PRL-3 PROMOTES EPITHELIAL-MESENCHYMAL TRANSITION AND CONFERS RESISTANCE TO APOPTOSIS SAMANTHA QUAH YILING (B.Sc, NUS) INSTITUTE OF MOLECULAR AND CELL BIOLOGY A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF BIOCHEMISTRY NATIONAL UNIVERSITY OF SINGAPORE 2010 Acknowledgements I am grateful to my supervisor, Associate Professor Zeng Qi for her guidance during the course of this project and the privilege to work in her lab I am also grateful to the Institute of Molecular and Cell Biology where the project was carried out, for the opportunity to pursue this degree through their sponsorship and support I like to thank Ms Vicki Koh and Doctor Wang Haihe for working most closely with me, and other past and present members of our lab in IMCB: Doctor Guo Ke, Ms Li Jie, Ms Tang Jing Ping, Mr Tan Cheng Peow Bobby, Mr Abdul Qader Al-Aidaroos, Mr Loo Jiamin, Doctor Liu Hao, Ms Gan Bin Qi and Ms Yaw Lai Ping for their support and sharing of technical expertise I acknowledge Doctor Dong Jing Ming for his work in the publication featured in Chapter 3.1 I would also like to thank Associate Professors Tang Bor Luen and Ge Ruowen for reviewing my work as part of my Thesis Advisory Committee This work was funded by research grants from the Agency of Science, Technology, and Research (A*STAR), Singapore, and I was supported by a Sponsorship from the Institute of Molecular and Cell Biology ii   Table of Contents Acknowledgements………………………………………………………………………………ii Table of Contents……………………………………………………………………………… iii List of Abbreviations…………………………………………………………………………… v List of Tables…………………………………………………………………………………… vi List of Figures……………………………………………………………………………………vi Summary ……………………………………………………………………………………… Chapter Introduction 1.1 Cancer Progression and Metastasis……………………………………………………………3 1.2 Protein Phosphorylation ………………………………………………………………………6 1.3 PRL family of Protein Tyrosine Phosphatases ……………………………………………….9 1.4 PRL-3 and cancer metastasis …………………………………………………………… …11 1.5 PRL-3 mediated cell signalling .15 1.6 PRL-3 as a target for cancer therapy ……………………………………………………… 17 1.7 Rationale of work ……………………………………………………………………………19 Chapter Materials and Methods 24 Chapter Results and Discussion 3.1 PRL-3 promotes Epithelial-Mesenchymal Transition 3.1.1 PRL-3 reduces paxillin, phosphorylated paxillin-Tyr31, and vinculin adhesion molecules 34 3.1.2 Elevated PRL-3 decreases filamentous actin, RhoA-GTP and Rac1-GTP .36 iii   3.1.3 PRL-3 signals through PI3K to promote EMT .………… ……………….38 3.1.4 PRL-3 down-regulates PTEN expression … …………………………………………41 3.2 PRL-3 Confers Resistance to Apoptosis and Up-regulates GADD34 Phosphorylation 3.2.1 PRL-3 confers resistance to apoptosis 43 3.2.2 PRL-3 up-regulates GADD34 tyrosine phosphorylation 48 3.2.3 PRL-3 interacts with GADD34 52 3.2.4 PRL-3 down-regulates Lyn ……………………………………………………………….54 Chapter Concluding remarks …………………………………………………………………57 Claims to original discovery ……………………………………………………………………60 Publication……………………………………………………………………………….………61 References……………………………………………………………………………………….62 iv   List of Abbreviations ATM: Ataxia telangiectasia mutated DSP: Dual Specificity Phosphatase ECM: Extracellular Matrix EGF: Epidermal Growth Factor EMT: Epithelial-Mesenchymal Transition ERK: Extracellular signal-Regulated Kinase JNK: c-Jun N-terminal Kinase MAPK: Mitogen-Activated Protein Kinase MMS: Methyl methanesulfonate PDK1: Phosphotidylinositol-Dependent Kinase PH: Pleckstrin Homology PI3K: Phosphatidylinositol 3-Kinase PKB: Protein Kinase B PRL: Phosphatase of Regenerating Liver PTB: Phosphotyrosine-Binding PTEN: Phosphatase and Tensin homologue deleted on chromosome 10 PTK: Protein Tyrosine Kinase PTP: Protein Tyrosine Phosphatase RTK: Receptor Tyrosine Kinase SFK: Src Family Kinase SH2: Src Homology v   List of Tables Table 1: Map of the Hypromatrix Cell Cycle Antibody Array™ 29 List of Figures Figure 1: Principle behind detection of protein tyrosine phosphorylation with the Hypromatrix Cell Cycle Antibody Array™……………………………………………… 30 Figure 2: Principle behind detection of protein-protein interaction with the Hypromatrix Cell Cycle Antibody Array™……………………………………………………………………… 32 Figure 3A: PRL-3 reduces paxillin in HeLa cells 34 Figure 3B: PRL-3 reduces paxillin, p-paxillin Tyr31 and vinculin in CHO cells (IF) 34 Figure 3C: PRL-3 reduces paxillin, p-paxillin Tyr31 and vinculin in CHO and DLD-1 cells (ECL) 34 Figure 4A: PRL-3 decreases F-actin in CHO cells 36 Figure 4B: PRL-3 decreases levels of RhoA-GTP and Rac1-GTP .36 Figure 4C: PRL-3 is polarized to membrane protrusions in some motile cells 36 Figure 5A: PRL-3 phosphorylates and activates Akt 38 Figure 5B: PRL-3 phosphorylates and inhibits GSK-3β .38 Figure 5C: PRL-3 down-regulates epithelial markers 38 Figure 5D: PRL-3 up-regulates mesenchymal markers .38 Figure 6A: PRL-3 down-regulates PTEN 41 Figure 6B: Proposed role for PRL-3 in EMT 41 Figure 7A: PRL-3 confers resistance to