1975) Autoxidation of polyunsaturated fatty compounds in mackerel oil: formation of 2,4,7decatrienals J Am Oil Chem Soc 53:349–353 McGill AS, Hardy R, Gunstone FD (1977) Further analysis of the volatile components of frozen cold stored cod and the influence of these on flavour J Sci Food Agric 28:200–205 Swoboda PAT, Peers KE (1977) Volatile odorous compounds responsible for metallic, fishy taint formed in butterfat by selective oxidation J Sci Food Agric 28:1010–1018 Josephson DB, Lindsay RC, Stuiber DA (1984) Variations in the occurrences of enzymically derived volatile aroma compounds in salt- and freshwater fish J Agric Food Chem 32:1344–1347 709 10 Haard NF (1992) Biochemistry and chemistry of color and color change in seafoods In: Flick GJ, Martin RE (eds) Advances in seafood biochemistry Technomic, Lancaster, pp 305–360 11 Kannan G, Kouakou B, Gelaye S (2001) Color changes reflecting myoglobin and lipid oxidation in chevon cuts during refrigerated display Small Rumin Res 42:67–74 12 Matsuura F, Hashimoto K (1959) Chemical studies on the red muscle (‘‘Chiai’’) of fishes X A new method for determination of myoglobin Nippon Suisan Gakkaishi 24:809–815 13 Richards MP, Hultin HO (2002) Contributions of blood and blood components to lipid oxidation in fish muscle J Agric Food Chem 50:555–564 14 Sohn JH, Taki Y, Ushio H, Kohata T, Shioya W, Ohshima T (2005) Lipid oxidations in ordinary and dark muscles of fish Influence on rancid off-odor development and color darkening of yellowtail flesh during ice storage J Food Sci 70:S490– S496 15 Bligh EG, Dyer WJ (1959) A rapid method of total lipid extraction and purification Can J Biochem Physiol 37:911–917 16 Sohn JH, Taki Y, Ushio H, Ohshima T (2005) Quantitative determination of total lipid hydroperoxides by a flow injection analysis system Lipids 40:203–209 17 Bito M (1965) Studies on the retention of meat color of frozen tuna II Effect of storage temperature on preventing discoloration of tuna meat during freezing storage Nippon Suisan Gakkaishi 31:534–539 18 Box GEP, Hunter WG, Hunter JS (1978) Statistics for experimenters Wiley, New York, pp 21–56 19 Steel RGD, Torrie JH (1980) Principles and procedures of statistics, 2nd edn McGraw-Hill, New York 20 Nakamura T, Tanaka R, Higo Y, Taira K, Takeda T (1998) Lipid peroxide levels in tissues of live fish Fish Sci 64:617–620 21 Suzuki N, Hashimoto K, Matsuura F (1973) Studies on the color of skipjack meat Nippon Suisan Gakkaishi 39:35–41 22 Ohshima T, Wada S, Koizumi C (1988) Influences of heme pigment, non-heme iron, and nitrite on lipid oxidation in cooked mackerel meat Nippon Suisan Gakkaishi 54:2165–2171 23 Chan HWS, Levett G (1977) Autoxidation of methyl linoleate Separation and analysis of isomeric mixtures of methyl linoleate hydroperoxides and methyl hydroxylinoleates Lipids 12:99–104 24 O’Grady MN, Monahan FJ, Brunton NP (2001) Oxymyoglobin oxidation and lipid oxidation in bovine muscle—mechanistic studies J Food Sci 66:386–391 25 Richards MP, Hultin HO (2003) Effects of added hemolysate from mackerel, herring and rainbow trout on lipid oxidation of washed cod muscle Fish Sci 69:1298–1300 26 Undeland I, Kristinsson HG, Hultin HO (2004) Hemoglobinmediated oxidation of washed minced cod muscle phospholipids: effects of pH and hemoglobin sources J Agric Food Chem 52:4444–4451 27 Hatate H, Kochi M (1992) Effect of antioxidants on lipid oxidation in homogenate of Japanese oyster during storage at and -25°C Nippon Suisan Gakkaishi 58:2397 28 Yin MC, Faustman C, Riesen JW, Williams SN (1993) a-Tocopherol and ascorbate delay oxymyoglobin and phospholipid oxidation in vitro J Food Sci 58:1273–1276 29 Sato K, Hegarty GR (1971) Warmed-over flavor in cooked meats J Food Sci 36:1098–1102 30 Ahn DU, Nam KC (2004) Effects of ascorbic acid and antioxidants on color, lipid oxidation and volatiles of irradiated ground beef Radiat Phys Chem 71:149–154 31 Cort WM, Scott JW, Araujo M, Mergens WJ, Cannalonga MA, Osadca M, Harley H, Parrish DR, Pool WR (1975) Antioxidant activity and stability of 6-hydroxy-2,5,7,8-tetramethylchroman-2carboxylic acid J Am Oil Chem Soc 52:174–178 123 710 32 Mielnik MB, Aaby K, Skrede G (2003) Commercial antioxidants control lipid oxidation in mechanically deboned turkey meat Meat Sci 65:1147–1155 123 Fish Sci (2010) 76:703–710 33 Nam KC, Ahn DU (2003) Use of antioxidants to reduce lipid oxidation and off-odor volatiles of irradiated pork homogenates and patties Meat Sci 63:1–8 Fish Sci (2010) 76:711–718 DOI 10.1007/s12562-010-0257-z ORIGINAL ARTICLE Social Science Econometric analysis of the factors contributing to the fish price increase in coastal TURFs in Japan: the case of income-pooling fishery for coastal shrimp ‘‘Sakuraebi Sergia lucens’’ Yutaro Sakai • Takahiro Matsui • Nobuyuki Yagi Yoshihito Senda • Hisashi Kurokura • Received: 26 December 2009 / Accepted: 23 April 2010 / Published online: 18 June 2010 Ó The Japanese Society of Fisheries Science 2010 Abstract While rights-based management systems have often been encouraged as effective management tools, few