Aquaculture Research, 2011, 42, 1415^1423 doi:10.1111/j.1365-2109.2010.02730.x Bioremediation and reuse of shrimp aquaculture effluents to farm whiteleg shrimp, Litopenaeus vannamei : a first approach Luis R Mart|¤ nez-Co¤rdova1, Jose¤ A Lo¤pez-El|¤ as1, Guadalupe Leyva-Miranda2, Luis Armenta-Ayo¤n2 & Marcel Martinez-Porchas3 Departamento de Investigaciones Cient|¤ ¢cas y Tecnolo¤gicas de la Universidad de Sonora, Sonora, Me¤xico Maestr|¤ a en Biociencias, Universidad de Sonora, Sonora, Me¤xico Centro de Investigacio¤n en Alimentacio¤n y Desarrollo, Sonora, Me¤xico Correspondence: M Mart|¤ nez-Porchas, Centro de Investigacio¤n en Alimentacio¤n y Desarrollo, Km 0.6 Carretera a La Victoria, Hermosillo, Sonora, Me¤xico E-mail: marcel@ciad.mx Abstract Shrimp aquaculture e¥uents were bioremediated in a two-phase system (System A) using the black clam Chione £uctifraga and the benthic microalgae Navicula sp., and then reused to farm whiteleg shrimp Litopenaeus vannamei In the experimental design, Systems B and C had an identical structure as System A, but no clams or microalgae were added System B received the same shrimp e¥uents while System C received only estuarine water Shrimp raw e¥uents had a poor water quality System A improved the water quality by decreasing the concentrations of total nitrogen, total ammonia nitrogen (TAN), nitrites, nitrates, phosphates, total suspended solids (TSS) and organic suspended solids (OSS) System B also decreased the concentration of TAN, TSS and OSS via sedimentation, but the e¡ect was less pronounced than that observed in System A Shrimp reared in the bioremediated e¥uents (System A) had better production (3166 kg À 1) and higher survival (89.2%) than those reared in e¥uents from Systems B (2610 kg À 1,75.1%) and C (2874 kg À 1, 82.1%) It is concluded that the bioremediation system was moderately e⁄cient and the bioremediated e¥uents were suitable to farm L vannamei Keywords: bioremediation, shrimp e¥uent, Chione £uctifraga, Navicula sp Introduction Aquaculture has experienced vigorous growth worldwide in the last two decades Its contribution r 2010 Blackwell Publishing Ltd to the global production of aquatic organisms grew from 3.9% in 1970 to more than 36% in 2006 (FAO 2009) The Crustaceans are the group with the highest growth rate (almost 17% per year from 2000 to 2006) and penaeid shrimp are by far the most important in terms of volume and value of production (FAO 2009) However, the explosive development of shrimp aquaculture has caused some serious problems, such as competition for water and land (PaŁez-Osuna, Gracia, Flores-Verdugo, Lyle-Fritch, Alonso-Rodr|¤ guez., Roque & Ruiz-FernaŁndez 2003), environmental impacts, including deforestation, eutrophication of receiving ecosystems, modi¢cation of habitat for terrestrial and aquatic animals, modi¢cation of landscape and hydrological patterns (GonzaŁlez-Ocampo, Morales, CaŁceres-Mart|¤ nez, Aguirre, HernaŁndez-VaŁzquez, Troyo-Dieguez & Ortega-Rubio 2006; Thomas, Courties, El Helwe, Herbland & Lemonnier 2010), the dependence of formulated shrimp feed from ¢sh meal as the main protein ingredient (Tacon 2002) and the continuous presence of epizooties (SaŁnchez-Mart|¤ nez, Aguirre-GuzmaŁn & Mej|¤ a-Ruiz 2007) As an example of the potential impact of aquaculture e¥uents, Tacon (2002) shows data regarding how much organic matter (OM), nitrogen (N) and phosphorous (P) is discharged into the environment for each tonne of shrimp harvested, depending on the feed conversion ratio (FCR) In Mexico, shrimp aquaculture operates with a mean FCR of about 1.8; considering the annual production and the data provided by Tacon (2002), it is calculated that 112 million kg of OM,7.8 million kg of N and 2.5 million kg of 1415 Bioremediation and reuse of e¥uents L R Mart|¤ nez-Co¤rdova et al P are discharged into the receiving ecosystems each year (Mart|¤ nez-Co¤rdova, Mart|¤ nez-Porchas & Corte¤sJacinto 2009) These are huge amounts and it is absolutely necessary to stop and if possible to reverse this process if we wish to have a sustainable aquaculture Some strategies have been used or suggested to minimize these impacts, including settling lagoons (Mart|¤ nez-Co¤rdova & Enriquez-Ocanìa 2007), septic tank treatments (Summerfelt & Penne 2007), low or zero water exchange (Balasubramanian, Pillai & Ravichandran 2005), recirculation systems (Timmons, Ebeling, Wheaton, Summerfelt & Vinci 2002; Lezama-Cervantes, Paniagua-Michel & Zamora-Castro 2010), the use of mangrove forests as nutrient sinks (Rivera-Monroy, Torres, Bahamon, Newmark & Twilley 1999), polyculture practices (Martinez-Cordova & Martinez-Porchas 2006; Mart|¤ nez-Porchas, Mart|¤ nezCo¤rdova, Porchas-Cornejo & Lo¤pez-El|¤ as 2010) and bioremediation (Paniagua-Michel & Garcia 2003) Bioremediation is the use of individual or combined organisms (animal, vegetal, bacteria, etc.) to minimize the polluting charge of e¥uents from aquaculture or any other activity, taking advantage of the natural or modi¢ed abilities of those organisms to reduce and/or transform waste products (ChavezCrooker & Oberque-Contreras 2010) Bioremediation can be conducted in di¡erent forms: in situ, ex situ, biostimulation, bioagmentation and others Some examples of successful bioremediation practices are the use of plants (phytoremediation), macroalgae, microalgae, ¢lter feeders, bio¢lters (polymer spheres with immobilized microorganisms), bio¢lms^bio£ocs (De Schryver, Crab, Deforidt, Boon & Verstraete 2008; Kuhn, Boardman, Craig, Flick Jr & Mclean 2009) or combined systems including two or more of these practices Although it has been demonstrated that some bivalves and micro- or macroalgae are capable of bioremediating e¥uents, many of these studies have been focused on the bioremediation of ¢sh e¥uents (Hussenot 2003; Zhou,Yang, Hu, Liu, Mao, Zhou, Xu & Zhang 2006; Liu,Wang & Lin 2010) The use of endemic species of bivalve and microalgae to bioremediate e¥uents would prevent the introduction of exotic species, which may cause other problems It is important to study di¡erent combinations of these species in order to achieve the greatest e⁄ciency The black clam (Chione £uctifraga) inhabits estuaries and shallow coastal waters in the Gulf of California It tolerates high concentrations of OM in the water column and can withstand a wide range of temperatures and salinities (Mart|¤ nez-Co¤rdova 1416 Aquaculture Research, 2011, 42, 1415–1423 1988), conditions that are similar to those prevailing in shrimp farm e¥uent; also, the species has commercial importance in north-western Mexico, mainly as an artisanal ¢shery, but it is beginning to be farmed in the region (Tinoco-Orta & CaŁceres-Mart|¤ nez 2003) In the case of microalgae, Navicula sp is a diatom that has been found in shrimp ponds and can be a food source for shrimp; also, it is reported to have the ability to act as a bioremediator of water (Paniagua-Michel & Garcia 2003) Based on the above information, the study was focused on evaluating an integrated system using benthic microalgae (Navicula sp.) and clam (C £uctifraga) to bioremediate shrimp aquaculture e¥uents and reuse the bioremediated e¥uents to farm whiteleg shrimp Litopenaeus vannamei at a microcosm level Material and methods Organisms The shrimp were obtained from a commercial farm (Maricultura del Pac|¤ ¢co S.A., Mazatlan, Me¤xico) and maintained under the laboratory conditions of dissolved oxygen (DO) 6.05 mg L À 1, temperature 28 1C, total ammonia nitrogen (TAN) 0.01mg L À 1, s fed ad libitum (35% crude protein; Purina Me¤xico , Hermosillo, Me¤xico) and a daily water exchange of 100% These conditions were maintained until the shrimp achieved an individual biomass of g Adult black clams (C £uctifraga) with an average size of 3.0 Æ 0.4 cm were hand collected from the La Cruz estuary (28148 05700 N, 111155 03000 O); organisms of a lower size were discarded, because we aimed to evaluate only the capacity of adult clam, which have a greater ¢ltration capacity The clam was maintained under the above laboratory conditions for weeks During this period, the organisms were fed with the diatom Chaetoceros muelleri The microalga Navicula sp was obtained from an aquaculture laboratory at Centro de Estudios Superiores del Estado de Sonora (CESUES, Navojoa, Sonora, Me¤xico) The microalgae were scaled up from 10 mL to 200 L using an F/2 medium with a double concentration of silicates Thereafter, the experimental units were inoculated with the microalgae week before beginning the trial Shrimp culture system The e¥uents used for the study were obtained from a semiintensive culture of white shrimp L vannamei r 2010 Blackwell Publishing Ltd, Aquaculture Research, 42, 1415^1423 Bioremediation and reuse of e¥uents L R Mart|¤ nez-Co¤rdova et al Aquaculture Research, 2011, 42, 1415^1423 (25 shrimp m À 2) reared in tanks with estuarine water The shrimp were farmed in six rectangular, plastic tanks with an area of m2 and ¢lled with water pumped from the estuary; each tank was provided with 0.9 m3 of sediment to achieve a height of 5^ cm The culture conditions were as follows: time of culture 50 days, initial size 5.0 Æ 0.3 g, stocking density 25 org m À 2, feeding supply and frequency twice a day to satiation (in feeding trays), the feed used was Camaronina with 35% of crude protein (Purina Me¤xs ico ) and the daily water exchange was 20% plastic tanks (1000 L) with black clams (C £uctifraga) distributed on the bottom (35 org m À 2) In Phase II, the water treated in each tank with clams £owed into subsequent tanks (1000 L) containing the benthic microalgae Navicula sp at an initial concentration of 50 000 cells mL À (Fig 1) The microalgae were attached to the walls and to arti¢cial substrates (plastic nets) introduced into the tanks, with a surface area of 1.65 m2 The untreated e¥uents £owed through the System B, which had a structure identical to the bioremediation system (System A), but with no clams or microalgae in the 1000 L tanks (Fig 1) A third system (System C) was constructed to determine the quality of the inlet estuarine water and was used as a control of the shrimp rearing in the ef£uents The structure of the System C was identical to that of Systems A and B, but shrimp were not reared in the rectangular tanks that received the estuarine water; also, no clams or microalgae were introduced into the 1000 L tanks Every system was constructed with three replicates with a water £ow of 0.56 L À for every ex- Bioremediation system One half of the e¥uent was sent to a bioremediation system and the other half was sent to an identical physical system but was not treated Both types of water were then used to cultivate white shrimp The bioremediation system (System A) consisted of two phases In Phase I, the e¥uents were equally distributed and made to £ow through three di¡erent ESTUARY Semiintensive culture of white shrimp Effluents Phase I: Black clams Phase II: Microalgae Reservoir SYSTEM A SYSTEM B Treatment Treatment Figure Scheme of the system used for the bioremediation of shrimp e¥uents (System A) with bivalves (Phase I) and microalga (Phase II) System B only tested the e¡ect of the pools on the decrease in the water quality parameters r 2010 Blackwell Publishing Ltd, Aquaculture