apoptosis in MCF7 cells .43 Figure 7B: PRL-3 confers resistance to apoptosis in DLD-1 cells 45 Figure 8A: PRL-3 up-regulates GADD34 protein tyrosine phosphorylation in DLD-1 cells .48 Figure 8B: PRL-3 up-regulates GADD34 protein tyrosine phosphorylation in MCF7 cells 48 Figure 8C: PRL-3 up-regulates GADD34 protein tyrosine phosphorylation in CHO cells 48 Figure 8D: Immunoprecipitation of phosphorylated GADD34 in MCF7 49 vi   Figure 8E: Immunoprecipitation of phosphorylated GADD34 in DLD-1 49 Figure 9A: PRL-3 interacts with GADD34 in DLD-1 52 Figure 9B: PRL-3 interacts with GADD34 in MCF7 52 Figure 9C: Immunoprecipitation of GADD34 with PRL-3 52 Figure 10A: PRL-3 down-regulates Lyn protein levels .54 Figure 10B: PRL-3 down-regulates Lyn mRNA levels .54 vii   Summary PRL-3 is a multi-tasking phosphatase involved in cancer metastasis It promotes various cancer-related properties, such as motility, invasiveness and tumorigenicity Two important features of cancer progression are Epithelial-Mesenchymal Transition (EMT) and evasion of programmed cell death EMT is a process that is important for embryonic development and oncogenesis This process causes epithelial cells to adopt a migratory mesenchymal phenotype Evasion of apoptosis allows transformed cells to survive in the circulation to reach distant secondary sites Here we attempt to understand the role of PRL-3 in these two processes In this study, we found that cells expressing PRL-3 exhibited reduced focal adhesion proteins paxillin, phosphorylated paxillin-Tyr31 and vinculin Additionally, there was reduction in RhoA-GTP, Racl-GTP and filamentous-actin (F-actin) DLD-1 human colorectal cancer cells stably expressing EGFP-PRL-3 showed activation of Akt by PRL-3 and inactivation of glycogen synthase kinase-3β In these cells, PRL-3 also down-regulated epithelial markers E-cadherin, γcatenin (plakoglobin) and integrin β3 while up-regulating mesenchymal markers fibronectin and snail These changes could all be abrogated by the phophoinositide 3-kinase (PI3K) inhibitor LY294002 Thus PRL-3 would act upstream of PI3K to initiate EMT during cancer metastasis PRL-3 also down-regulates phosphatase and tensin homologue deleted on chromosome 10 (PTEN), which is a key antagonist of PI3K, reinforcing PI3K/Akt activation These changes point to PRL-3 promoting EMT by signalling through PI3K and down-regulating PTEN Activation of Akt is also known to have effects on cell cycle regulation and cell survival We found that MCF7 cells and DLD-1 cells stably expressing EGFP-PRL-3 were more resistant to genotoxic agents methyl methanesulfonate (MMS) and doxorubicin, as well as oxidative stress induced by H2O2 We screened protein lysates from these cells using a commercial antibody   array to find cell cycle related proteins whose phosphorylation status could be modified by PRL3, and for proteins that could interact with PRL-3 We identified the Growth Arrest and DNA Damage protein GADD34 as a candidate that fulfils both conditions consistently across different cell lines To understand how PRL-3 could mediate GADD34 phosphorylation, we looked for changes in Lyn, a Src family kinase known to phosphorylated GADD34 and negatively regulate its pro-apoptotic response to genotoxic apoptosis Surprisingly, we found that PRL-3 downregulated Lyn protein as well as mRNA We take this finding to indicate that PRL-3 might promote phosphorylation of GADD34 by an alternative pathway that is independent of Lyn These events require PRL-3 phosphatase activity, as the catalytically inactive mutant PRL-3 (C104S) could not effect these changes We propose that PRL-3 confers resistance to apoptosis through phosphorylation and inhibition of GADD34 These findings are part of the growing body of evidence that PRL-3 is a multi-tasking phosphatase involved in cancer metastasis through a variety of processes PRL-3 is thus a promising molecular target for cancer therapy   Chapter Introduction 1.1 Cancer Progression and Metastasis Cancer research in the past quarter century has revealed this complex disease to be a multistep process, in which cells acquire traits that allow them to override normal cell proliferation and homeostasis regulation to progress from normalcy to malignancy The physiological changes in tumorigenesis can be classified into six broad categories: self sufficiency in growth signals, insensitivity to growth-inhibitory (anti-growth) signals, limitless replicative potential, sustained angiogenesis, and tissue invasion and metastasis [1] These traits are acquired through genetic and epigenetic changes in the cancer cells and further supported by normal neighbouring cells in the tumour microenvironment Approximately 90% of cancer deaths are due to metastatic lesions rather than primary tumours The classical overview of metastasis consists of several steps – local invasion, intravasation, survival in the circulation, extravasation and colonization [2] Each of these steps requires the cells to overcome barriers of physiological checks and balances that maintain healthy tissue function Such barriers that suppress tumour formation include extracellular matrix components, basements membranes, reactive oxygen species, the limited availability of nutrients and oxygen, and attack by the immune system [3] These factors exert selective pressure that promotes outgrowth of cells that are able to adapt and thrive in microenvironments that would be inhospitable to normal cells Cell-cell adhesion and attachment to the extracellular matrix regulate signals for cell growth and proliferation Altered cell adhesion liberates cells from the normal constraints of tissue architecture [3] Cell surface receptors are important transducers of growth-stimulatory signals, and their deregulation is associated with tumour pathogenesis For example, members of the ErbB family of Receptor Tyrosine Kinases (RTKs) are deregulated in non-small-cell lung   The Hypromatrix Cell Cycle Antibody Array can also be used for detecting protein-protein interaction We screened protein lysates of DLD-1 and MCF7 cells to find proteins that interact with PRL-3 The antibodies fixed on the array capture their respective antigens from whole cell protein lysates, together with their interacting proteins In order to detect protein-protein interaction, we used HRP conjugated GFP antibody to detect GFP-PRL-3 and GFP-PRL-3 (C104S) GADD34 (Position A3) once again emerged as a protein of interest, being found to consistently bound more abundantly to PRL-3 compared to mutant PRL-3 (C104S) in both DLD1 (Figure 8A) and MCF7 (Figure 9B) cells The MCF7 results were further confirmed by immunoprecipitation (Figure 9C) Whole cell lysates were immunoprecipitated with PRL-3 antibody (Clone #318) GFP-PRL-3 is shown here as a loading control and to demonstrate the efficiency of the pull-down Consistent with the antibody array results, GADD34 binds more strongly to PRL-3 (Lane 3) compared to PRL-3 (C104S) (Lane 2) The interaction between GADD34 and PRL-3 might possibly result in some conformational change in GADD34 to enable it to be more easily phosphorylated Another possibility is that this interaction creates a larger protein complex that has downstream functions This interaction is reminiscent of GADD34’s interaction with the catalytic subunit of Protein Phosphatase (PP1), which results in dephosphorylation of eIF2α [104] GADD34 also binds other proteins that are known modulators of protein phosphatase activity [105] Here GADD34 interacts more strongly with catalytically active PRL-3 compared to the inactive mutant It is possible that while PRL-3 promotes phosphorylation of GADD34, GADD34 could also influence the activity of PRL-3, which is also a protein phosphatase 53   3.2.4 PRL-3 Down-regulates Lyn A B Figure 10A Western blot of transiently (lanes 1-3) and stably (lanes 4-6) transfected MCF7 cells Both sets show Lyn protein levels to be down-regulated in PRL-3 expressing cells (Lanes and 6) compared to untransfected (lane 4), GFP vector transfected (lane 1) and GFP-PRL-3 (C104S) mutant transfected (lane and 5) cells Figure 10B RT-PCR to show levels of Lyn and PRL-3 transcript with GAPDH as a loading control Lyn transcripts are down-regulated in MCF7 cells transfected with PRL-3 (lane 3) compared with untransfected control cells (lane 1) and PRL-3 (C104S) (lane 2) 54   Following our finding that PRL-3 could up-regulate GADD34 tyrosine phosphorylation, we investigated Lyn, which is a Src Family Kinase that has been reported to interact with GADD34 and phosphorylate it [85] Src family kinases play an important role in coupling cell surface receptors to cytoplasmic signalling They are involved in regulation of cell adhesion and migration through integrin signalling [23, 24] They are also involved in cell proliferation, differentiation and cell shape changes We found that PRL-3 over-expression led to down-regulation of Lyn protein in MCF7 cells The protein levels of Lyn were down-regulated by PRL-3 under transient (Figure 10A, Lane 3) and stable expression conditions (Lane 6) We then observed the mRNA levels of Lyn and found that PRL-3 down-regulated Lyn transcript as well (Figure 10B, Lane 3) This suggests transcriptional down-regulation This was unexpected as we anticipated Lyn would be up-regulated, since it has been reported to phosphorylate GADD34 in response to DNA damage [85] However, as our observations of GADD34 phosphorylation and Lyn down-regulation were in normal cell culture conditions where cells were not challenged with any stimulus We postulate that in this context, PRL-3 may be promoting GADD34 phosphorylation in a Lyn-independent manner The functional domain of GADD34 involved in executing apoptosis is reported to be the region of amino acids 1-214 Proteins binding in this region may be involved in execution of apoptotic activity and