studies have analyzed the effects of those systems empirically In this article, we have focused on a special form of the territorial use rights in fisheries strategy, namely, an income-pooling system, and examined the effects of this system empirically Earlier studies have regarded the control of fish landing amount and improvement of the quality of fish as the two main determining factors in such a system Consequently, in our study, we estimated the relationships between these two factors and the price of fish using the econometric method The results show that the two factors indeed have significant effects on price changes Keywords Co-integration Á Freshness Á Income pooling system Á Price Á Production control Á TURF Á Unit root Introduction Rights-based management systems have recently been promoted as effective management tools for fisheries worldwide [1] The individual transferable quota (ITQ) system and territorial use rights in fisheries (TURFs) are typical examples of rights-based management systems Y Sakai (&) Á T Matsui Á N Yagi Á H Kurokura Graduate School of Agricultural and Life Science, The University of Tokyo, Bunkyo, Tokyo 113-8657, Japan e-mail: aa086253@mail.ecc.u-tokyo.ac.jp Y Senda Amita Institute for Sustainable Economies, Chiyoda, Tokyo 102-0075, Japan While the ITQ system has been applied to many fisheries in developed countries, the TURFs strategy has been attracting increasing attention for its potential to manage fisheries in developing countries [2] Those two management systems have been studied intensively in recent decades However, most of these studies employed a theoretical or descriptive approach to analyze the effects of the respective system, and very few attempts were made to evaluate the economic performances of the management systems using empirical data, such as production and price records In the study reported here, we focused on the TURFs strategy as implemented in Japanese coastal fisheries, especially in those cases in which fishermen had introduced a unique management system called an income-pooling system Under this system, a team of fishermen harvest fish simultaneously under collaborative arrangements, sell the catch cooperatively, and divide the total income based on a specific set of rules [3, 4] This management system eases the scramble for fish among the fishermen and has many benefits in terms of resource utilization and fishermen’s income [4] Hirasawa [5] divided the system into two categories based on its main effects: the production increase type (A type) and the income increase type (B type) The A type increases the production amount through an optimal effort distribution in terms of the fishing ground Platteau and Seki [6] studied empirically this type of income pooling system in the Shiroebi fishery in Toyama Bay, Japan However, the production increase effect can be considered to be a general effect of an efficient fishing operation and not as a unique characteristic of the incomepooling system Therefore, in our study, we focused on management system type B Hirasawa [5] further divided type B into two categories: the fish price increase type [type (1)] and the freshness keeping type [type (2)] Type (1) increases the fish price 123 712 through production control (quantity control), and type (2) also increases the fish price, but by keeping the fish fresh (quality control) Both types increase the price of the fish and the income of the fishermen Baba and Hasegawa [7] and Matsui [8, 9] studied the effects of type (1) in Sakuraebi fishery in Suruga Bay, but there have been few case studies on the effects of type (2), possibly due to the difficulty of obtaining data on the freshness of fish However, since the consumption of fresh fish is often the most preferred and highly priced product form [10], improving the freshness of fish is extremely important as a management option to increase the income of fishermen Therefore, if the income-pooling system has the effect of improving the freshness of fish, we also have to incorporate it into our analysis to evaluate the system We selected the Sakuraebi fishery in Suruga Bay for study and analyzed the price change of the fish under the income-pooling system The main objective of this study was to analyze the two types of price increase mentioned above in an empirical manner and evaluate the effect of the income-pooling system Materials and methods Research field Sakuraebi Sergia lucens is a tiny shrimp (body length 3– cm) with a lifespan of about 15 months Spawning season is during the summer The shrimp stay in the deep layer of the bay (depth 300–400 m) during the daytime and swim up to the surface layer (depth 30–80 m) at night Sakuraebi is harvested only in Suruga Bay, although the same species is distributed in other area, such as Sagami Bay or Tokyo Bay [11, 12] In more recent times, the import of Sakuraebi from Taiwan has been increasing, but it is treated as a different product from that harvested in Suruga Bay Therefore, in our study, we focused solely on the Sakuraebi