Research, 42, 1415^1423 1417 Bioremediation and reuse of e¥uents L R Mart|¤ nez-Co¤rdova et al perimental unit The £ow rates of the experimental systems were controlled by water valves The hydraulic retention time (HRT) (yh) was 29.7 h for each circular tank containing clams or microalgae and 184.5 h for each complete system Reuse of treated e¥uents to cultivate white shrimp After being treated in Systems A^C, the water was then reused for rearing shrimp (L vannamei) in plastic tanks (6 m2) identical to those mentioned above Nine pools were used to farm the shrimp in the treated water The treated water from System A was distributed into three pools with a shrimp stocking density of 25 shrimp m À (Fig.1); the water from System B also £owed into the other three culture pools, and the same was done for System C Particularly for System C, the water used was pumped directly from the estuary, but previously £owed through all the pools without animals or microalgae The culture conditions were the same as mentioned above for the shrimp culture system Aquaculture Research, 2011, 42, 1415–1423 duction method (Wood, Armstrong & Richards 1967), and the orthophosphates were measured using the PhosVer method (HACH, Loveland, CO, USA) To measure the TSS and OSS, 1L of the sampled water was ¢ltered through GFC 47 mm Whatman ¢lters, which were then washed and dried at 90 1C for h The di¡erence in weight between the dried ¢lters before and after ¢ltration was estimated as the TSS The OSS were determined by incineration of the dried ¢lters in a mu¥e furnace at 450 1C for h, and then cooled and weighed The same process was carried out with clean seawater (previously ¢ltered and sterilized) from the estuary, which was a basepoint subtracted for the results of TSS and OSS The concentration of microalgae cells (Navicula sp.) was determined by treating samples of water with a Branson 2210 ultrasonic bath and the concentration of cells per millilitre was determined in a hematocytometer The shrimp production variables, growth, survival, ¢nal biomass and FCR were evaluated in each of the pools The FCR was estimated as the weight of feed administered/weight gain of the shrimps Statistical analysis Analysis of water quality and production variables The environmental and water quality variables were measured in the estuarine inlet water and e¥uents (before and after bioremediation) The estuarine inlet water was sampled in the rectangular tanks of System C, which did not have shrimp and received water directly from the estuary The raw e¥uents were measured at the exit of each shrimp culture tank before the water entered into System A or B The e¥uents from each system were then analysed as they exited the tanks of Phase II The variables were monitored periodically for temperature, salinity, DO, pH and chlorophyll a twice a day, using a multisensor YSI 6600 series (Yellow Springs, OH, USA) Total nitrogen (TN), N-NO2, NNO3, TAN and P-PO4, total suspended solids (TSS) and organic suspended solids (OSS) were all determined once a week The TN was measured using the micro-Kjeldahl method The concentration of TAN was evaluated using the ammonia-salicylate method (Bower & Holm-Hansen 1980) The nitrite concentration was determined using the colorimetric method described by Strickland and Parsons (1972, NitriVer Method) Nitrate was determined using the cadmium^copper re- 1418 A one-way analysis of variance was performed to evaluate the production variables of the shrimp cultivated in the e¥uents from Systems A, B and C, and a post hoc Tukey test was used to detect signi¢cant di¡erences A con¢dence level of 95% was established The results are presented as means (standard deviation) To evaluate the water quality variables, a repeated-measures analysis of variance was performed Results Bioremediation Signi¢cant di¡erences in some of the water quality parameters were observed among the raw e¥uents, the di¡erent Systems of e¥uent processing (A, B or C) and the inlet estuarine water (Figs and 3) Most of the parameters monitored for water quality were signi¢cantly higher in the raw e¥uents and the e¥uents from System B that were not bioremediated, while lower concentrations of those parameters were observed in System A (bioremediated e¥uents), System C (control) and the Estuary The TN increased with time in all the systems, but signi¢cantly higher values were found in the raw e¥uents and System B, while no di¡erences were r 2010 Blackwell Publishing Ltd, Aquaculture Research, 42, 1415^1423 Bioremediation and reuse of e¥uents L R Mart|¤ nez-Co¤rdova et al Aquaculture Research, 2011, 42, 1415^1423 TAN Concentration (mg·L–1) Total Nitrogen NO2 2.4 0.04 1.2 1.8 0.03 0.9 1.2 0.02 0.6 0.6 0.01 0.3 0 7 NO3 PO4 0.5 0.05 0.4 0.04 0.3 0.03 0.2 0.02 0.1 0.01 7 Time (Weeks) Figure Concentrations of water quality parameters found throughout time in the raw e¥uents, the bioremediated e¥uents with bivalve and microalga (System A), the nonbioremediated e¥uents (System B), the estuarine that £owed into a similar system of tanks but without animals (System C) and the estuarine water (Estuary) Di¡erent letters on the left of each marker in each graphic indicate signi¢cant di¡erences Total Suspended Solids 300 250 200 150 100 Concentration (mg·L–1) observed among the rest of the Systems (A and C) and the estuarine water (Fig 2) The concentration of TAN recorded a similar dynamic in all the treatments through the experimental period; however, the raw e¥uents and the e¥uents from System B had higher concentrations of TAN that those found in System C and the Estuary In the case of the bioremediated ef£uents (System A), the concentrations of TAN were signi¢cantly lower than the raw e¥uents but no differences were found with regard to the rest of the treatments For nitrite levels, the raw e¥uents and System B showed the highest concentrations during the experiment Although System A showed results similar to those of System B (P 0.069), they were also similar to those observed in System C and Estuary (P40.7) A similar tendency was observed for nitrates as that for TAN and nitrite concentrations (Fig 2) The phosphates were also higher in the nonbioremediated e¥uents (raw e¥uents and System B) as compared with the rest of the treatments System A had lower values than the nonbioremediated e¥uents, but higher than those of System C and the Estuary (Fig 2) The TSS were the highest in the raw e¥uents, followed by those found in System B Both nonbioremediated e¥uents had higher values of TSS than Systems A and C and the estuarine water Systems A and C and the estuarine water showed statistically similar values (Fig 3) The OSS were also the highest in 50 c a b a a Raw Effluents System A System B System C Estuary c ab b a a Raw Effluents System A System B System C Estuary Organic Suspended Solids 50 40 30 20 10 Time (Weeks) Figure Concentrations of suspended solids found throughout time in the raw e¥uents, the bioremediated e¥uents with bivalve and microalga (System A), the nonbioremediated e¥uents (System B), the estuarine that £owed into a similar system of tanks but without animals (System C) and the estuarine water (Estuary) Di¡erent letters on the left of each marker in each graphic indicate signi¢cant di¡erences the raw e¥uents and those from System B No di¡erences were found among the OSS levels of System A and the rest of the treatments (Fig 3) r 2010 Blackwell Publishing Ltd, Aquaculture Research, 42, 1415^1423 1419 Bioremediation and reuse of e¥uents L R Mart|¤ nez-Co¤rdova et al Navicula sp 100000 Table Environmental variables in the microcosm culture of shrimp in the bioremediated e¥uents (System A), the nonbioremediated e¥uents (System B) and the estuarine water (System C) Cells·mL–1 80000 60000 System A 40000 20000 Temperature ( 1C) Salinity (%) DO (mg L À 1) pH NO3 (mg L À 1) NO2 (mg L À 1) TAN (mg L À 1) PO4 (mg L À 1) Time (Weeks) Chione fluctifraga Survival (%) 100 26.1 41.2 5.6 8.2 0.30 1.04 0.68 0.16 Æ Æ Æ Æ Æ Æ Æ Æ 1.1a 2.1a 0.5a 0.3a 0.06a 0.55a 0.35ab 04a System B 26.2 41.5 5.7 8.2 0.41 1.51 1.05 0.21 Æ Æ Æ Æ Æ Æ Æ Æ 1.2a 2.0a 0.6a 0.2a 0.05b 0.76b 0.6b 09a System C 25.9 41.0 5.9 8.3 0.28 1.01 0.60 0.15 Æ Æ Æ Æ Æ Æ Æ Æ 0.9a 1.9a 0.6a 0.2a 0.05a 0.62a 0.32a 0.06a 80 Di¡erent letters in the same row indicate signi¢cant di¡erences (Po0.05) DO, distilled water; TAN, total ammonia nitrogen 60 40 20 Table Production parameters of white shrimp farmed at microcosms in the bioremediated e¥uents (System A), the nonbioremediated e¥uents (System B) and the estuarine water (System C) Time (Weeks) Figure Concentration of the benthic microalga (Navicula sp.) and survival of clams (Chione £uctifraga) during the experiment In terms of e⁄ciency, System A with clams and microalgae removed 17.3% of TN, 24.5% of TAN, 19.2% of nitrites, 13.5% of nitrates, 21.6% of phosphates, 22.3% of TSS and 23.2% of OSS from the raw e¥uents System B showed a removal e⁄ciency of o4% of TN, nitrites, nitrates and phosphates, while the removal of TAN,TSS and OSS was 10.2%,10.1% and 8.6% respectively The concentration of the benthonic microalgae remained at levels above the 50 000 cells mL À 1, during the ¢rst weeks of the experiment, but declined during the last week (Fig.4) By the last week, the presence of Navicula sp was replaced in part by an unidenti¢ed diatom The chlorophyll levels were signi¢cantly higher in Phase II of System A (23.5 Æ 3.8 mg m À 3), which had the benthonic microalgae, followed by Phase II from Systems B (7.0 Æ 2.6 mg m À 3) and C (4.0 Æ 2.7 mg m À 3) respectively The survival of the clams was constant during the entire experiment, with an average survival above 90% in every week (Fig 4); as adult clams were used for the experiment, the growth during the experimental period was not signi¢cant (0.5^1.0 mm) Shrimp rearing in e¥uents No signi¢cant di¡erences were detected among the treatments with respect to the following environ- 1420 Aquaculture Research, 2011, 42, 1415–1423 Final weight (g) Growth rate (g week À 1) Survival (%) Final biomass (kg À 1) FCR System A System B System C 14.2 Æ 1.3a 1.15 Æ 0.04a 13.8 Æ 1.2a 1.10 Æ 0.05a 14.0 Æ 1.6a 1.12 Æ 0.06a 89.2 Æ 2.1a 3166 Æ 206a 75.1 Æ 3.6c 2610 Æ 280b 82.1 Æ 3.8b 2874 Æ 205ab 1.47 Æ 0.06a 1.73 Æ 0.05b 1.51 Æ 0.05a Di¡erent letters in the same row indicate signi¢cant di¡erences (Po0.05) FCR, feed conversion ratio mental variables: temperature, salinity, DO, pH and PO4 (Table 1) However, higher values of TAN, NO2 and NO3 were observed in the tanks where shrimp from System B were reared Regarding the production parameters of the shrimps farmed in di¡erent types of e¥uents, the ¢nal weight and the growth rate were statistically similar among all the treatments (Systems A, B and C) However, the highest survival was found in shrimps reared in the bioremediated e¥uents (System A), followed by those reared in estuarine water (System C), while the lowest survival was observed in the shrimps cultivated in nonbioremediated e¥uents (System B) (Table 2) The highest biomass was also achieved in System A and the lowest in System B, while no di¡erences were observed among System C and the rest of the treatments The biomass of shrimp from System A was 21% higher than that of System B (Table 2) r 