proteins that bind outside this region may modulate the apoptotic activity [105] We searched for possible phosphorylation sites on GADD34 using PhosphoSitePlus and found that GADD34 has one potential tyrosine phosphorylation site at Y262 [106] We also searched for possible kinase binding motifs on GADD34 using ScanSite [106] and found that GADD34 has 55   an Erk1 Kinase binding motif (RTSTSALSPGSKPST) at S212 and a PDK1 binding site group (EEGVNKFSYPPSHRE) at S178 Both these sites are close to the potential tyrosine phosphorylation site as well as the apoptosis execution domain PI3K action generates PIP3 at the plasma membrane, recruiting PDK1 and Akt to bind PIP3, resulting in phosphorylation of Akt [25] We have previously shown PRL-3 is able to up-regulate phosphorylation of Akt [57], and PDK1 might be the kinase through which PRL-3 mediates this effect 56   Chapter Concluding Remarks Cancer metastasis is the leading cause of death in cancer patients Metastasis is a multi-step process that involves cancer cells acquiring traits that allow them to detach from the primary tumour, enter the blood or lymph circulation, and survive to reach a receptive microenvironment to colonise it [3] Protein phosphorylation regulates many signalling pathways that regulate key cellular processes Protein kinases and phosphatases maintain the proper balance of phosphorylation status of signalling proteins, determining their activity Inappropriate kinase or phosphatase activity disrupts signal transduction, and can drive cells towards malignancy The PRL family is a unique family of protein tyrosine phosphatases that contain a PTP active site sequence and the prenylation motif CAAX [42] The third member of the family, PRL-3, has been linked to metastasis since Vogelstein’s group linked its transcripts to colorectal cancer progression in 2001 [43] Since then, PRL-3 has been found to be involved in many cancerassociated cell properties, including transformation, migration, invasion, tumorigenesis and metastasis Here we showed PRL-3 over-expression reduces key focal adhesion molecules paxillin (total and phosphorylated form) and vinculin (Figure 3) This might indicate reduced contacts between cells and the ECM PRL-3 also decreases the levels of F-actin, a key component of the cytoskeleton Levels of active RhoA and Rac1 were also reduced by PRL-3 Additionally, PRL3 was found to be polarised in membrane protrusions of some motile cells (Figure 4) Taken together, it seems PRL-3 destabilises the cytoskeleton, and alters key signal transducers between the ECM and cytoskeleton Changes in cell adhesion and motility are features of the process of Epithelial-Mesemchymal Transition (EMT) We studied PRL-3’s effect on the PI3K/Akt pathway which regulates EMT, and important epithelial and mesenchymal markers 57   We discovered PRL-3 is able to activate the Akt via PI3K and up-regulate epithelial markers Ecadherin, γ-catenin and integrin β3, while at the same time down-regulating mesenchymal markers fibronectin and snail (Figure 5) PRL-3 further enhanced PI3K action by down- regulating PTEN, the phosphatase responsible for reversing PI3K phosophorylation of PIP2 to PIP3 (Figure 6A) We conclude that PRL-3 promotes EMT via PI3K and PTEN, activating Akt and finally resulting in transcriptional suppression of epithelial markers (Figure 6B) Cancer progression also requires overcoming cell cycle arrest and apoptosis The Akt pathway not only plays a role in EMT, it also is involved in integrin signalling to regulate detachmentinduced apoptosis [10] Thus PRL-3 activation of PI3K/Akt might also have consequences for cell survival Akt activation also overcomes G2/M cell cycle checkpoint induced by DNA damage [82] We found that PRL-3 was able to confer some degree of resistance to various genotoxic apoptosis-inducing stimuli (Fig 7) We used an antibody array (Fig 1) and screened for cell cycle related proteins whose tyrosine phosphorylation status was affected by PRL-3, and found GADD34 to be of interest PRL-3 consistently up-regulated the phosphorylation of GADD34 in the three cell lines tested (Fig 8) Phosphorylation of GADD34 results in inhibition of its pro-apoptotic activity in response to genotoxic damage [85] GADD34 was also found to interact with PRL-3 using the same array, and confirmed this with immunoprecipitation (Fig 9) It is possible that binding of GADD34 and PRL-3 might render GADD34 more easily phosphorylated or they could be mutually regulating each other PRL-3 could also be activating a kinase responsible for phosphorylation of GADD34 We checked if PRL-3 had any effect on Lyn, a Src Family Kinase known to phosphorylate GADD34 [85] The consequence of GADD34 phosphorylation by Lyn is negative regulation of its proapoptotic response to DNA damage We found that PRL-3 down-regulated Lyn protein levels as well as mRNA transcript 58   levels (Fig 10) This finding indicates that the