harvested in Suruga Bay The Sakuraebi fishery is a licensed fishery in which 720 fishermen are actively employed on 120 vessels in three coastal towns around Suruga bay, namely Yui, Kanbara, and Ooigawa There are two fishing seasons: the spring season starts in May and finishes in June, and the autumn season from October to December At the present time, each season consists of about 20 fishing days, totaling about 40 days annually The fishing method is pair-boat trawl net Daily fishing activity takes about several hours, from early evening to the night as the best fishing time is shortly after the sunset The harvested shrimp are stored in a refrigerator at the port and auctioned the next morning to processors and fish dealers The shrimp bought in the auction are further distributed as fresh, frozen, or 123 Fish Sci (2010) 76:711–718 traditionally processed products (boiled and sun-dried) In 1985, the share of the fresh and frozen products was 10%, with the traditionally processed product accounting for 90% [11] More recently, however, the share of fresh and frozen products has been increasing, and several auction participants told one of the authors that in September 2009 it was about 30% History of Sakuraebi fishery in Suruga Bay Sakuraebi fishery started in 1895 and became a licensed fishery in 1910 In 1969, the fishermen introduced the income-pooling system separately in the three coastal towns in an effort to alleviate the increased competition among fishermen Although this system had some effect on maintaining higher prices and limiting harvest volume, the competition among the three towns still remained intense Therefore, in 1977, the system was modified and expanded to a unified pooling system covering the three towns [11, 12] To maintain the freshness of the shrimps, fishermen started to use ice on their vessels in 1980 In 2001, fish pumps were introduced to all the vessels in the fishery Fish pumps can pump shrimps with seawater so that the body of the shrimps is usually kept unharmed and the freshness of the shrimps is maintained In 2001, a large refrigerator was introduced in Yui port so that all of the shrimp landed in the port could be stored in it until the auction the next morning This refrigerator is considered to have made a major contribution towards maintaining the freshness of the shrimps Figure shows the yearly changes in Sakuraebi production and price Production increased until the introduction of the regional pooling system in 1969, then decreased Production reached 7748 tons in 1969, but in more recent times it has been slightly lower than 2000 tons The price has shown an upward trend throughout this observation period In 1969, the price increased dramatically, possibly due to the decrease in production under the pooling system The price increased further during the first decade of the 2000s amid a period of stable production volume, possibly due to an increase in the freshness of the shrimp following the introduction of the port refrigerator and fish pumps In 2007, the average annual price was 2793 yen/kg Analytical model Time series data on the freshness of the shrimp were not available, so we used the after-auction distribution share of fresh and frozen shrimp in this study In general, as the freshness of the shrimp improves, the proportion of fresh and frozen shrimp increases and that of traditional processed products (boiled and sun-dried) decreases, so the Fish Sci (2010) 76:711–718 713 10000 production 3000 price 2500 Production (tons) 8000 2000 6000 1500 4000 Price (yen/kg) Fig The real price and production of Sakuraebi 1000 2000 500 0 1956 1961 1966 1971 1976 1981 1986 1991 1996 2001 2006 Year distribution share after the auction can be used as a proxy variable for the freshness of the shrimp We treated the share as an exogenous variable in our model The validity of this treatment is discussed in a following section We assumed that the demand for the shrimp can be divided into two parts: the demand for fresh/frozen shrimp and that for traditional processed shrimp products We employed the same two assumptions as Matsui [8], as follows: Assumption The demand and price of fresh/frozen and processed product are independent Assumption The partial adjustment coefficients of fresh/ frozen and processed demand functions are equal In addition, we made a third assumption, which was entirely new Assumption The effects of month, income, and time trend are equal to the demand for fresh/frozen and processed products According to the interview survey conducted in this study, Sakuraebi harvested in Suruga Bay can be substituted by Sakuraebi imported from Taiwan and Akiami paste shrimps imported from China and Viet Nam when there is a shortage in the supply of products from Suruga Bay The price of Sakuraebi harvested in Suruga Bay is usually determined by the harvested quantity in Suruga Bay and is hardly affected by the price of these imported shrimps Therefore, we did not incorporate any substitute goods in our analysis, assuming that the influence of the