2010 Blackwell Publishing Ltd, Aquaculture Research, 42, 1415^1423 Aquaculture Research, 2011, 42, 1415^1423 Finally, FCRs were lower in Systems A and C compared with those obtained for the shrimps reared in System B (Table 2) Discussion Shrimp rearing at a semiintensive scale is activity practice capable of exerting a signi¢cant impact on the environment Some of the parameters of water quality increased by 100% or more from the estuarine water to the raw e¥uents Although this was demonstrated at an experimental scale, similar results have been observed in commercial farms (Jackson, Preston & Thompson 2004) Jackson et al (2004) studied the discharge nutrient loads at di¡erent shrimp farms, ¢nding concentrations of TN and TSS as high as and 200 mg L À 1, respectively; similar results were observed in this experiment The bioremediation system appeared to have a moderate e⁄ciency, as nitrogenous compounds and the phosphates were lower after the e¥uent £owed through the pools with clams and the benthonic microalgae Some authors have documented that the presence of bivalves and microalgae can decrease the concentration of di¡erent compounds that contaminate receiving ecosystems For instance, Hernandez, Bashan and Bashan (2006) found a P removal e⁄ciency of around 25% for Chlorella spp alone, and up to 72% for Chlorella spp co-immobilized with Azospirillum braziliense In addition, Jones, Dennison and Preston (2001) evaluated a multiphase system (sedimentation, ¢lter feeders and microalgae) to treat shrimp e¥uents and achieved an overall improvement in water quality as follows: TSS À (12%), TN (28%), P (14%), NH1 (76%), NO3 (30%), À PO4 (35%), bacteria (30%) and chlorophyll a (0.7%); however, the HRT of this system was lower than that observed in our experiment, which suggests that the e⁄ciency of our system was lower that of Jones et al (2001) Also, the density of bivalves they used was much higher, although the retention time used in our system corresponded to a daily water exchange similar to that used in commercial farms (10^20%) The bioremediation e⁄ciency in the above-mentioned experiments as well as in our experiment was estimated by measuring the number of nutrients removed from the raw e¥uents The results suggest that the quality of water was signi¢cantly improved after being treated by the bioremediation system (A); however, System B, which did not have clams or microalgae, also showed some e⁄ciency in removing TAN,TSS and OSS These results may be attributed to Bioremediation and reuse of e¥uents L R Mart|¤ nez-Co¤rdova et al the sedimentation in the pools Hence, it can be hypothesized that the e⁄ciency of System A in removing nitrogenous metabolites and phosphates can be attributed to the presence of Navicula sp., while the removal of suspended solids may be caused in part by the presence of clams and by sedimentation in the tanks (sediments were observed in the treatment pools of Systems A and B, although they were not measured) Vymazaj (1988) found that microalgae species such as Navicula sp were capable of removing nutrients from polluted streams with a maximum ef¢ciency of 80% and 70% for ammonium and orthophosphates respectively Navicula sp has been used as part of bio¢lms to improve the water quality, due to its ability to remove nitrogenous compounds and phosphates (Thompson, Abreu & Wasielesky 2002) Regarding suspended solids, the presence of bivalves and the use of tanks as sedimentation units have been shown to decrease the concentration of suspended solids and TN from aquaculture e¥uents (Jones et al 2001; Bernal-Jaspeado 2006; Li, Veilleux & Wikfors 2009) The greater e⁄ciency of System A in removing OSS than TSS could be explained by the ¢ltration activity of the clams; in this regard, it has been demonstrated that bivalves preferably ingest organic and reject inorganic materials (Newell & Jordan 1983) Although the bioremediation system with C £uctifraga and Navicula sp had acceptable e⁄ciency, the concentrations of the microalgae decreased during the last week This decrease may be attributed to the high turbidity observed in System A during the last weeks, caused by the increase in TSS and OSS It has been reported that the abundance of some microalgae species such as Navicula sp depends on the turbidity and the concentration of suspended solids (Unrein & Vincour 1999) Some alternatives to solve this problem might be to increase bivalves in Phase I or include a sedimentation tank, as suggested by Jones et al (2001) to decrease the concentration of suspended solids Although Navicula sp levels decreased by the last week, the nitrogenous metabolites continued decreasing in System A, which may be attributed to the remaining concentration of Navicula sp and the unidenti¢ed diatom that was predominant during the last few days As a ¢rst approach, it was observed that the bioremediation system had lower e⁄ciency than those using macroalgae, in terms of nutrient removal and biomass production (Xu, Fang & Wei 2008; Marinho-Soriano, Nunes, Carneiro & Pereira 2009; Mart|¤ nez-Porchas et al 2010) However, it is important r 2010 Blackwell Publishing Ltd, Aquaculture Research, 42, 1415^1423 1421 Bioremediation and reuse of e¥uents L R Mart|¤ nez-Co¤rdova et al to continue studying the ability of C £uctifraga and Navicula sp as potential bioremediators of shrimp (or ¢sh) e¥uents, at di¡erent densities and using different system designs, to achieve a better e⁄ciency Regarding the production parameters of the shrimp reared on the three systems, it was observed that the bioremediated e¥uents (System A) were very suitable for the culture of white shrimp The growth rates were similar to or higher than the 0.9^1.0 g week À 1, reported as commercially feasible (Mart|¤ nez-Co¤rdova 1999) The productive response of the shrimp reared in the bioremediated e¥uents was better than that observed in those cultivated in e¥uents from Systems B and C The di¡erence in survival and biomass among the shrimps reared in bioremediated e¥uents (from System A) and those reared in the nonbiormediated e¥uents (System B) may be attributed to the improvement in the water quality Although none of the water quality parameters reached the lethal concentration (LC50) in the nonbioremediated e¥uents, they were almost twofold higher than those from the bioremediated e¥uents Di¡erent authors have documented that the chronic exposure of penaeid shrimps to high concentrations of nitrogenous compounds and suspended solids can diminish their growth and food intake (Frias-Espericueta, Harfush-Melendez & Paez-Osuna 2000; Ray, Lewis, Browdy & Le¥er 2009) Moreover, the slight increase in the productive response of shrimps from System A as compared with those reared in System C could be attributed to the higher survival and to the presence of OM in System A, such as bio£ocs and microalgae (Navicula sp and other diatoms), which could be an alternative source of food The biomass obtained in Systems A and C was higher than the mean reported in most semiintensive farms of the region The FCRs in the same treatments are considered to a pro¢table value for commercial purposes (Juarez 2008) The results suggest that the shrimp can thrive in bioremediated e¥uents, which indicates that the treated water (by clams and microalgae) can be reused by recirculation This practice would reduce the environmental impact caused by the massive discharges of shrimp aquaculture Furthermore, the black clam have commercial value and may represent and extra economical income for farmers (Mart|¤ nez-Porchas et al 2010) It can be concluded that the bioremediation system was moderately e⁄cient in removing nutrients and solids (TSS and OSS) from shrimp aquaculture e¥uents Also, the tanks themselves are useful due to the sedimentation activity 1422 Aquaculture Research, 2011, 42, 1415–1423 It is necessary, however, to improve System A with some modi¢cations in the design The production parameters obtained in the present study strongly suggest that the bioremediated e¥uents can be used for farming white shrimp without a negative e¡ect on its survival and growth References Balasubramanian C.P., Pillai S.M & Ravichandran P (2005) Zero-water exchange shrimp farming systems (extensive) in the periphery of Chilka lagoon, Orissa, India Aquaculture International 12, 555^572 Bernal-Jaspeado T (2006) Balance de nitro¤geno en un sistema integrado de cultivo de camaro¤n blanco y un bio¢ltro en el e£uente utilizando la almeja negra Chione £uctifraga Master thesis, University of Sonora, Hermosillo, Sonora, Mexico, 96pp Bower C.E & Holm-Hansen T (1980) A salicylate^hypochlorite method for determining ammonia in seawater Canadian Journal of Fisheries and Aquatic Sciences 37,794^ 798 Chavez-Crooker P & Oberque-Contreras J (2010) Bioremediation of aquaculture wastes Current Opinion in Biotechnology 21, 313^317 De Schryver P., Crab R., Deforidt T., Boon N & Verstraete W (2008) The basics of bio-£ocs technology: the added value for aquaculture Aquaculture 277, 125^137 FAO (2009) The State ofWorld Fisheries and Aquaculture 2008 Food and Agriculture Organization of the United Nations, Rome, Italy, 196pp Frias-Espericueta M.G., Harfush-Melendez M & Paez-Osuna F (2000) E¡ects of ammonia on mortality and feeding of postlarvae shrimp Litopenaeus vannamei Bulletin of Environmental Contamination and Toxicology 65, 98^103 GonzaŁlez-Ocampo H., Morales L., CaŁceres-Mart|¤ nez C., Aguirre H., HernaŁndez-VaŁzquez S.,Troyo-Dieguez E & Ortega-Rubio A (2006) Shrimp aquaculture environmental diagnosis in the semiarid coastal zone in Mexico Fresenius Environmental Bulletin 15, 659^669 Hernandez J., Bashan L & Bashan Y (2006) Starvation enhanced phosphorous removal from wastewater by the microalgae Chlorella spp co-immobilized with Azospirillum brazilense Enzyme and Microbial Technology 38, 190^198 Hussenot J.M.E (2003) Emerging e¥uent management strategies in marine ¢sh-culture farms located in European coastal wetlands Aquaculture 226,113^128 Jackson C., Preston N & Thompson P.J (2004) Intake and discharge nutrient loads at three intensive shrimp farms Aquaculture Research 35, 1053^1061 Jones A.B., Dennison W.C & Preston N.P (2001) Integrated treatment of shrimp e¥uent by sedimentation, oyster ¢ltration and macroalgal absorption: a laboratory scale study Aquaculture 193, 155^178 Juarez L.M (2008) Current status of shrimp aquaculture in Mexico Panorama Acu|¤ cola 13, 49^53 r 2010 Blackwell Publishing Ltd, Aquaculture Research, 42, 1415^1423 Aquaculture Research, 2011, 42, 1415^1423 Kuhn D.D., Boardman G.D., Craig S.R., Flick G.J Jr & Mclean E (2009) Use of microbial £ocs generated from tilapia ef£uent as a nutritional supplement for shrimp, Litopenaeus vannamei Panorama Acu|¤ cola 14, 32^35 Lezama-Cervantes C., Paniagua-Michel J.J & Zamora-Castro J (2010) Bioremediacion of e¥uents ones of the culture of Litopenaeus vannamei (Boone, 1931) using microbial mats in a recirculating system Latin American Journal of Aquatic Research 38, 129^142 Li Y.,Veilleux D.J & Wikfors G.H (2009) Particle removal by Northern bay scallops Argopecten irradians irradians in a semi-natural setting: application of a £ow-cytometric technique Aquaculture 296, 237^245 Liu J.,Wang Z & Lin W (2010) De-eutrophication