GADD34 phosphorylation we observed might be brought about by an alternative pathway independent of Lyn We conclude that PRL-3 confers some resistance to DNA damaged-induced apoptosis, through GADD34 phosphorylation Here we have shown PRL-3 plays its role in metastasis and tumour progression through these two important processes, EMT and resistance to DNA damage induced apoptosis Taken together, cancer cells that over-express PRL-3 can transform from epithelial cells to adopt a more motile and invasive mesenchymal cells At the same time, they would be able to evade apoptosis to reach their new sites of colonisation These findings contribute to the growing body of evidence that PRL-3 is a multi-tasking phosphatase, involved in progression of various major human cancers through different cellular processes Thus, PRL-3 remains an attractive potential molecular target and prognostic indicator for cancer therapy 59   Claims to original discovery In the course of our investigations, several findings were made which, to our knowledge, are novel and have not been reported previously These are listed below: 1) PRL-3 reduces focal adhesion molecules paxillin, phosphorylated paxillin-Tyr31 and vinculin 2) PRL-3 decreases cytoskeletal filamentous actin 3) PRL-3 activates AKT in a PI3K-dependent manner and down-regulates PTEN 4) PRL-3 promotes Epithelial-Mesenchymal Transition, down-regulating epithelial markers E-cadherin, γ-catenin and integrin β3, and up-regulating mesenchymal markers fibronectin and snail 5) PRL-3 confers resistance to apoptosis induced by DNA damaging agents and H2O2 6) PRL-3 binds to GADD34 and up-regulates GADD34 phosphorylation 7) PRL-3 down-regulates the Src Family Kinase Lyn 60   Publication The work in Chapter was published in Cancer Research; 2007; 67: (7) 2922-2926 PRL-3 Down-regulates PTEN Expression and Signals through PI3K to Promote EpithelialMesenchymal Transition Authors: Haihe Wang, Samantha Yiling Quah, Jing Ming Dong, Edward Manser, Jing Ping Tang and Qi Zeng, from the Institute of Molecular and Cell Biology, Singapore 61   References 10 11 12 13 14 15 16 17 18 19 20 21 Hanahan D, Weinberg R A (2000) The hallmarks of cancer Cell 100:57-70 Nguyen D X, Bos P D, Massague J (2009) Metastasis: from dissemination to organspecific colonization Nat Rev Cancer 9:274-84 Gupta G P, Massague J (2006) Cancer metastasis: building a framework Cell 127:67995 Sharma S V, Bell D W, Settleman J, Haber D A (2007) Epidermal growth factor receptor mutations in lung cancer Nat Rev Cancer 7:169-81 Guo W, Giancotti F G (2004) Integrin signalling during tumour progression Nat Rev Mol Cell Biol 5:816-26 Cavallaro U, Christofori G (2004) Cell adhesion and signalling by cadherins and IgCAMs in cancer Nat Rev Cancer 4:118-32 Yang J, Weinberg R A (2008) Epithelial-mesenchymal transition: at the crossroads of development and tumor metastasis Dev Cell 14:818-29 Cotter T G (2009) Apoptosis and cancer: the genesis of a research field Nat Rev Cancer 9:501-7 Grossmann J (2002) Molecular mechanisms of "detachment-induced apoptosis-Anoikis" Apoptosis 7:247-60 Chiarugi P, Giannoni E (2008) Anoikis: a necessary death program for anchoragedependent cells Biochem Pharmacol 76:1352-64 Reddig P J, Juliano R L (2005) Clinging to life: cell to matrix adhesion and cell survival Cancer Metastasis Rev 24:425-39 Rich T, Allen R L, Wyllie A H (2000) Defying death after DNA damage Nature 407:777-83 Hanahan D, Folkman J (1996) Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis Cell 86:353-64 Chambers A F, Groom A C, MacDonald I C (2002) Dissemination and growth of cancer cells in metastatic sites Nat Rev Cancer 2:563-72 Klein C A (2009) Parallel progression of primary tumours and metastases Nat Rev Cancer 9:302-12 Holmgren L, O'Reilly M S, Folkman J (1995) Dormancy of micrometastases: balanced proliferation and apoptosis in the presence of angiogenesis suppression Nat Med 1:14953 Naumov G N, MacDonald I C, Weinmeister P M, Kerkvliet N, Nadkarni K V, Wilson S M, Morris V L, Groom A C, Chambers A F (2002) Persistence of solitary mammary carcinoma cells in a secondary site: a possible contributor to dormancy Cancer Res 62:2162-8 Paget S (1989) The distribution of secondary growths in cancer of the breast 1889 Cancer Metastasis Rev 8:98-101 Johnson L N (2009) The regulation of protein phosphorylation Biochem Soc Trans 37:627-41 Alberts B, Molecular biology of the cell 5th ed 2008, New York: Garland Science 1268 p Olsen J V, Blagoev B, Gnad F, Macek B, Kumar C, Mortensen P, Mann M (2006) Global, in vivo, and site-specific phosphorylation dynamics in signaling networks Cell 127:635-48 62   22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 Downward J, Parker P, Waterfield M D (1984) Autophosphorylation sites on the epidermal growth factor receptor Nature 311:483-5 Parsons S J, Parsons J T (2004) Src family kinases, key regulators of signal transduction Oncogene 23:7906-9 