effect is limited We assumed a linear functional form and employed a partial adjustment model Based on these assumptions, the fresh/frozen shrimp and processed shrimp inverse-demand functions can be given by Pf ¼ af þ bf Q f þ X cI MDI f þ dY þ eP ðÀ1Þ þ f TIME and PP ¼ aP þ bP QP þ X ð1Þ cI MDI þ dY P þ eP ðÀ1Þ þ f TIME ð2Þ respectively, where P is the price, Q is the quantity, MDI is the monthly dummy variable for month I, and TIME is the time trend variable The superscript f denotes the fresh/ frozen products and p denotes the processed products If the distribution ratio of fresh and frozen products to processed products is k: (1 - k), then the total inversedemand function can be represented as P¼ kQPf þ ð1 À kÞQPP Q ¼ ap þ ðaf À ap Þk þ bf k2 Q þ bp ð1 À kÞ2 Q X þ cI MDI þ dY þ ePðÀ1Þ þ f TIME ð3Þ Therefore, the average price for the shrimp can be explained by the eight types of variables: constant term, k, k2Q, (1 - k)2Q, MDI, Y, P(-1), and TIME To simplify the equation, we modify the representation of Eq as X cI MDI þ dY P ¼ a þ bk þ ck2 Q þ dð1 À kÞ2 Q þ þ ePðÀ1Þ þ f TIME ð4Þ where a ¼ ap ; b ¼ af À ap ; c ¼ bf ; d ¼ bp The long-run represented as PL ¼ inverse-demand a þ bk þ ck2 Q þ dð1 À kÞ2 Q þ 1Àe P ð5Þ function can be cI MDI þ dY þ f TIME ð6Þ 123 714 Fish Sci (2010) 76:711–718 The short-run and long-run elasticities are calculated as follows: Qt Short-run own-price elasticity: Et ¼ ðck2 þ dð1 À kÞ2 Þ Pt ð7Þ Short-run expenditure elasticity: gt ¼ d Long-run own-price elasticity: Et ¼ Yt Pt ð8Þ ðck2 þ dð1 À kÞ2 Þ Qt 1Àe Pt ð9Þ Long-run expenditure elasticity: gt ¼ d Yt À e Pt ð10Þ Simulation analysis is usually conducted by assigning an assumed value to the model and comparing the results with the standard value This approach allows the difference between the standard value and the simulated value at each time point to be identified However, the purpose of this study was to analyze the total effect of the income-pooling system from 1968 to 2007, and we can therefore simply calculate it by an integration calculation to fulfill our purpose Since we employed the partial adjustment model, price fluctuations during a certain period caused by fluctuations in the values of explanatory variables are path-dependent However, in the long-run, the partial adjustment can be finished, and the price changes can be seen as path-independent To keep the discussion simple, we calculated only the long-run price changes The price fluctuations in the long-run caused by the change of the production and the after-auction distribution share are thus calculated as ZQ2 DPQ ¼ 1Àe oP dQ ¼ fck2 þ dð1 À kÞ2 gðQ2 À Q1 Þ oQ 1Àe Q1 ð11Þ and DPk ¼ 1Àe Zk2 oP dk ok k1 À ÁÉ È ðb À 2dQÞðk2 À k1 Þ þ Qðc þ dÞ k22 À k12 ; ¼ 1Àe ð12Þ respectively, where Q1 and Q2 are the production amount in time t1 and t2, respectively, and k1 and k2 are the afterauction share of fresh/frozen products in time t1 and t2, respectively The total price change in the long-run from time t1 to t2 (DPL) can be calculated by Eq Therefore, the share of price change caused by the change in the 123 production and the after-auction distribution share are calculated as ðDPQ =DPL Þ and ðDPk =DPL Þ; respectively Data Monthly data from the spring harvest season (March–June) and the autumn harvest season (October–December) from 1964 to 2007 were used for this analysis In years when there was no fishing in March or October, the data from the rest of the months were used The sample number was 279 Variable definitions and data sources are presented in Table All of the data on price and expenditure were deflated by the consumer food price index After-auction distribution share of the fresh and frozen products There is no formal statistical information available on the after-auction distribution share of fresh and frozen products However, some information was obtained from a literature search • • • • In 1985 the share of fresh and frozen products was 10% [11] In 1993 the share for dried fish was 60%, boiled 30%, and fresh10% [11] In 1995 the share of fresh and frozen products was 10% [11] In 2005 the share of fresh and frozen products was 30% [9] The following information was verbally communicated to us: Table Variable definitions and data sources Variable Definition P Real ex-vessel price of Sakuraebi (yen/kg)a Q Landing quantity of Sakuraebi (tons)a Y Estimated total annual household expenditure (billion yen)b,c MDI Monthly dummy variable equals for month I and at all other times k The after-auction distribution share of fresh and frozen Sakuraebi TIME Time trend variable equals in March 1964 and increases by per month a Yui Fisheries Cooperative Association Landing reports b Ministry of Internal Affairs and Communications Annual report on the family income and expenditure survey c Ministry of Internal Affairs and Communications Monthly report of current population estimates Fish Sci (2010) 76:711–718 • • 715 In 2001, a large refrigerator was placed in Yui port, and in the same year fish pumps were introduced in all of the boats in Sakuraebi