of e¥uent wastewater from ¢sh aquaculture by using marine green alga Ulva pertusa Chinese Journal of Oceanology and Limnology 28, 201^208 Marinho-Soriano E., Nunes S.O., Carneiro M.A & Pereira D.C (2009) Nutrients removal from aquaculture wastewater using the macroalgae Gracilaria birdiae Biomass and Bioenergy 33, 327^331 Martinez-Cordova L & Enriquez-Ocanìa F (2007) Study of the benthic fauna in a discharge lagoon of a shrimp farm with special emphasis on polychaeta Online Journal of Biological Sciences 7,12^17 Mart|¤ nez-Co¤rdova L.R (1988) Bioecolog|¤ a de la almeja negra Chione £uctifraga (Sowerby,1853) Revista de Biolog|¤ aTropical 36, 213^219 Mart|¤ nez-Co¤rdova L.R (1999) Cultivo de Camarones Peneidos, Principios y PraŁcticas AGT Editor, M e¤ xico DF, Mexico,298pp Martinez-Cordova L.R & Martinez-Porchas M (2006) Polyculture of the Paci¢c white shrimp, Litopenaeus vannamei, giant oyster, Crassostrea gigas, and black clam, Chione £uctifraga in ponds in Sonora, Mexico Aquaculture 258, 321^326 Mart|¤ nez Co¤rdova L.R., Mart|¤ nez-Porchas M & Corte¤s Jacinto E (2009) Camaronicultura Mexicana y Mundial: „actividad sustentable o industria contaminante? Revista Internacional de Contaminacio¤n Ambiental 25, 181^196 Mart|¤ nez-Porchas M., Mart|¤ nez-Co¤rdova L.R., Porchas-Cornejo M & Lo¤pez-El|¤ as J.A (2010) Shrimp polyculture: a potentially, pro¢table, sustainable but yet uncommon aquacultural practice Reviews in Aquaculture 2,73^85 Newell R.I.E & Jordan S.J (1983) Preferential ingestion of organic material by the American oyster, Crassostrea virginica Marine Ecology Progress Series 13, 47^53 PaŁez-Osuna F., Gracia A., Flores-Verdugo F., Lyle-Fritch L.P., Alonso-Rodr|¤ guez R., Roque A & Ruiz-FernaŁndez A.C (2003) Shrimp aquaculture development and the environment in the Gulf of California ecoregion Marine Pollution Bulletin 46, 806^815 Paniagua-Michel J & Garcia O (2003) Ex-situ bioremediation of shrimp culture e¥uent using constructed microbial mats Aquacultural Engineering 28,131^139 Ray A.J., Lewis B.L., Browdy B.L & Le¥er J.W (2009) Suspended solids removal to improve shrimp (Litopenaeus vannamei) production and an evaluation of a plant-based Bioremediation and reuse of e¥uents L R Mart|¤ nez-Co¤rdova et al feed in minimal-exchange, superintensive culture systems Aquaculture 299, 89^98 Rivera-Monroy V.H.,Torres L.A., Bahamon L., Newmark F & Twilley R.R (1999) The potential use of mangrove forests as nitrogen sinks of shrimp aquaculture pond e¥uents: the role of denitri¢cation Journal of theWorld Aquaculture Society 30, 12^25 SaŁnchez-Mart|¤ nez J.G., Aguirre-GuzmaŁn G & Mej|¤ a-Ruiz H (2007) White spot syndrome virus in cultured shrimp: a review Aquaculture Research 38,1339^1354 Strickland J.D.H & Parsons T.R (1972) A Practical Handbook of Seawater Analysis, Bulletin 167, 2nd edn Fisheries Research Board Canada, Ottawa, ON, Canada, 310pp Summerfelt R.C & Penne C.R (2007) Septic tank treatment of the e¥uent from a small-scale commercial recycle aquaculture system North American Journal of Aquaculture 69, 59^68 Tacon A.G.J (2002) Thematic review of feeds and feed management practices in shrimp aquaculture Report prepared under the World Bank, NACA, WWF and FAO Consortium Program on Shrimp Farming and the Environment,Work in Progress for Public Discussion Published by the Consortium, 69pp Thomas Y., Courties C., El Helwe Y., Herbland A & Lemonnier H (2010) Spatial and temporal extension of eutrophication associated with shrimp farm wastewater discharges in the New Caledonia lagoon Marine Pollution Bulletin 61, 387^398 Thompson F.L., Abreu P.C & Wasielesky W (2002) Importance of bio¢lm for water quality and nourishment in intensive shrimp culture Aquaculture 203, 263^278 Timmons M.B., Ebeling J.M.,Wheaton F.W., Summerfelt S.T & Vinci B (2002) Sistemas de Recirculacio¤n para la Acuicultura Fundacio¤n Chile,Vitacura, Santiago de Chile, Chile,748pp Tinoco-Orta G.D & CaŁceres-Mart|¤ nez J (2003) Infestation of the clam Chione £uctifraga by the burrowing worm Polydora sp nov in laboratory conditions Journal of Invertebrate Pathology 83, 196^205 Unrein F & Vincour A (1999) Phytoplankton structure and dynamics in a turbid Antarctic lake (Potter Peninsula, King George Island) Polar Biology 22, 93^101 Vymazaj J (1988) The use of periphyton communities for nutrient removal from polluted streams Hydrobiologia 166, 225^237 Wood E.D., Armstrong F.A.G & Richards F.A (1967) Determination of nitrate in seawater by cadmium-copper reduction to nitrite Journal of Marine BiologyAssociation (United Kingdom) 47, 23–31 XuY., Fang J & Wei W (2008) Application of Gracilaria lichenoides (Rhodophyta) for alleviating excess nutrients in aquaculture Journal of Applied Phycology 20,199^203 Zhou Y., Yang H., Hu H., Liu Y., Mao Y., Zhou H., Xu X & Zhang F (2006) Bioremediation potential of the macroalga Gracilaria lemaneiformis (Rhodophyta) integrated into fed ¢sh culture in coastal waters of north China Aquaculture 252, 264^276 r 2010 Blackwell Publishing Ltd, Aquaculture Research, 42, 1415^1423 1423 Growth and ¢rst reproduction of C corteziensis J M Mazo¤n-SuaŁstegui et al Aquaculture Research, 2011, 42, 1558^1568 Figure Monthly variations in water temperature, salinity, pH and concentrations of oxygen, chlorophyll a, particulate organic material (POM) and particulate inorganic material (PIM) in the cultivation site in Bah|¤ a de Agiabampo, Sonora, Mexico (Fig 4) Maximum reproductive activity occurred in May (26 1C; 37 gL À 1, 4.8 mg L À POM and 0.6^ 1.2 mg L À chlorophyll a), when 65% of the oysters were ripe We did not detect any spawned male during the study TD of oocytes showed an average size of 32.1 Æ 3.9 mm during May corresponding to 100% of post-vitellogenic ooyctes This was followed by a 1562 slight decrease of TD in July (29.3 Æ 4.8 mm), with similar proportions of vitellogenic and postvitellogenic oocytes in ovaries Maximum diametre (50.2 Æ 13.8 mm) occurred in September (85% postvitellogenic oocytes) and minimum average size (26.2 Æ 5.3 mm) in October (95% post-vitellogenic oocytes) Di¡erences in the TD of oocytes were signi¢cantly di¡erent over time (Fig 5) r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1558^1568 Aquaculture Research, 2011, 42, 1558^1568 Growth and ¢rst reproduction of C corteziensis J M Mazo¤n-SuaŁstegui et al Figure Mean monthly variations (Æ SE) in shell height, length and width, as well as wet weight of juveniles of the Cortez oyster Crassostrea corteziensis cultivated in Bah|¤ a de Agiabampo, Sonora, Mexico Sex ratio Of the total sample population, 35.8% were females, 42% were males and 22.2% were undi¡erentiated specimens No hermaphrodite oysters were observed The mean sex ratio was 1:1.2 (female:male) Males occurred more frequently from March (50%; the third month of ¢eld cultivation) through September 2005 (end of the study), with a peak in May (65%) The lowest percentage occurred in October (25%) Females started to appear in May (33%) and increased over time, with a peak in October (75%) Age/size at ¢rst maturation Considering the 2.25 months that covered the stages of larval development, settlement and hatchery care of spat, the ¢rst sexually ripe oysters occurred at 42 mm SH and $ 3.25 months of age (male), and 54 mm SH and $ 4.5 months (female) The age at ¢rst sexual maturation for 50% of the cultivated population was 4.75 months for males (55^59 mm) and 5.25 months for females (60^64 mm) (Fig 6) The age at ¢rst sexual maturity in relation to planting time in the ¢eld was 5.5 months (males) and 6.75 months (females) for the ¢rst sexually ripe oysters, and months (males) and 7.5 months (females) when considering 50% of the cultivated population Discussion In previous studies, mean daily growth rates reported for C corteziensis in lagoons with typical marine conditions in Sonora ranged from 0.183 to 0.253 mm day À over a period of 7^10 months (ChaŁvez-Villalba et al 2008) In our study, the mean daily growth rate was 0.308 mm day À 1, which is the fastest rate reported for this species and corresponds to a southern, warmer site such as Bah|¤ a Agiabampo, Sonora Also in a previous study, ChaŁvez-Villalba et al (2005) registered the slowest growth rate (0.183 mm day À 1) at the northernmost and coldest site in El Soldado Lagoon, Sonora Di¡erences in growth rates between sites of di¡erent latitudes can be related to overall temperature patterns along the Paci¢c coast At the northern site, mean temperature varied from 32 1C in summer to 15 1C in winter At the southern site, mean temperature varied from 31 1C in summer to 22 1C in winter (this study) Cuevas-Gue¤vara and Mart|¤ nezGuerrero (1979) also noted a smaller range in temperature towards the south, where this oyster species is intensively ¢shed Overall, warmer areas appear more propitious to aquaculture programmes or pilot-scale ventures with the Cortez oyster This is further evidenced by the higher grow rate (0.284 mm day À 1) at the northern site during summer (ChaŁvez-Villalba et al 2005) For the summer season at the southern location (this study), the fastest growth rate averaging 0.538 mm day À corresponds to a long season of warm temperatures This result also agrees with observations under hatchery conditions, where optimal growth of spat (0.52 mm day À 1) occurred in temperatures ranging from 28 to 30 1C (CaŁceres-Puig et al 2007) As Cardoso, Langlet, Lo¡, Martins, Witte, Santos andVan derVeer (2007) indicate, local environmental conditions are important for determining survival r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1558^1568 1563 Growth and ¢rst reproduction of C corteziensis J M Mazo¤n-SuaŁstegui et al Aquaculture Research, 2011, 42, 1558^1568 Figure Monthly variations in female (a) and male (b) gonad developmental stages of the Cortez oyster Crassostrea corteziensis cultivated in Bah|¤ a de Agiabampo, Sonora, Mexico and growth trends in bivalves In this study, however, survival rate at the end was very high (97%) and not likely a¡ected by environmental factors.While faster growth rates occurred in this study, the Cortez oyster had faster growth rates (0.304 mm day À 1) under hyposaline ($ 25 gL À 1) conditions (Contreras-Mendoza & Medina-SaŁnchez 2006) Other studies indicate that wild populations are usually located in estuarine zones, where freshwater run o¡ lowers salinity (PaŁezOsuna, Zazueta-Padilla & Osuna-Lo¤pez 1993; Fr|¤ asEspericueta, Osuna-Lo¤pez & PaŁez-Osuna 1999) This suggests that average growth occurs in typical marine conditions, but optimal development of the species may occur in warmer waters with fresh water 1564 input from estuarine systems Another important factor a¡ecting bivalve survival and growth is food supply Recent studies indicate that energy for growth of the Cortez oyster comes from two sources, phytoplankton and non-chlorophyll-related seston inputs (ChaŁvez-Villalba et al 2005) Although the concentrations of chlorophyll and seston measured in this trial were lower than the range reported for other coastal lagoons in Sonora (Castro-Longoria & Grijalva-Chon 1992; ChaŁvez-Villalba et al 2008), our values were within the range that is not limiting for bivalve growth (Rupp, Parsons, Thompson & de Bem 2005) The exception to this