Playford M P, Schaller M D (2004) The interplay between Src and integrins in normal and tumor biology Oncogene 23:7928-46 Manning B D, Cantley L C (2007) AKT/PKB signaling: navigating downstream Cell 129:1261-74 Wang W Q, Sun J P, Zhang Z Y (2003) An overview of the protein tyrosine phosphatase superfamily Curr Top Med Chem 3:739-48 Tonks N K, Neel B G (1996) From form to function: signaling by protein tyrosine phosphatases Cell 87:365-8 Denu J M, Stuckey J A, Saper M A, Dixon J E (1996) Form and function in protein dephosphorylation Cell 87:361-4 Tonks N K (2006) Protein tyrosine phosphatases: from genes, to function, to disease Nat Rev Mol Cell Biol 7:833-46 Flint A J, Tiganis T, Barford D, Tonks N K (1997) Development of "substrate-trapping" mutants to identify physiological substrates of protein tyrosine phosphatases Proc Natl Acad Sci U S A 94:1680-5 Di Cristofano A, Pandolfi P P (2000) The multiple roles of PTEN in tumor suppression Cell 100:387-90 Puc J, Keniry M, Li H S, Pandita T K, Choudhury A D, Memeo L, Mansukhani M, Murty V V, Gaciong Z, Meek S E, Piwnica-Worms H, Hibshoosh H, Parsons R (2005) Lack of PTEN sequesters CHK1 and initiates genetic instability Cancer Cell 7:193-204 Mohn K L, Laz T M, Hsu J C, Melby A E, Bravo R, Taub R (1991) The immediate-early growth response in regenerating liver and insulin-stimulated H-35 cells: comparison with serum-stimulated 3T3 cells and identification of 41 novel immediate-early genes Mol Cell Biol 11:381-90 Diamond R H, Cressman D E, Laz T M, Abrams C S, Taub R (1994) PRL-1, a unique nuclear protein tyrosine phosphatase, affects cell growth Mol Cell Biol 14:3752-62 Cates C A, Michael R L, Stayrook K R, Harvey K A, Burke Y D, Randall S K, Crowell P L, Crowell D N (1996) Prenylation of oncogenic human PTP(CAAX) protein tyrosine phosphatases Cancer Lett 110:49-55 Zeng Q, Hong W, Tan Y H (1998) Mouse PRL-2 and PRL-3, two potentially prenylated protein tyrosine phosphatases homologous to PRL-1 Biochem Biophys Res Commun 244:421-7 Sun J P, Wang W Q, Yang H, Liu S, Liang F, Fedorov A A, Almo S C, Zhang Z Y (2005) Structure and biochemical properties of PRL-1, a phosphatase implicated in cell growth, differentiation, and tumor invasion Biochemistry 44:12009-21 Kim K A, Song J S, Jee J, Sheen M R, Lee C, Lee T G, Ro S, Cho J M, Lee W, Yamazaki T, Jeon Y H, Cheong C (2004) Structure of human PRL-3, the phosphatase associated with cancer metastasis FEBS Lett 565:181-7 Dumaual C M, Sandusky G E, Crowell P L, Randall S K (2006) Cellular localization of PRL-1 and PRL-2 gene expression in normal adult human tissues J Histochem Cytochem 54:1401-12 63   40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 Zeng Q, Si X, Horstmann H, Xu Y, Hong W, Pallen C J (2000) Prenylation-dependent association of protein-tyrosine phosphatases PRL-1, -2, and -3 with the plasma membrane and the early endosome J Biol Chem 275:21444-52 Sun J P, Luo Y, Yu X, Wang W Q, Zhou B, Liang F, Zhang Z Y (2007) Phosphatase activity, trimerization, and the C-terminal polybasic region are all required for PRL1mediated cell growth and migration J Biol Chem 282:29043-51 Bessette D C, Qiu D, Pallen C J (2008) PRL PTPs: mediators and markers of cancer progression Cancer Metastasis Rev 27:231-52 Saha S, Bardelli A, Buckhaults P, Velculescu V E, Rago C, St Croix B, Romans K E, Choti M A, Lengauer C, Kinzler K W, Vogelstein B (2001) A phosphatase associated with metastasis of colorectal cancer Science 294:1343-6 Kato H, Semba S, Miskad U A, Seo Y, Kasuga M, Yokozaki H (2004) High expression of PRL-3 promotes cancer cell motility and liver metastasis in human colorectal cancer: a predictive molecular marker of metachronous liver and lung metastases Clin Cancer Res 10:7318-28 Li J, Guo K, Koh V W, Tang J P, Gan B Q, Shi H, Li H X, Zeng Q (2005) Generation of PRL-3- and PRL-1-specific monoclonal antibodies as potential diagnostic markers for cancer metastases Clin Cancer Res 11:2195-204 Peng L, Ning J, Meng L, Shou C (2004) The association of the expression level of protein tyrosine phosphatase PRL-3 protein with liver metastasis and prognosis of patients with colorectal cancer J Cancer Res Clin Oncol 130:521-6 Radke I, Gotte M, Kersting C, Mattsson B, Kiesel L, Wulfing P (2006) Expression and prognostic impact of the protein tyrosine phosphatases PRL-1, PRL-2, and PRL-3 in breast cancer Br J Cancer 95:347-54 Wang L, Peng L, Dong B, Kong L, Meng L, Yan L, Xie Y, Shou C (2006) Overexpression of phosphatase of regenerating liver-3 in breast cancer: association with a poor clinical outcome Ann Oncol 17:1517-22 Miskad U A, Semba S, Kato H, Yokozaki H (2004) Expression of PRL-3 phosphatase in human gastric carcinomas: close correlation with invasion and metastasis Pathobiology 71:176-84 Li Z R, Wang Z, Zhu B H, He Y L, Peng J S, Cai S R, Ma J P, Zhan W H (2007) Association of tyrosine PRL-3 phosphatase protein expression with peritoneal metastasis of