fishery Both types of machines greatly contributed towards improving the freshness of the fish In 2009 the distribution share of fresh and frozen products was 30% Based on the available information, we assumed that the after-auction distribution share of fresh and frozen products has shifted as follows Firstly, until 1983, the share was negligible (assumed to be a constant 0.01) because no records exist for fresh or frozen products entering the commercial distribution channels of the Sakuraebi shrimp during this period Then, from 1984 to 2000, the share was assumed to be a constant 0.1 because a literature search revealed that the share was 10% in 1985, 1993, and 1995 From 2001 onwards, the share was assumed to be a constant 0.3 because a literature search revealed that is was 0.3 in 2005 and 2009 The share was assumed to have jumped from 0.1 to 0.3 in 2001 based on the result of our verbal communications which indicated that the freshness of the shrimp was significantly improved by introducing the use of a large refrigerator in Yui port and fish pumps in the boats, both in 2001 A sensitivity test of the assumption was also conducted Table summarizes the assumption on the after-auction distribution share of fresh and frozen products Unit root test Time series data often have a unit root and a increasing or decreasing trend Therefore, time series regressions often have high R2 values and significant t statistics even though no true relation between variables in fact exists This problem is known as spurious regression [13] On the other hand, according to the Granger representation theorem, if the variables in the model have unit roots and the model can be expressed as an error correction model, the variables are co-integrated, and the estimates of the regression are not spurious [14] The error correction model can be transformed to the partial adjustment model, so the theorem can be applied to the model in this study Therefore, we conducted the augmented Dickey–Fuller (ADF) test, which is widely used for unit root tests [15] Table indicates that the test results taken together cannot reject the null hypothesis of a unit root test Table The ADF unit-root test Variable Trend and intercept s-Stat Intercept Lag s-Stat None Lag s-Stat Lag P -4.49*** -3.71*** -1.25 k2Q -2.24*** -0.76 -0.18 (1 - k)2Q Y -3.71 0.84** 10 -2.05 -4.36*** 10 -1.30 3.23 12 -17.60*** DP Dk Q -17.64*** -9.98*** -15.30*** -7.51*** 12 D(1 - k)2Q -15.30*** DY -15.70*** -17.66*** -9.94*** -15.30*** -8.76*** 10 -4.88*** 11 Optimum lag-length is determined by the Schwarz Bayesian information criterion ADF Augmented Dickey–Fuller (ADF) test ** P \ 0.05, *** P \ 0.01 Results The model was estimated by ordinary least squares (OLS) and then re-estimated without the insignificant variables in the first estimation Table shows the parameter estimates using TSP ver 5.0 (TSP International, India) as computational software The adjusted R2 value is high enough Durbin’s m test statistic [16] indicates that there is no first-order correlation Since c and d are less than 0, the theoretical sign conditions are satisfied All of the parameters except for the constant term are significant at less than the 5% level of significance The partial adjustment term is significant at the 1% level of significance Thus, the variables in the model are co-integrated Table Estimation results Variable Parameter Estimate t Statistics m Cons a 162.31 1.600 k b 1536.6*** 3.650 k2Q c -5.2051** -2.572 (1 - k)2Q d -0.3918*** -5.980 MD4 c4 119.45** 2.256 MD5 c5 451.56*** 6.800 MD6 c6 191.05*** 3.494 MD10 c10 -193.01*** -3.057 Table The assumption on the after-auction distribution share of fresh and frozen products Y d 0.0426*** P(-1) e 0.8391*** 28.81 Period 1964–1983 1984–2000 2001–2007 TIME f -2.659*** -3.478 Share 0.01 0.1 0.3 Adjusted R2 -0.072 0.857 2.967 m indicates the Durbin’s m test statistic ** P \ 0.05, *** P \ 0.01 123 716 Table Estimated elasticities Fish Sci (2010) 76:711–718 Elasticities Period (1964–1975) Period (1976–1985) Period (1986–1995) Period (1996–2007) Average (1964–2007) -0.46 -0.14 -0.15 -0.09 -0.21 0.35 0.33 0.41 0.27 0.34 -0.87 -0.94 -0.58 -0.92 2.56 1.71 2.03 Short-run Price Expenditure Long-run Price Expenditure -1.3 1.76 The short-run and long-run own-price and expenditure elasticities are shown in Table The long-run own-price elasticity is outstandingly high in period in absolute value because this period includes the years before the regional income-pooling system was introduced, when production was much higher than it has been in recent years It has decreased in absolute value as a whole, from 0.87 in period to 0.58 in period 4, indicating that the demand for Sakuraebi has become inelastic in recent years The long-run expenditure elasticity is higher than in all periods, indicating that Sakuraebi is a luxury good It increases from period to period but decreases dramatically in period The after-auction distribution share of fresh and frozen products k may have a large measurement error, so we conducted a sensitivity