trend occurred with the PIM content, which was always higher than POM r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1558^1568 Aquaculture Research, 2011, 42, 1558^1568 Growth and ¢rst reproduction of C corteziensis J M Mazo¤n-SuaŁstegui et al Figure Mean bimonthly variations (Æ SE) of theoretical diametre of oocytes of juveniles of the Cortez oyster Crassostrea corteziensis cultivated in Bah|¤ a de Agiabampo, Sonora, Mexico Figure Size/age at ¢rst sexual maturity of male and female juveniles of the Cortez oysters Crassostrea corteziensis cultivated in Bah|¤ a de Agiabampo, Sonora, Mexico and peaked in July, in correspondence to the highest temperatures detected and maximal reproductive activity, including population spawning This result agrees with ¢ndings by NarvaŁez, Lodeiros, Freites, Nu¤nìez, Pico and Prieto (2000) that gametogenesis in bivalve species of tropical distribution rely more on food availability than on water temperature, while this process in temperate species appear to be a¡ected by temperature changes rather than availability of food Gametogenesis in C corteziensis follows the general pattern of other marine bivalves Data collected from histological examination of gonads and oocyte size indicated that gametogenesis began in March^ April and oocytes passed rapidly from pre-vitellogenesis to post-vitellogenesis phases Vitellogenic and post-villegenic oocytes were present during late spring and summer, yielding a bimodal distribution under the in£uence of long term and relatively high temperatures (25^27 1C) The presence of di¡erent phases of oocyte at the same time indicates that environmental conditions, particularly water temperature and POM levels, were favourable for continuous development of the gonad and spawning of gametes (Lango-Reynoso, ChaŁvez-Villalba & Le Pennec 2006) While females of the cultivated population spawned massively in September, no activity of this event was detected in males Despite this, the presence of males experiencing early development in September provided evidence of a partial spawning occurring in August According to Rodr|¤ guez-Jaramillo et al (2008), the presence of growing, ripe and reabsorbed oocytes occurs normally until November in this species Based on these results, and the data of environmental changes from May through August showing increasing water temperatures and relatively constant seston (POM) concentrations, we believe that C corteziensis followed an opportunistic strategy for activating and sustaining gametogenesis from energy taken from food r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1558^1568 1565 Growth and ¢rst reproduction of C corteziensis J M Mazo¤n-SuaŁstegui et al The Cortez oyster behaved as a typical protandrous bivalve, where males are more abundant than females when small or maturing for the ¢rst time and changes to female later when larger The sex ratio of wild bivalves is about even at larger sizes (Gervis & Sims 1992) Protandrous behaviour in this species was reported by Baqueiro-Cardenas (1991) and Mazo¤nSuaŁstegui et al (2009), and is similar to changes in gender in C gigas, where hermaphrodites represent a transitional stage from male to female (Baghurst & Mitchell 2002; Lango-Reynoso et al 2006) In this study, however, hermaphrodites were not detected In C gigas, hermaphrodites occur when the transition coincides with changes from low to high temperatures (Fabioux, Huvet, Le Souchu, Le Pennec & Pouvreau 2005), that is, from less to more favourable conditions for reproduction (Lango-Reynoso, Devauchelle, Le Pennec & Hatt 1999) In this study, di¡erent geographic areas show di¡erent sex change patterns; as an intermediate stage, we found larger numbers of small, hermaphrodite males at a northern site, coinciding with a marked temperature range of 18 1C (ChaŁvez-Villalba et al 2008) In contrast, more females and no hermaphrodites were found throughout the year at a southern site, where the temperature range was 1C (Rodr|¤ guez-Jaramillo et al 2008) The pattern we found approximates the southern location Although the minimal marketable size at ¢rst maturity has been used as a basis for commercial harvesting in some bivalves (Campbell & Ming 2003), the age and size when the Cortez oyster reaches ¢rst sexual maturity is not well established Parres-Haro (2008) found developing gametes in hatchery-reared C corteziensis juveniles that were as small as 10 mm SH, but viability of the gametes was not con¢rmed ChaŁvez-Villalba et al (2008) found ripe gonads in 6month-old males (dated from time of planting) that ranged from 45 to 50 mm SH This result di¡ers from our ¢ndings, which shows the ¢rst ripe males at 42 mm SH (3.25^5.5 months old from fertilization to planting time in the ¢eld) and the ¢rst ripe females at 54 mm SH (4.5^6.75 months old from fertilization to planting) Other bivalve species reach their ¢rst sexual maturity at di¡erent times, depending on a complex interaction of endogenous and exogenous cues, including genetic mechanisms triggered at the onset of gametogenesis (Cruz, Rodr|¤ guez-Jaramillo & Ibarra 2000), temperature variations and availability of food related to the geographic range of populations of the same species (Chung, Hur, Shin & Kim 2005), di¡erences in growth rates that a¡ect the time needed to reach average adult size (Millione, Saucedo 1566 Aquaculture Research, 2011, 42, 1558^1568 & Southgate 2011) and low densities of oysters within natural stocks caused by local harvesting of the species (Romo-Pinìera 2010) Because of these di¡erences, small species, such as the catarina scallop Argopecten ventricosus ripen for the ¢rst time at 4^5 months (20^32 mm SH) in Bah|¤ a Magdalena and Bah|¤ a Concepcion, Mexico (Cruz et al 2000), while big species, such as the winged pearl oyster Pteria penguin from northeastern Australia reach ¢rst sexual maturity at $ 113.7 mm (males) and $ 153.7 mm (females) (Millione et al 2011) The mid-sized chocolate clam Megapitaria squalida collected in Bah|¤ a de La Paz, Mexico develops ripe gonads within the ¢rst year at 64.5 mm SH (Romo-Pinìera 2010) We believe that minimal size is more important than minimal age for the management of wild populations The evidence for Cortez oysters reared at the hatchery before starting this ¢eld trial indicates that the time required from spawning of broodstock to the time when spat is ready for ¢eld cultivation is 9^ 10 weeks Previous studies suggest that most natural beds of this species in Sinaloa and Sonora contain oysters with an average of 55 mm SH and a range from 34 to 75 mm SH (Osuna-Lo¤pez, Zazueta-Padilla, Rodr|¤ guez-Higuera & PaŁez-Osuna 1990; PaŁez-Osuna et al 1993) Based on these data, our results suggest that the Cortez oyster is a good candidate for commercial farming in warm waters from southern Sonora to Central America Further support comes from spat of the species produced at the CIBNOR’s hatchery and later reared in Panama, where growth ranged from 0.318 to 0.345 mm day À (Sainz & Vergara-Lo¤pez 2008) We also propose that only wild oysters 465 mm SH be collected This strategy provides a helpful basis for allowing oysters to breed at least once and contribute to replenishment of wild populations before harvesting This strategy will also provide more reliable management strategies for cultivating, reproducing and harvesting the Cortez oyster under continuous, pilot-scale commercial operations Acknowledgments We thank M Robles-Mungaray, M Osuna-Garc|¤ a and P Ormart-Castro at CIBNOR for assistance during rearing of spat at the hatchery and M del RefugioLo¤pez for analysis of primary productivity of seawater I Fogel (CIBNOR) provided critical editorial comments for improving this manuscript Funding was provided by grants SAGARPA-CONACYT 2003-061 and AVANCE-CONACYT C01-275 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1558^1568 Aquaculture Research, 2011, 42, 1558^1568 Growth and ¢rst reproduction of C corteziensis J M Mazo¤n-SuaŁstegui et al References Arcos F.G., Ibarra A.M., Rodr|¤ guez-Jaramillo C., Garc|¤ a-La Torre E.A & VaŁzquez-Boucard C (2009) Quanti¢cation of vitellin/vitellogenin-like proteins in the oyster Crassostrea corteziensis (Hertlein 1951) as a tool to predict the degree of gonad maturity Aquaculture Research 40, 644^655 Baghurst B & Mitchell J.G (2002) Sex-speci¢c growth and condition of the Paci¢c oyster (Crassostrea gigas Thunberg) Aquaculture Research 33, 1253^1263 Baqueiro-Cardenas E (1991) Culture of Crassostrea corteziensis in Mexico In: Estuarine and Marine Bivalve Mollusk Culture (ed by W Menzel), pp 113^118 CRS Press, New York, USA CaŁceres-Puig J.I., Abasolo-Pacheco F., Mazo¤n-SuaŁstegui J.M., Maeda-Mart|¤ nez A.N & Saucedo P.E (2007) E¡ect of temperature on growth and survival of Crassostrea corteziensis spat during late-nursery culturing at the hatchery Aquaculture 272, 417^422 Campbell A & Ming M.D (2003) Maturity and growth of the Paci¢c geoduck clam, Panopea abrupta, in Southern British Columbia, Canada Journal of Shell¢sh Research 22, 85^90 Cardoso J., Langlet D., Lo¡ J.F., Martins A.R.,Witte J., Santos P.T & Van der Veer H.W (2007) Spatial variability in growth and reproduction of the Paci¢c oyster Crassostrea gigas (Thunberg, 1793) along the west European coast Journal of Sea Research 57, 303^315 Castro-Longoria R & Grijalva-Chon M (1992) Spatio-temporal variability of nutrients and seston in the coastal lagoon La Cruz, Sonora Ciencias Marinas 17, 83^97 ChaŁvez-Villalba J., Lo¤pez-Tapia M.R., Mazo¤n-SuaŁstegui J.M & Robles-Mungaray M (2005) Growth of the oyster Crassostrea corteziensis (Hertlein, 1951) in Sonora, Mexico Aquaculture Research 36,1337^1344 ChaŁvez-Villalba J., HernaŁndez-Ibarra A., Lo¤pez-Tapia M.R & Mazo¤n-SuaŁstegui J.M (2008) Prospective culture of the Cortez oyster Crassostrea corteziensis from northwestern Mexico: growth, gametogenic activity, and condition index Journal of Shell¢sh Research 27,711^720 Chung E.Y., HurY.B., Shin M.S & KimY.M (2005) Reproductive biology of the female manila clam, Ruditapes philippinarum (Bivalvia: Veneridae) on the west coast of Korea KoreanJournal of Malacology 21, 1^11 Contreras-Espinosa F (1984) Manual deTe¤ cnicas Hidrobiolo¤gicas Universidad Auto¤noma Metropolitana, campus Iztapalapa, Mexico City, Mexico Contreras-Mendoza C.N & Medina-SaŁnchez J.R (2006) Cultivo de ostio¤n Crassostrea corteziensis en los canales de drenaje de una granja camaronera BSc thesis, Universidad Auto¤noma de Sinaloa, MazatlaŁn, Sinaloa, Mexico Cruz P., Rodr|¤ guez-Jaramillo C & Ibarra A.M (2000) Environment and population origin e¡ects on ¢rst sexual maturity of catarina scallop, Argopecten ventricosus, (Sowerby II,1842) Journal of Shell¢sh Research 19, 89^93 Cuevas-Guevara C.A & Mart|¤ nez-Guerrero A (1979) Estudio gonaŁdico de Crassostrea corteziensis Hertlein, C palmula Carpenter y C iridescens Hanley, de San Blas, Nayarit, Mexico (Bivalvia: Ostreidae) Anales Instituto Ciencias del Mar y Limnolog|¤ a 6, 81^98 Fabioux C., Huvet A., Le Souchu P., Le Pennec M & Pouvreau S (2005) Temperature and photoperiod drive Crassostrea gigas reproductive internal clock Aquaculture 250, 458^470 Fr|¤ as-Espericueta M.G., Osuna-Lo¤pez J.I & PaŁez-Osuna F (1999) Gonadal maturation and trace metals in the