gastric carcinoma and prognosis Surg Today 37:646-51 Wu X, Zeng H, Zhang X, Zhao Y, Sha H, Ge X, Zhang M, Gao X, Xu Q (2004) Phosphatase of regenerating liver-3 promotes motility and metastasis of mouse melanoma cells Am J Pathol 164:2039-54 Yamashita S, Masuda Y, Matsumoto K, Okumura Y, Matsuzaki H, Kurizaki T, Haga Y, Katafuchi S, Murayama T, Ikei S, Kawahara K (2007) Down-regulation of the human PRL-3 gene is associated with the metastasis of primary non-small cell lung cancer Ann Thorac Cardiovasc Surg 13:236-9 Zhou J, Wang S, Lu J, Li J, Ding Y (2009) Over-expression of phosphatase of regenerating liver-3 correlates with tumor progression and poor prognosis in nasopharyngeal carcinoma Int J Cancer 124:1879-86 Zeng Q, Dong J M, Guo K, Li J, Tan H X, Koh V, Pallen C J, Manser E, Hong W (2003) PRL-3 and PRL-1 promote cell migration, invasion, and metastasis Cancer Res 63:271622 64   55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 Guo K, Li J, Tang J P, Koh V, Gan B Q, Zeng Q (2004) Catalytic domain of PRL-3 plays an essential role in tumor metastasis: formation of PRL-3 tumors inside the blood vessels Cancer Biol Ther 3:945-51 Guo K, Li J, Wang H, Osato M, Tang J P, Quah S Y, Gan B Q, Zeng Q (2006) PRL-3 initiates tumor angiogenesis by recruiting endothelial cells in vitro and in vivo Cancer Res 66:9625-35 Wang H, Quah S Y, Dong J M, Manser E, Tang J P, Zeng Q (2007) PRL-3 downregulates PTEN expression and signals through PI3K to promote epithelial-mesenchymal transition Cancer Res 67:2922-6 Giancotti F G, Tarone G (2003) Positional control of cell fate through joint integrin/receptor protein kinase signaling Annu Rev Cell Dev Biol 19:173-206 Peng L, Jin G, Wang L, Guo J, Meng L, Shou C (2006) Identification of integrin alpha1 as an interacting protein of protein tyrosine phosphatase PRL-3 Biochem Biophys Res Commun 342:179-83 Liang F, Liang J, Wang W Q, Sun J P, Udho E, Zhang Z Y (2007) PRL3 promotes cell invasion and proliferation by down-regulation of Csk leading to Src activation J Biol Chem 282:5413-9 Fiordalisi J J, Keller P J, Cox A D (2006) PRL tyrosine phosphatases regulate rho family GTPases to promote invasion and motility Cancer Res 66:3153-61 Bretscher A, Edwards K, Fehon R G (2002) ERM proteins and merlin: integrators at the cell cortex Nat Rev Mol Cell Biol 3:586-99 Forte E, Orsatti L, Talamo F, Barbato G, De Francesco R, Tomei L (2008) Ezrin is a specific and direct target of protein tyrosine phosphatase PRL-3 Biochim Biophys Acta 1783:334-44 Srivastava J, Elliott B E, Louvard D, Arpin M (2005) Src-dependent ezrin phosphorylation in adhesion-mediated signaling Mol Biol Cell 16:1481-90 Ivetic A, Ridley A J (2004) Ezrin/radixin/moesin proteins and Rho GTPase signalling in leucocytes Immunology 112:165-76 Stephens B J, Han H, Gokhale V, Von Hoff D D (2005) PRL phosphatases as potential molecular targets in cancer Mol Cancer Ther 4:1653-61 Pathak M K, Dhawan D, Lindner D J, Borden E C, Farver C, Yi T (2002) Pentamidine is an inhibitor of PRL phosphatases with anticancer activity Mol Cancer Ther 1:1255-64 Ahn J H, Kim S J, Park W S, Cho S Y, Ha J D, Kim S S, Kang S K, Jeong D G, Jung S K, Lee S H, Kim H M, Park S K, Lee K H, Lee C W, Ryu S E, Choi J K (2006) Synthesis and biological evaluation of rhodanine derivatives as PRL-3 inhibitors Bioorg Med Chem Lett 16:2996-9 Choi S K, Oh H M, Lee S K, Jeong D G, Ryu S E, Son K H, Han D C, Sung N D, Baek N I, Kwon B M (2006) Biflavonoids inhibited phosphatase of regenerating liver-3 (PRL3) Nat Prod Res 20:341-6 Guo K, Tang J P, Tan C P, Wang H, Zeng Q (2008) Monoclonal antibodies target intracellular PRL phosphatases to inhibit cancer metastases in mice Cancer Biol Ther 7:750-7 Christiansen J J, Rajasekaran A K (2006) Reassessing epithelial to mesenchymal transition as a prerequisite for carcinoma invasion and metastasis Cancer Res 66:831926 65   72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 Turner C E, Miller J T (1994) Primary sequence of paxillin contains putative SH2 and SH3 domain binding motifs and multiple LIM domains: identification of a vinculin and pp125Fak-binding region J Cell Sci 107 ( Pt 6):1583-91 Thiery J P, Sleeman J P (2006) Complex networks orchestrate epithelial-mesenchymal transitions Nat Rev Mol Cell Biol 7:131-42 Aberle H, Schwartz H, Kemler R (1996) Cadherin-catenin complex: protein interactions and their implications for cadherin function J Cell Biochem 61:514-23 Lee J M, Dedhar S, Kalluri R, Thompson E W (2006) The epithelial-mesenchymal transition: new insights in signaling, development, and disease J Cell Biol 172:973-81 Ridley A J, Schwartz M A, Burridge K, Firtel R A, Ginsberg M H, Borisy G, Parsons J T, Horwitz A R (2003) Cell migration: integrating signals from front to back Science 302:1704-9 Moustakas A, Heldin C H (2007) Signaling networks guiding epithelial-mesenchymal transitions during embryogenesis and cancer progression Cancer Sci 