analysis Since the distribution share was largest after 2001, it is highly possible that the k value in this period has the largest measurement error Therefore, we changed the value of k during 2001–2007 from 0.3 to 0.25 and 0.35 and re-estimated the elasticities of Sakuraebi for each value Table shows that the rates of change in the price and expenditure elasticities with different k values of less than 4% The price changes between 1968 and 2007 caused by the production control and the improvement in the freshness of fish were calculated based on Eqs 11 and 12, where 1968 is the year just before the introduction of the regional income-pooling system In Eq 11, we used the monthly average production in 1968 (1089 ton) as Q1, and the monthly average production in 2007 (369 ton) as Q2, and the after-auction distribution share of fresh and frozen products in 1968 (0.01) as k In Eq 12, the monthly average production in 1968 was used as Q and the distribution share in 1968 as k1 and in 2007 as k2 From 1968 to 2007 the price increase caused by the production control is calculated to 1722.22 yen/kg and that caused by the increase in the distribution share of fresh and frozen products is calculated to be 900.87 yen/kg (Table 7) Discussion In this study, we evaluated the effects of the incomepooling system on fish price Earlier studies regarded the 123 2.1 Table Long-run elasticities for different k values Long-run elasticities Average (1964–2007) Rate of change k = 0.3 Price Expenditure -0.92 – 2.03 – k = 0.25 Price Expenditure -0.96 -0.04 1.98 0.02 k = 0.35 Price Expenditure -0.9 0.02 2.04 0.00 Table Price increase caused by the change in production and afterauction distribution share of fresh and frozen products from 1968 to 2007 Production Distribution share Price change (yen/kg) Share in the total price change 1722.22 1.08 900.87 0.56 control of production volume and the improvement in the freshness of fish as the two main factors for the price increase under this management system Most of these previous studies focused on the first factor and did not incorporate the second factor into their analyses; however, we incorporated both factors in our analysis using the afterauction distribution share of fresh and frozen products as the indicator In our analysis, we implicitly assumed that the improvement in the freshness of the shrimp is the effect of the income-pooling system This assumption is consistent with the conclusion of Hirasawa [5] who reported, ‘‘if each fisherman harvest independently, they tend to try harder to catch more quantity than to improve the quality of their harvest’’ and ‘‘the effect of improvement of the freshness of the harvested fish is limited if other fishermen don’t try to it’’ Thus, it can be assumed that it is very hard for fishermen to improve the quality of the harvested fish without a proper management system, such as the incomepooling system Fish Sci (2010) 76:711–718 The central assumption of our analysis is that the afterauction distribution share of fresh and frozen products is exogenous in our demand–supply model In the interview survey of this study, one processor said that it was hard to increase the distribution share of fresh and frozen products before 2001 (before the introduction of the refrigerator and fish pumps) because the freshness of the shrimp was not guaranteed at that time The processor also said that even now it is not possible to sell all the shrimp as fresh or frozen products Therefore, we assumed that the afterauction distribution share of fresh and frozen products was determined by the level of freezing technology and was exogenous to our model However, this assumption is not always applicable to other fisheries, so care should be taken when applying the approach used here to other studies The estimation results are generally good, and the estimated elasticities are appropriate to Sakuraebi Ariji [17] estimated Japanese demand elasticities for shrimps and crabs as one product using two models and obtained estimates of 1.27 and 1.19 as the income elasticity and -1.00 and -1.09 as the own-price elasticity by the two models, respectively The own-price elasticities estimated in our study are almost same as those of Ariji [17] In terms of the expenditure elasticity, we have to consider two facts First, income is usually used for the items such as home purchases which are not included in consumption expenditure, so the relations between the total consumption expenditure and the expenditure for each item is stronger than that between the income and the expenditure for each item [18] This means that the expenditure elasticity for one item is usually larger than the income elasticities for the same item Second, expenditure elasticity becomes larger for luxurious goods than for other goods, and Sakuraebi is relatively a luxurious good among the shrimps and crabs in Japan Keeping the two facts in mind, the estimated elasticities can be said to be consistent with those of Ariji [17] The sensitivity test showed that the measurement errors