mangrove oyster Crassostrea corteziensis: seasonal variation Science of theTotal Environment 231, 115^123 Gervis M.N & Sims N.S (1992) Biology and Culture of Pearl Oysters (Bivalvia: Pteriidae) Overseas Development Administration of the United Kingdom, International Centre for Living Aquatic Resources Management, Manila, Philippines, 49pp Howard D.W & Smith C.S (1983) Histological techniques for marine bivalve mollusks NOOA Technical Memorandum NMFS-F/NEC-25, U.S Department of Commerce, Woods Hole, MA Hurtado M.A., Ram|¤ rez J.L., Rodr|¤ guez-Jaramillo C.,Tovar D., Ibarra A.M., Soudant P & Palacios E (2009) Comparison of continuous and batch feeding systems on maturation, biochemical composition and immune variables of the oyster Crassostrea corteziensis (Hertlein 1951) Aquaculture Research 40, 464^472 Lango-Reynoso F., Devauchelle N., Le Pennec M & Hatt P.J (1999) Elements of reproductive strategy in oysters, Crassostrea gigas, from the‘‘Rade de Brest,’’ France Invertebrate Reproduction and Development 36, 141^144 Lango-Reynoso F., ChaŁvez-Villalba J & Le Pennec M (2006) Reproductive patterns of the Paci¢c oyster Crassostrea gigas in France Invertebrate Reproduction and Development 49, 41^50 Maeda-Mart|¤ nez A.N (2008) Estado actual del cultivo de bivalvos en Me¤xico In:Taller regional de la FAO sobre el Estado Actual del Cultivo y Manejo de Moluscos Bivalvos y su Proyeccio¤n Futura: Factores que Afectan su Sustentabilidad en Ame¤ rica Latina Actas de Pesca FAO No 12 (ed by A Lovatelli, A Far|¤ as & I Uriarte), pp 91^100 FAO, Rome, Italy Mazo¤n-SuaŁstegui J.M., Avile¤s-Quevedo S., Robles-Mungaray M & Flores-Higuera F (2002) Experiencias en el cultivo de ostio¤n de placer Crassostrea corteziensis a partir de semilla producida en el laboratorio In: Mem IV Simp Nac Acuic (ed by L.F Franco), pp 15–18 Centro de Estudios del Mar y Acuicultura and Universidad de San Carlos, Antigua, Guatemala Mazo¤n-SuaŁstegui J.M., Ru|¤ z-Ru|¤ z K.M., Parres-Haro A & Saucedo P.E (2008) Combined e¡ects of diet and stocking density on growth and biochemical composition of spat of the Cortez oyster Crassostrea corteziensis at the hatchery Aquaculture 284, 98^105 Mazo¤n-SuaŁstegui J.M., Parres-Haro M.A., Ru|¤ z-Ru|¤ z K.M., Rodr|¤ guez-Jaramillo M.C & Saucedo P.E (2009) In£uence of hatchery diets on early grow-out of the Cortez oyster r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1558^1568 1567 Growth and ¢rst reproduction of C corteziensis J M Mazo¤n-SuaŁstegui et al Crassostrea corteziensis in Guasave, Sinaloa, Mexico Aquaculture Research 40,1908^1914 Millione M., Saucedo P.E & Southgate P.C (2011) Sexual development, sex ratio and morphometrics of Pteria penguin (Bivalvia: Pteriidae), in north-eastern Australia Molluscan Research (in press) NarvaŁez C., Lodeiros C., Freites L., Nu¤nìez M., Pico D & Prieto A (2000) Abundancia de juveniles y crecimiento de Pinna carnea (Mytiloide: Pinnacea) en cultivo suspendido Revista de Biolog|¤ aTropical 48,785^797 Osuna-Lo¤pez J.I., Zazueta-Padilla H.M., Rodr|¤ guez-Higuera A & PaŁez-Osuna F (1990) Trace metal concentrations in mangrove oyster (Crassostrea corteziensis) from Tropical Lagoon Environments, Mexico Marine Pollution Bulletin 21, 486^488 PaŁez-Osuna F., Zazueta-Padilla H.M & Osuna-Lo¤pez J.I (1993) Biochemical composition of the oysters Crassostrea iridescens and Crassostrea corteziensis in the northwest coast of Mexico: seasonal changes Journal of Experimental Marine Biology and Ecology 170, 1^9 Parres-Haro M.A (2008) Evaluacio¤n del crecimiento en campo de semilla de ostio¤n de placer Crasosstrea corteziensis (Hertlein), alimentada diferentes dietas arti¢ciales en el laboratorio BSc thesis, Instituto Tecnolo¤gico del Mar, Los Mochis, Sinaloa, Mexico Rodr|¤ guez-Jaramillo C., Hurtado M.A., Romero-Vivas E., Ram|¤ rez J.L., Manzano M & Palacios E (2008) Gonadal development and histochemistry of the tropical oyster, Crassostrea corteziensis (Hertlein, 1951) during an annual reproductive cycle Journal of Shell¢sh Research 27, 1129^1141 1568 Aquaculture Research, 2011, 42, 1558^1568 Romo-Pinìera A.K (2010) Estrategia reproductiva de Megapitaria squalida (Sowerby,1835) em dos zonas de Baja California Sur, Mexico PhD thesis, Centro Interdisciplinario de Ciencias Marinas del I.P.N La Paz, Baja California Sur, Mexico Rupp G.S., Parsons G.J.,Thompson R.J & de Bem M.M (2005) In£uence of environmental factors, season and size at deployment on growth and retrieval of postlarval lion’s paw scallop Nodipecten nodosus (Linnaeus, 1758) from a subtropical environment Aquaculture 243, 195^216 Sainz I & Vergara-Lo¤pez P (2008) Identi¢cacio¤n y cuanti¢cacio¤n de organismos colonizantes de la ostra Crassostrea corteziensis cultivada en ¢ncas camaroneras Final report, Project SENACYT-PanamaŁ PS41161 Saout C., Que're' C., Donval A., Paulet Y.M & Samain J.F (1999) An experimental study of the combined e¡ects of temperature and photoperiod on reproductive physiology of Pecten maximus from the Bay of Brest (France) Aquaculture 172, 301^314 Sokal R.R & Rohlf F.J (1981) Biometry, 2nd edn W.H Freeman, San Francisco, CA, USA VaŁzquez-JuaŁrez R., HernaŁndez-Lo¤pez J., Gutie¤rrezRivera J.N., Coronado-Molina D & Mazo¤n-SuaŁstegui J.M (2006) First report of herpes virus in Paci¢c oyster Crassostrea gigas from faros in Northwestern Me¤xico In: Book of Abstracts, Global Conference on Aquatic Animal Health (ed by A Balmont), pp 62–63 OIE (World Organisation for Animal Health), Bergen, Norway r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1558^1568 Aquaculture Research, 2011, 42, 1569^1576 doi:10.1111/j.1365-2109.2011.02884.x Molecular cloning and mRNA expression of cathepsin C in white shrimp, Litopenaeus vannamei Lu Yishan, Lin Shitian,Wu Zaohe & Jian Jichang Guangdong Provincial Key Laboratory of Pathogenic Biology and Epidemiology for Aquatic Economic Animals, Fisheries College of Guangdong Ocean University, Zhanjiang, China Correspondence: Wu Zaohe, Guangdong Provincial Key Laboratory of Pathogenic Biology and Epidemiology for Aquatic Economic Animals, Fisheries College of Guangdong Ocean University, Zhanjiang, 524025, China E-mail: wuzh@gdou.edu.cn Abstract The cDNA encoding cathepsin C from the haemocytes of Litopenaeus vannamei (designated LVcathepsinC) was cloned by rapid ampli¢cation of cDNA ends (RACE) techniques The full length of LVcathepsinC cDNA was 2026 bp, with an open reading frame of 1356 bp, which encoded a polypepetide of 451 amino acid residues with a theoretical molecular weight of 50.76 kDa and an estimated isoelectric point of 6.01 LVcathepsinC showed high similarity to other organisms on performing BLAST analysis Fluorescent quantitative real-time reverse transcriptase-polymerase chain reaction was used to examine the expression of the LVcathepsinC gene in haemocytes of L vannamei after the challenge of bacteriaVibrio alginolyticus There was a clear time-dependent expression pattern of LVcathepsinC after the bacterial challenge, and the mRNA expression reached a maximum level at h post challenge, and then returned to the control level after h The up-regulated mRNA expression of LVcathepsinC in L vannamei after bacterial challenge indicates that the LVcathepsinC gene is inducible and may be involved in immune response Keywords: Litopenaeus vannamei, cathepsin C, real-time RT-PCR, RACE Introduction Cathepsin C (dipeptidyl-peptidase I) is a widely expressed lysosomal cysteine proteinase belonging to the papain Superfamily (Rao, Rao & Hoidal 1997) Cysteine proteinase can catalyse the hydrolysis of many proteins with di¡erent speci¢cities For cathepsin C to r 2011 Blackwell Publishing Ltd exert its proteinase activity, it is crucial that the procathepsin C is cleaved by a certain proteinase such as cathepsin L or S, followed by the formation of an oligomeric structure (Dahl, Halkier, Lauritzen, Dolenc, Pedersen, Turk & Turk 2001) It plays an important role in the activation of haematopoietic serine proteases found in the granules of cytotoxic lymphocytes, such as granzymes A and B, and in£ammatory cells, such as chymase, cathepsin G and netrophil elastase (Mcguire, Lipsky & Thiele 1993; Nauland & Rijken 1994; Pham & Ley 1999; Wolters, Pham, Muilenburg, Ley & Caughey 2001) It also has the ability to remove dipeptides sequentially from the amino terminus of peptide and protein substrates (Mcdonald, Callahan, Zeitman & Ellis 1969; Metrione & MacGeorge1975) Except for dipeptidyl aminopeptidase activity, the general functions attributed to cathepsin C include cell growth (Doughty & Gruenstein 1987), neuraminidase activation (D’Agrosa & Callahan 1988), alimentary tract (Ishidoh, Muno, Sato & Kominami1991), proliferation of basal cell carcinomas and platelet factor XIII activation (Lynch & Pfueller 1988) Cathepsin C has a unique structure (Turk, Janjic, Stern, Podobnik, Lamba, Dahl, Lauritzen, Pedersen, Turk & Turk 2001) consisting of four identical subunits, each containing an N-terminal exclusion domain, a heavy (H) chain harbouring the catalytic Cys234 and a C-terminal light (L) chain However, the exclusion domain partially blocks the prime side of active cleft, making it accessible only to the N-terminus of a peptide substrate This unique structural arrangement makes cathepsin C an e⁄cient processing enzyme specialized in the removal of dipeptide from the N-terminus of a protein precursor (Mort & Buttle 1997; Turk, Turk & Turk 2000) 1569 Molecular cloning of cathepsin C in L vannamei L Yishan et al In recent studies, the cathepsin C gene has been reported in many animals, such as Xenopus laevis (GenBank accession no BC056109), Danio rerio (GenBank accession no NM-214722), Marsupenaeus japonicus (GenBank accession no AB104735) and Penaeus monodon (GenBank accession no EU026137) However, there is no information available on cathepsin C in Litopenaeus vannamei so far Shrimp depends entirely on an innate immune system, without an adaptive mechanism to resist pathogen invasion (Gross, Bartlett, Browdy, Chapman & Warr 2001) Once pathogens like bacteria enter the haemocoel of the host, they may break down the complex system of innate defence mechanisms and cause mass mortalities in cultured shrimp (Lee, Yu, Chen, Yang & Liu 1996; Janeway Jr & Medzhitov 1998) Nowadays, shrimp has becoming an important asset to the economy (Dong & Xiang 2007) Understanding the response of L vannamei against bacterial challenge can provide us with further information on the anti-stress mechanism and help us select appropriate biomarkers to evaluate the actual physiological status of L vannamei and environmental impact, and then to develop strategies and approaches to control diseases Here, we report the full sequence of LVcathepsinC and its deduced amino acid sequence In addition, we examine the expression pattern of the LVcathepsinC gene in haemocytes exposed to bacterial challenge Materials and methods Organisms, bacterial challenge and tissues preparation Litopenaeus vannamei were purchased from a shrimp farm and maintained in aerated sand-¢ltered seawater at 25 1C for week before processing The bacterial challenge experiment was performed by Aquaculture Research, 2011, 42, 1569^1576 injecting 0.05 mL of Vibrio alginolyticus resuspended in phosphate bu¡ered saline (PBS) with a concentration of  107 cells mL À into the muscles Six shrimp injected with 0.05 mL PBS were used as the control group The injected shrimp were returned to seawater tanks, and 18 individuals were randomly sampled at 2, 4, 6, and 10 h after the injection The haemolymphs from the control and the stimulated groups were collected from the abdomen blood sinus of shrimp using a syringe The haemolymph samples were immediately centrifuged at 800 g, 1C for10 to harvest the haemocytes and then TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was added for RNA extraction following the manufacturer’s instruction Primers’design Formerly, a 355 bp LVcathepsinC like EST fragment had been identi¢ed from the subtracted cDNA library of L vannamei induced by V algnolyticus (Cai, Lu, Wu, Jian, Wang & Cai 2010) Then, some speci¢c primers designed from the EST fragment were used for the gene cloning and real-time reverse transcriptase-polymerase chain reaction (RT-PCR) analysis (Table 1) Cloning of the LVcathepsinC cDNA Both the and the ends of LVcathepsinC cDNA were cloned by a rapid ampli¢cation of the cDNA end (RACE) kit (Roche, Munich, Germany) according to the procedure speci¢ed by the manufacturer and sequenced by Sangon Biological Engineering Technology & Services (Shanghai, China) By overlapping the end,5 end and the EST fragments with cluster analysis, the full length of the LVcathepsinC cDNA was obtained Table Primer sequences and their applications in this study Primer names Sequence ^3 Applications OligodT Anchor primer LVsense LVanti1 LVanti2 RTLVsense RTLVanti ActinF ActinR GACCACGCGTATCGATGTCGACT GACCACGCGTATCGATGTCGAC GCCATCAACTCGCAACAAAGCA AAACTGGCTTCTGGTGGTTGCTG CTGCTTTGTTGCGAGTTGATG CTCAAGGATGTGAAGGTGGTTT TGTAATGTTTGGTGCAGGAAGT TTCGAGCAGGAGATGACCACC ATTCCATGCCCAGGAATGAGG OligodT-anchor primer for and RACE Anchor primer for and RACE Sense primer for LVcathepsinC in RACE Anti-primer for LVcathepsinC in first-round RACE Anti- for LVcathepsinC in second-round RACE Sense primer for LVcathepsinC real-time RT-PCR Anti-primer for LVcathepsinC real-time RT-PCR Sense primer for b-actin in real-time RT-PCR Anti-primer for b-actin in real-time RT-PCR RT-PCR, reverse transcriptase-polymerase chain reaction; RACE, rapid ampli¢cation of cDNA ends 1570 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1569^1576 Aquaculture Research, 2011, 42, 1569^1576 Molecular cloning of cathepsin C in L vannamei L Yishan et al Figure Nucleotide and deduced amino acid sequences of LVcathepsinC The asterisk shows the stop code Bioinformatic analysis The similarity analysis of nucleotide and protein sequence was carried out using the BLAST program at NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi) Multiple alignments of cathepsin C sequences were performed using the CLUSTALW2 Multiple Alignment program (http:// www.ebi.ac.uk/Tools/clustalW2/) Analyses of the de- r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1569^1576 1571 Molecular cloning of cathepsin C in L vannamei L Yishan et al duced amino acid sequences were conducted using the programs PSORT (Kenta Nakai, National Institute Basic Biology, Tokyo, Japan), SCAN PROSITE (EXPASY Molecular 1572 Aquaculture Research, 2011, 42, 1569^1576 Biology Server) and NETNGLYC 1.0 Server (http://www cbs.dtu.dk/services/NetNGlyc/) A phylogenetic tree was computed using DNAMAN software according to r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1569^1576 Aquaculture Research, 2011, 42, 1569^1576 the neighbour-joining method based on the sequences of LVcathepsinC and other known cathepsin C sequences in GenBank One thousand bootstrap replicates were performed for the phylogenetic analysis Real-time RT-PCR The expression of the LVcathepsinC transcript in haemocytes post bacteria challenge was measured using £uorescent real-time RT-PCR Haemolymph (0.5 mL shrimp À 1) was collected from the abdomen blood sinus of six individuals and pooled together as a replicate sample Then, three such replicates were taken for each time point in the bacterial challenge experiment The haemocytes’ collection and total RNA extraction were isolated as described in ‘Organisms, bacterial challenge and tissues preparation’ The cDNA ¢rst-strand synthesis was carried out based on reverse transcriptase M-MLV (Rnase H-) (Takara, Shiga, Japan) using total RNA as a template The cDNA mix was then diluted to1:10 and stored at À 80 1C for subsequent £uorescent real-time RT-PCR Two speci¢c primers were used to amplify the partial sequence of LVcathepsinC and b-actin was chosen as the reference gene for internal standardization ampli¢ed by two b-actin primers designed from the sequence in GenBank (accession no AF300705) The £uorescent real-time RT-PCR assay was carried out in a Bio-Rad IQ5 Real-time PCR System (Bio-Rad, Hercules, CA, USA) The ampli¢cations were performed in a 20 mL reaction volume containing 10 mL of Hotstart £uo-PCR mix (purchased from Sangon Biological Engineering Technology & Services Shanghai, China), mL sense primer and mL anti-sense primer (10 mM), mL of 1:10 diluted cDNA and mL of sterile water The thermal pro¢le was 95 1C for min, followed by 40 cycles of 95 1C for 10 s, 55 1C for 30 s and 72 1C for 30 s Dissociation curve analysis of ampli¢cation products was performed at the end of each PCR reaction After the PCR program, £uorescent real-time PCR data were analysed using the Bio-Rad IQ5 system (Bio-Rad) and Student’s t-test was used for statistical analysis Molecular cloning of cathepsin C in L vannamei L Yishan et al Results cDNA cloning and sequence analysis Based on the EST sequence of 355 bp, a fragment of 1526 bp was ampli¢ed using the RACE technique By RACE-PCR, a 388 bp fragment was ampli¢ed A total 2026 bp nucleotide sequence representing the complete cDNA sequence of the LVcathepsinC gene was obtained The complete cDNA had been deposited in GenBank under accession no FJ265735 Sequence analysis showed that there is an open reading frame of 1356 bp encoding a protein of 451 amino acids The theoretical molecular weight of the deduced amino acid is 50.76 kDa, with an isoelectric point of 6.01 In UTR, the sequence lacks a polyadenylation signal sequence (AATAAA) (Fig 1) Bioinformatics analysis The BLAST program analysis showed that the nucleotide sequence of the LVcathepsinC gene shares very high homology with M japonicus and P monodon Multiple sequence alignment of LVcathepsinC with other cathepsin C amino acid sequences revealed that they are highly conserved The software analysis indicated that there exists a putative typical signal peptide of 20 amino acids (position 1^20 aa), a long propeptide of 201amino acids (position 21^221aa) and a putative mature peptide region of 230(position 222^ 451aa) in cathepsin C The mature protein, comprised of a heavy chain (position 222^384 aa) and a L chain (position 384^451aa), contains three catalytic active sites (Cys247, His393 and Asn415) that are highly conserved in all papain family members (Fig 2) The phylogenetic tree based on the amino acid sequences of cathepsin C showed that all the vertebrate cathepsin C and invertebrate cathepsin C were clustered together In the phylogenetic tree, the LVcathepsinC showed the closest relationship with those of P mondon and M japonicus, which were in general agreement with the concept of the traditional taxonomy of the three species (Fig 3) Figure Multiple alignment of the deduced amino acid sequence of LVcathepsinC with reported cathepsin C sequences from rat, Rattus norvegicus (Genbank accession no AB23200), human, Homo sapiens (2118248A), tiger shrimp, Penaeus monodon (ABW74905), kuruma prawn, Marsupenaeus japonicus (BAC57943), and zebra¢sh, Danio rerio (AAA64286) Asterisks (Ã) the amino acid residues conserved in the six species Colon (:) residues with more similar properties, Dot (.) residues with some similar properties and the blank indicates residues with opposite properties The arrows indicate the cleavage sites of the signal peptide, propeptide, the heavy and light chains of the mature peptide The conserved catalytic residues, cysteine, histidine and asparagines are highlighted and in bold LV, Litopenaeus vannamei; PM, P monodon; MJ, M japonicus; RN, R norvegicus; HS, H sapiens; DR, D rerio r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1569^1576 1573 Molecular cloning of cathepsin C in L vannamei L Yishan et al Figure The N^J phylogenic tree based on the cathepsin C from white shrimp (Litopenaeusvannamei), kuruma prawn (Marsupenaeus japonicus), tiger shrimp (Penaeusmonodon), zebra¢sh (Danio rerio), frog (Xenopus laevis), domestic dog (Canis familiaris), cattle (Bos taurus), Human (Homo sapiens), orangutan (Pongo abelli), mouse (Mus musculus), rat (Rattus norvegicus), and a parasitic helminth (Schistosoma mansoni) Numbers at nodes are bootstrap support indices after 1000 replicates Expression of LVcathepsinC in response to bacterial challenge Fluorescent real-time RT-PCR was used to examine the time-dependent expression pattern of LVcathepsinC in haemocytes of L wannamei challenged by V alginolyticus The results showed during the ¢rst h after V alginolyticus stimulation, the cathepsin C mRNA remained at a low level h after stimulation, the expression of the LVcathepsinC gene was up-regulated and reached the highest level After h, the LVcathepsinC expression declined gradually and recovered almost to the original level by h The LVcathepsinC gene expression levels at and h after bacterial challenge were signi¢cantly higher than that in the control group (Po0.01) (Fig 4) Discussion In the present work, we determined the complete cDNA sequence encoding cathepsin C from the haemocytes of L vannamei However, our sequence lacks a polyadenylation signal sequence (AATAAA) and di¡ers from many species, including cathepsin C in Human and P mondon Despite the lack of polyadeny- 1574 Aquaculture Research, 2011, 42, 1569^1576 Figure Relative expression of LVcathepsinC in the haemocytes of white shrimp, Litopenaeus vannamei at di¡erent times post Vibrio alginolyticus challenge b-actin was chosen as the reference gene for internal standardization and samples from the shrimp injected with phosphate bu¡ered saline were used as the control group Data showed that the LVcathepsinC gene expression levels at and h after bacterial challenge were signi¢cantly higher than that of the control group (Po0.01) lation signal sequence, the cDNA sequence of the LVcathepsinC gene still has a polyA tail, and the deduced amino acid sequence shares high identity to other known cathepsin C such as P mondon (90.91%) and M japonicus (89.14%) Cathepsin C, ¢rstly synthesized as procathepsin C and modi¢ed into mature cathepsin C comprised of a heavy chain, a light chain and a propeptide, is a typical lysosomal cysteine proteinase belonging to the papain Superfamily (Turk et al 2001) The three amino acid residues, as putative important catalytic active sites in all papain family members, were found in the deduced amino acids of LVcathepsinC and also conserved among the invertebrate and vertebrate species However, only one consensus site at residues 25 was detected when referring to the potential glycosylation sites for post-translational modi¢cation, whereas two sites in