in k values not have a significant effect on the estimation results, indicating that our results are credible despite the low reliability of the data on the after-auction distribution share of fresh and frozen products Our calculations based on the estimation results revealed that 108 and 56% of the total price increase in the long-run from 1968 to 2007 can be explained by the production volume control and the improvement in the freshness, respectively This means the price increase caused by the improvement in freshness is more than half of the price increase caused by the production volume control Therefore, the effects of this improvement of freshness cannot be ignored when evaluating the income-pooling system The two causes of the price increases taken together are more than 100% of the total price increase, which means that without other mitigating factors, the price could have been 717 higher than the observed real prices The negative factor is the time trend Although it is difficult to specify the exact components of the time trend, the change in consumer preference can be included in the negative factor Since we did not explicitly incorporate the effects of any substitute goods in our model, the effects, if any, may be included in the time trend Additional factors for the time trend would be changes in food distribution system, such as the decrease in the number of auction participants for Sakuraebi It is clear, however, that the economic performance of the income-pooling system is extremely high The income-pooling system is a kind of collaborative working practice This collaboration may have made it possible to purchase the large refrigerator in Yui port and to improve the freshness of the product in the Sakuraebi fishery Although in this study we focused on the relations between the price of Sakuraebi and the harvest quantity and freshness, the mechanisms behind such collaborations need to be investigated further for a better understanding of the economic effects of the income-pooling system Evaluating the economic performance of fishery management systems is a complicated task, and both the quality and quantity of the landed fish needs to be considered in any such analysis This study is one of the very few studies which have analyzed the effects of a fishery management system using empirical data related to the quantity and quality of fish It is usually difficult to obtain time series data on the quality of harvested fish, and our approach uses the after-auction distribution share of the product types as the indicator of the freshness of the fish This approach can be applied to examine the effects of other fishery management systems The improvement of the quality of the harvested fish is also reported under the ITQ system [19] The effect of the production volume control and the quality improvement of the fish under the ITQ system needs to be examined in future studies using a model similar to the one we have introduced in this study References FAO (2002) A fishery manager’s guidebook: management measures and their application Fisheries Technical Paper No 424 FAO, Rome Cancino JP, Uchida H, Wilen JE (2007) Turfs and ITQs: collective vs individual decision making Mar Resour Econ 22(4):391–406 Baba O (1998) Significance of the pooling system and its problems In: Kitahara T et al (eds) Aiming at the establishment of fisheries management technology Koseisha Koseikaku, Tokyo (in Japanese) Baba O, Yagi N (2006) Roles and functions of the pooling system in Japanese fisheries In: Using market mechanisms to manage fisheries—smoothing the path OECD, Paris 123 718 Hirasawa Y (1985) The functions and general characters of the income pooling system In: Hirasawa Y et al (eds) Restructuring Japanese fisheries: part Tokyo Suisan Shinkokai, Tokyo (in Japanese) Platteau JP, Seki E (2001) Community arrangements to overcome market failure: pooling groups in Japanese fisheries In: Aoki M, Hayami Y (eds) Communities and markets in economic development Oxford University Press, Oxford Baba O, Hasegawa A (1990) The economic effects of the pooling system in Sakuraebi fishery in Suruga Bay Jpn J Fish Econ 34(3):1–25 (in Japanese) Matsui T (2007) Analysis of the price forming of the marine products—in view of the transition of the price and the cumulative amount of catch Jpn J Fish Econ 51(3):25–40 (in Japanese with English abstract) Matsui T (2008) Significance of the control of catch amount in the pooling system—a case of Sakuraebi fisheries in Suruga Bay Jpn J Fish Econ 52(3):1–19 (in Japanese with English Abstract) 10 FAO (2009) The state of world fisheries and aquaculture 2008 FAO, Rome 11 Omori M, Shida K (1995) ‘‘Sakura-Ebi’’—history of one hundred years of the Sergestid shrimp fishing industry Shizuoka Shinbunsha, Shizuoka (in Japanese) 123 Fish Sci (2010) 76:711–718 12 Uchida H, Baba O (2008) Fishery management and the pooling arrangement in the Sakuraebi Fishery in Japan In: Tounsend R, Shotton R, Uchida H (eds) Case studies in fisheries self-governance FAO, Rome, pp 175–189 13 Granger CW, Newbold P (1974) Spurious regressions in econometrics J Econ 2:111–120 14 Engle RF, Granger CW (1987) Cointegration and error correction—representation, estimation, and testing Econometrica 55:251–276 15 Dickey D, Fuller W (1979) Distribution of the estimators for autoregressive time-series with a unit root J Am Stat Assoc 74:427–431 16 Durbin J (1970) Testing for serial correlation in least-squares regression when some of regressors are lagged dependent variables Econometrica 38:410–421 17 Ariji M (2004) Economic analysis for the sustainability of Japanese fishery Taga, Tokyo (in Japanese) 18 Ministry of Internal Affairs and Communications (1965–2008) Annual report on the family income and expenditure survey Japan Statistical Association, Tokyo 19 Squires D, Kirkley J, Tisdell CA (1995) Individual transferable quota as a fisheries management tool Rev Fish Sci 3–2:141–169 [...]... containing two sister clades, one consisting of the T Koito Graduate School of Frontier Science, The University of Tokyo, Kashiwa, Chiba 277 -856 1, Japan T Koito Á K Kubokawa Á N Miyazaki Ocean Research Institute, The University of Tokyo, 1-15-1 Minamidai, Nakano, Tokyo 164-863 9, Japan S Tanabe Center for Marine Environmental Studies, Ehime University, Matsuyama, Ehime 79 0-8 57 7, Japan Present Address:... evolution Gene 333: 27 34 27 Perrin WF, Mitchell ED, Mead JG, Caldwell DK, Caldwell MC, Van Bree PJH, Dawbin WH (19 87) Revision of the spotted dolphins, Stenella spp Mar Mamm Sci 3:99– 170 28 Perrin WF (19 97) Development and homologies of head stripes in the delphinoid cetaceans Mar Mamm Sci 13:1–43 Fish Sci (2010) 76 : 577 –583 DOI 10.10 07/ s12562-010-0244-4 ORIGINAL ARTICLE Biology Growth, sex ratio, and maturation... bathymetric contours, the location of the refugium, positions of current meters (filled triangles A–D ), and conductivity, temperature, and depth (CTD) stations (filled circles: July 1 4, open circles: September 28) The open boundaries were located at the north, east, and west of the modeled region Bottom left panel Particle release sites (gray-shaded areas R, IS 1, IN 1, IN 2, OS 1, ON 1, HR, H1–3) 563 140°E... Symp Fishing Gear and Fishing Vessel Design St John’s, Newfoundland, pp 340–344 6 Hattula T, Luoma T, Kostiainen R, Poutanen J, Kallio M, Suuronen P (1995) Effects of catching method on different quality parameters of Baltic herring (Clupea harengus L.) Fish Res 23:209–221 7 Cole RG, Alcock NK, Handley SJ, Grange KR, Black S, Cairney D, Day J, Ford S, Jerrett AR (2003) Selective capture of blue cod (Parapercis... among the river hippopotamus, common minke whale, blue whale, humpback whale, bowhead whale, pygmy right whale, Indus river dolphin, Sowerby’s beaked whale, Amazon river dolphin, Franciscana, bottlenose dolphin, beluga, Vaquita and harbor porpoise (DDBJ/EMBL/GenBank accession numbers: AF54583– AF5459 1, AF54594–AF54596 and U925 57) One forward primer, SWS-F2 (ATGAGCAAGATGTCAGAGGA ), corresponds to the N-terminus... J Mar Freshw Res 43:345–356 10 Lowe TE, Ryder JM, Carragher JF, Wells RMG (1993) Flesh quality in snapper, Pagrus auratus, affected by capture stress J Food Sci 58 :77 0 77 3, 79 6 11 Hopkins TE, Cech J Jr (1992) Physiological effects of capturing striped bass in gillnets and fyke traps Trans Am Fish Soc 121:819–822 Fish Sci (2010) 76 :549–559 12 Parker RR, Black EC, Larkin PA (1959) Fatigue and mortality... 53.6 ± 3 .7 54.0 ± 3.1 0 .70 37 1.00 12 5 49.9 ± 5.3 56.5 ± 3.2 57. 1 ± 3.3 0 .73 15 1.00 4 6 53.9 ± 5.9 54 .7 ± 0.3 7 1.00 41 1.00 70 0.91 11 0.96 49 1.00 13 58.5 ± 4.3 0.50 18 1.00 3 64 .7 59.1 52 .7 61.1 ± 6.2 0.20 5 0.00 2 8 55.9 9 55.4 64 .7 ± 3.3 0.25 4 1.00 1 55.6 ± 2.4 64.8 ± 8.0 0.00 4 46 .7 0 .75 4 1.00 2 10 11 12 69.2 ± 4.8 0.00 3 13 0 14 68.3 ± 6.9 0.00 2 15 72 .8 0.00 1 16 64.0 0.00 1 17 76.9 0.00... Research Institute, The University of Tokyo, Kashiwa, Chiba 277 -856 4, Japan e-mail: miyakey@aori.u-tokyo.ac.jp M Hara National Research Institute of Aquaculture, Fisheries Research Agency, 422-1 Nakatsuhamaura, Minami-ise, Mie 516-019 3, Japan H Hoshikawa Central Fisheries Research Institute, Hokkaido Research Organization, Yoichi, Hokkaido 046-855 5, Japan the establishment of new refugia in this area could... work, three patterns of juvenile growth were found It is suggested that these differences in juvenile growth are mainly caused by differences in their Y Yamana Graduate School of Fisheries Science, Hokkaido University, Hakodate, Hokkaido 041-861 1, Japan T Hamano Department of Applied Aquabiology, National Fisheries University, Shimonoseki, Yamaguchi 75 9-659 5, Japan S Goshima Faculty of Fisheries Sciences,... 1 0.86 8.90 62.8 ± 2.3 67. 4 ± 1.2 1.65 24.4 IS1 20 0.59 0. 07 70.0 ± 0.8 82.6 ± 3 .7 1.91 0.53 IN1 25 0 .72 0 67. 9 ± 0.6 – 2.02 – IN2 5 0.30 0 64.0 ± 1.6 – 0.63 – OS1 ON1 20 20 0.59 0 .72 0. 07 0 70 .0 ± 0.8 67. 9 ± 0.6 82.6 ± 3 .7 – 1.91 2.02 0.53 – SE Standard error a Adult abundance and mean shell length are based on Hoshikawa (2006 unpublished data) 123 Fish Sci (2010) 76 :561– 570 565 Table 2 Definitions