kuruma prawn, three to four sites in mammalian and ¢ve in the £atworm were reported (Brindley, Kalinna, Dalton, Day,Wong, Smythe & Mcmanus 1997; Pham, Armstrong, Zimonjic, Popescu, Payan & Ley 1997; Dahl et al 2001; Qiu,Yamano & Unuma 2005) In the past decade, higher frequencies of disease have been reported in aquatic organisms Cathepsin, which is considered to be an immune-related factor, has been reported in several species For example, the Cathepsin C gene was found to be an up-regulated gene involved in the ¢nal stages of oocyte matura- r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1569^1576 Aquaculture Research, 2011, 42, 1569^1576 tion, helping to regulate the ovary growth in kuruma prawn (Qiu et al 2005) Cathepsin B as the single most dominant enzyme with a speci¢c activity in Meretrix meretrix (Wang, Liu, Wang, Tang & Xiang 2008) Cathespins L was highly expressed after the WSSV (white spot syndrome virus) infection in L vannamei, suggesting that it was involved in the defence response against the virus (Zhao, Yin, Weng, Guan, Li, Xing, Chan & He 2007) In this paper, we found that the LVcathepsinC expression in haemocytes was up-regulated after V alginolyticus challenge, and a clear time-dependent expression pattern of LVcathepsinC was observed The result indicated that LVcathepsinC is a constitutive and inducible acute-phase protein Our ¢ndings suggested that LVcathepsinC may be involved in the response to bacterial infection and plays an important role in the immune response of the host Furthermore, the observation of the time-dependent expression pattern of LVcathepsinC provided a new clue towards understanding the natural response to diseases affecting the shrimp production Acknowledgments We thank all the laboratory members for their critical reviews and comments on this manuscript We are especially grateful for the critical comments from the anonymous reviewers This research is supported by research grants from the Bureau of Science and Technology of Guangdong Province, China (No 2005B20301008) References Brindley P.J., Kalinna B.H., Dalton J.P., Day S.R., Wong J.Y., Smythe M.L & McManus D.P (1997) Proteolytic degradation of host hemoglobin by schistosomes Mol Biochem Parasitol 89,1^9 Cai X.H., LuY.S.,Wu Z.H., Jian J.C.,Wang B & Cai S.H (2010) Construction of subtracted cDNA library of Liptopenaeus vannamei induced by Vibrio algnolyticus and analysis of expressed sequence tags Acta Hydrobiologica Sinica 34, 157^163 D’Agrosa R.M & Callahan J.W (1988) In vitro activation of neuraminidase in the beta-galactosidase-neuraminidase-protective protein complex by cathepsin C Biochem Biophys Res Commun 157,770^775 Dahl S.W., Halkier T., Lauritzen C., Dolenc I., Pedersen J., TurkV & Turk B (2001) Human recombinant pro-dipeptidyl peptidase I (cathepsin C) can be activated by cathe- Molecular cloning of cathepsin C in L vannamei L Yishan et al psins L and S but not by autocatalytic processing Biochemistry 40,1671^1678 Dong B & Xiang J.H (2007) Discovery of genes involved in defense/immunity functions in a haemocytes cDNA library from Fenneropenaeus chinensis by ESTs annotation Aquaculture 272, 208^215 Doughty M.J & Gruenstein E.I (1987) Cell growth and substrate e¡ects on characteristics of a lysosomal enzyme (cathepsin C) in Duchenne muscular dystrophy ¢broblasts Biochem Cell Biol 65, 617^625 Gross P.S., Bartlett T.C., Browdy C.L., Chapman R.W & Warr G.W (2001) Immune gene discovery by expressed sequence tag analysis of hemocytes and hepatopancreas in the Paci¢c White Shrimp, Litopenaeus vannamei, and the Atlantic White Shrimp, L setiferus Dev Comp Immunol 25, 565^577 Ishidoh K., Muno D., Sato N & Kominami E (1991) Molecular cloning of cDNA for rat cathepsin C Cathepsin C, a cysteine proteinase with an extremely long propeptide J Biol Chem 266, 16312^16317 Janeway C.A Jr & Medzhitov R (1998) Introduction: the role of innate immunity in the adaptive immune response Semin Immunol 10, 349^350 Lee K.K.,Yu S.R., Chen F.R.,Yang T.I & Liu P.C (1996) Virulence of Vibrio alginolyticus isolated from diseased tiger prawn, Penaeus monodon Curr Microbiol 32, 229^231 Lynch G.W & Pfueller S.L (1988) Thrombin-independent activation of platelet factor XIII by endogenous platelet acid protease Thromb Haemost 59, 372^377 McDonald J.K., Callahan P.X., Zeitman B.B & Ellis S (1969) Inactivation and degradation of glucagon by dipeptidyl aminopeptidase I (cathepsin C) of rat liver J Biol Chem 244, 6199^6208 McGuire M.J., Lipsky P.E & Thiele D.L (1993) Generation of active myeloid and lymphoid granule serine proteases requires processing by the granule thiol protease dipeptidyl peptidase I J Biol Chem 268, 2458^2467 Metrione R.M & MacGeorge N.L (1975) The mechanism of action of dipeptidyl aminopeptidase Inhibition by amino acid derivatives and amines; activation by aromatic compounds Biochemistry 14, 5249^5252 Mort J.S & Buttle D.J (1997) Cathepsin B Int J Biochem Cell Biol 29,715^720 Nauland U & Rijken D.C (1994) Activation of thrombin-inactivated single-chain urokinase-type plasminogen activator by dipeptidyl peptidase I (cathepsin C) Eur J Biochem 223, 497^501 Pham C.T & Ley T.J (1999) Dipeptidyl peptidase I is required for the processing and activation of granzymes A and B in vivo Proc Natl Acad Sci USA 96, 8627^8632 Pham C.T., Armstrong R.J., Zimonjic D.B., Popescu N.C., Payan D.G & Ley T.J (1997) Molecular cloning, chromosomal localization, and expression of murine dipeptidyl peptidase I J Biol Chem 272,10695^10703 Qiu G.F., Yamano K & Unuma T (2005) Cathepsin C transcripts are di¡erentially expressed in the ¢nal stages of r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1569^1576 1575 Molecular cloning of cathepsin C in L vannamei L Yishan et al oocyte maturation in kuruma prawn Marsupenaeus japonicus Comp Biochem Physiol B Biochem Mol Biol 140, 171^181 Rao N.V., Rao G.V & Hoidal J.R (1997) Human dipeptidyl-peptidase I Gene characterization, localization, and expression J Biol Chem 272, 10260^10265 Turk B., Turk D & Turk V (2000) Lysosomal cysteine proteases: more than scavengers Biochim Biophys Acta 1477, 98^111 Turk D., JanjicV., Stern I., Podobnik M., Lamba D., Dahl S.W., Lauritzen C., Pedersen J., Turk V & Turk B (2001) Structure of human dipeptidyl peptidase I (cathepsin C): exclusion domain added to an endopeptidase framework creates the machine for activation of granular serine proteases EMBO J 20, 6570^6582 1576 Aquaculture Research, 2011, 42, 1569^1576 Wang X.M., Liu B.Z., Wang G.D., Tang B.J & Xiang J.H (2008) Molecular cloning and functional analysis of cathepsin B in nutrient metabolism during larval development in Meretrix meretrix Aquaculture 282, 41^ 46 Wolters P.J., Pham C.T., Muilenburg D.J., Ley T.J & Caughey G.H (2001) Dipeptidyl peptidase I is essential for activation of mast cell chymases, but not tryptases, in mice J Biol Chem 276, 18551^18556 Zhao Z.Y., Yin Z.X., Weng S.P., Guan H.J., Li S.D., Xing K., Chan S.M & He J.G (2007) Pro¢ling of di¡erentially expressed genes in hepatopancreas of white spot syndrome virus-resistant shrimp (Litopenaeus vannamei) by suppression subtractive hybridisation Fish Shell¢sh Immun 22, 520^534 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1569^1576 [...]... loci Amean (overall) FIS (overall) Ho (overall) Locus Table 2 Continued Genetic divergence among broodstocks of Arctic charr C T Blackie et al Aquaculture Research, 2011, 42, 1440–1452 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1440^1452 Aquaculture Research, 2011, 42, 1440^1452 Genetic divergence among broodstocks of Arctic charr C T Blackie et al Figure 2 Graphical representation of population... Zhou X., Niu C & Li Q (1999) The e¡ects of light on aquatic animals Chinese Journal of Zoology 34, 45^48 (in Chinese) r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1431^1439 1439 Aquaculture Research, 2011, 42, 1440^1452 doi:10.1111/j.1365-2109 .2010. 02736.x Genetic divergence among broodstocks of Arctic charr Salvelinus alpinus in eastern Canada derived from the same founding populations Craig... Rockwood Aquaculture Research Centre (RARC) Rockwood Aquaculture Research Centre Carpenter’s Aquaculture (CA) Cardigan Fish Hatchery (CFH) Coastal Zones Research Institute (CZRI) Char-Tec (CT) Pisciculture des Alleghanys (PA) Nova Scotia Agricultural College (NSAC) Darren Cameron (DC) Cooke Aquaculture (COA) Moose Mountain Fisheries (MMF) Coldwater Fisheries (CF) Coldwater Fisheries Rockwood Aquaculture. .. fed diets containing di¡erent percentages of distillers’grains with solubles Progressive Fish-Culturists 55, 95^100 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1424^1430 Aquaculture Research, 2011, 42, 1431^1439 doi:10.1111/j.1365-2109 .2010. 02735.x A new system for the culture and stock enhancement of sea cucumber, Apostichopus japonicus (Selenka), in cofferdams Libin Zhang1, Hongsheng... common attributes of ¢sh in closed r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1440^1452 1447 Aquaculture Research, 2011, 42, 1440–1452 Genetic divergence among broodstocks of Arctic charr C T Blackie et al Table 4 Hierarchical analysis of molecular variance (AMOVA) based on FST measures for 21 broodstock populations of aquaculture Arctic charr (Salvelinus alpinus) at six microsatellite... nucleotide supplementation enhances growth and immune responses of grouper, Epinephelus malabaricus Aquaculture Nutrition 15,117^122 1430 Aquaculture Research, 2011, 42, 1424^1430 Mohsen A.A & Lovell R.T (1990) Partial substitution of soybean meal with animal protein sources in diets for channel cat¢sh Aquaculture 90, 303^311 Moros E.E., Darnoko D., Cheryan M., Perkins E.G & Jerrell J (2002) Analysis.. .Aquaculture Research, 2011, 42, 1424^1430 doi:10.1111/j.1365-2109 .2010. 02734.x Evaluation of corn distillers dried grains with solubles and brewers yeast in diets for channel catfish Ictalurus punctatus (Rafinesque) Menghe H Li, Daniel F Oberle & Penelope M Lucas Thad Cochran National Warmwater Aquaculture Center, Mississippi State University, Stoneville,... polyethylene (HDPE) netting; 4, shade netting; 5, strut bar; 6, polyethylene (PE)-corrugated sheet; 7, polyvinyl chloride (PVC) cannula; 8, tie wire 1432 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1431^1439 Aquaculture Research, 2011, 42, 1431^1439 New system for the culture of sea cucumber L Zhang et al thickness The length of the cannulae depended on the spacing required between the corrugated... colour of polyethylene-corrugated sheets Di¡erent letters indicate signi¢cant di¡erences (Po0.05) and bars represent standard errors of means 1434 r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1431^1439 Aquaculture Research, 2011, 42, 1431^1439 New system for the culture of sea cucumber L Zhang et al ences among sea cucumber numbers in BO3, BW3 and BP3 (Po0.05) E¡ect of spacing Numbers of... system and observation date indicate signi¢cant di¡erence between di¡erent coloured upper and lower layers (Po0.05) r 2011 Blackwell Publishing Ltd, Aquaculture Research, 42, 1431^1439 1435 New system for the culture of sea cucumber L Zhang et al Aquaculture Research, 2011, 42, 1431^1439 Table 3 Numbers of Apostichopus japonicus in upper and lower layers at di¡erent spacings and shape/style 20 October