98:1512-20 Basak S, Jacobs S B, Krieg A J, Pathak N, Zeng Q, Kaldis P, Giaccia A J, Attardi L D (2008) The metastasis-associated gene Prl-3 is a p53 target involved in cell-cycle regulation Mol Cell 30:303-14 Hinds P W (2008) Too much of a good thing: the Prl-3 in p53's oyster Mol Cell 30:2601 Werner S R, Lee P A, DeCamp M W, Crowell D N, Randall S K, Crowell P L (2003) Enhanced cell cycle progression and down regulation of p21(Cip1/Waf1) by PRL tyrosine phosphatases Cancer Lett 202:201-11 Frisch S M, Ruoslahti E (1997) Integrins and anoikis Curr Opin Cell Biol 9:701-6 Kandel E S, Skeen J, Majewski N, Di Cristofano A, Pandolfi P P, Feliciano C S, Gartel A, Hay N (2002) Activation of Akt/protein kinase B overcomes a G(2)/m cell cycle checkpoint induced by DNA damage Mol Cell Biol 22:7831-41 Fouquet S, Lugo-Martinez V H, Faussat A M, Renaud F, Cardot P, Chambaz J, PinconRaymond M, Thenet S (2004) Early loss of E-cadherin from cell-cell contacts is involved in the onset of Anoikis in enterocytes J Biol Chem 279:43061-9 Hollander M C, Sheikh M S, Yu K, Zhan Q, Iglesias M, Woodworth C, Fornace A J, Jr (2001) Activation of Gadd34 by diverse apoptotic signals and suppression of its growth inhibitory effects by apoptotic inhibitors Int J Cancer 96:22-31 Grishin A V, Azhipa O, Semenov I, Corey S J (2001) Interaction between growth arrestDNA damage protein 34 and Src kinase Lyn negatively regulates genotoxic apoptosis Proc Natl Acad Sci U S A 98:10172-7 Yagi A, Hasegawa Y, Xiao H, Haneda M, Kojima E, Nishikimi A, Hasegawa T, Shimokata K, Isobe K (2003) GADD34 induces p53 phosphorylation and p21/WAF1 transcription J Cell Biochem 90:1242-9 Ren X D, Kiosses W B, Schwartz M A (1999) Regulation of the small GTP-binding protein Rho by cell adhesion and the cytoskeleton EMBO J 18:578-85 Vermes I, Haanen C, Steffens-Nakken H, Reutelingsperger C (1995) A novel assay for apoptosis Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin V J Immunol Methods 184:39-51 Zhang G, Gurtu V, Kain S R, Yan G (1997) Early detection of apoptosis using a fluorescent conjugate of annexin V Biotechniques 23:525-31 66   90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 van Engeland M, Nieland L J, Ramaekers F C, Schutte B, Reutelingsperger C P (1998) Annexin V-affinity assay: a review on an apoptosis detection system based on phosphatidylserine exposure Cytometry 31:1-9 Schaller M D (2001) Paxillin: a focal adhesion-associated adaptor protein Oncogene 20:6459-72 Hall A (2005) Rho GTPases and the control of cell behaviour Biochem Soc Trans 33:891-5 Jaffe A B, Hall A (2005) Rho GTPases: biochemistry and biology Annu Rev Cell Dev Biol 21:247-69 Kotani H, Takaishi K, Sasaki T, Takai Y (1997) Rho regulates association of both the ERM family and vinculin with the plasma membrane in MDCK cells Oncogene 14:1705-13 Pankov R, Endo Y, Even-Ram S, Araki M, Clark K, Cukierman E, Matsumoto K, Yamada K M (2005) A Rac switch regulates random versus directionally persistent cell migration J Cell Biol 170:793-802 Schlessinger K, Hall A (2004) GSK-3beta sets Snail's pace Nat Cell Biol 6:913-5 Zhou B P, Deng J, Xia W, Xu J, Li Y M, Gunduz M, Hung M C (2004) Dual regulation of Snail by GSK-3beta-mediated phosphorylation in control of epithelial-mesenchymal transition Nat Cell Biol 6:931-40 Cully M, You H, Levine A J, Mak T W (2006) Beyond PTEN mutations: the PI3K pathway as an integrator of multiple inputs during tumorigenesis Nat Rev Cancer 6:18492 Subauste M C, Nalbant P, Adamson E D, Hahn K M (2005) Vinculin controls PTEN protein level by maintaining the interaction of the adherens junction protein beta-catenin with the scaffolding protein MAGI-2 J Biol Chem 280:5676-81 Fukata M, Nakagawa M, Kaibuchi K (2003) Roles of Rho-family GTPases in cell polarisation and directional migration Curr Opin Cell Biol 15:590-7 Li Z, Dong X, Wang Z, Liu W, Deng N, Ding Y, Tang L, Hla T, Zeng R, Li L, Wu D (2005) Regulation of PTEN by Rho small GTPases Nat Cell Biol 7:399-404 Fornari F A, Randolph J K, Yalowich J C, Ritke M K, Gewirtz D A (1994) Interference by doxorubicin with DNA unwinding in MCF-7 breast tumor cells Mol Pharmacol 45:649-56 Lundin C, North M, Erixon K, Walters K, Jenssen D, Goldman A S, Helleday T (2005) Methyl methanesulfonate (MMS) produces heat-labile DNA damage but no detectable in vivo DNA double-strand breaks Nucleic Acids Res 33:3799-811 Novoa I, Zeng H, Harding H P, Ron D (2001) Feedback inhibition of the unfolded protein response by GADD34-mediated dephosphorylation of eIF2alpha J Cell Biol 153:1011-22 Hollander M C, Poola-Kella S, Fornace A J, Jr (2003) Gadd34 functional domains involved in growth suppression and apoptosis Oncogene 22:3827-32 [cited; Available from: http://scansite.mit.edu/ 67   ... …………………………………………41 3. 2 PRL- 3 Confers Resistance to Apoptosis and Up-regulates GADD34 Phosphorylation 3. 2.1 PRL- 3 confers resistance to apoptosis 43 3.2.2 PRL- 3 up-regulates GADD34 tyrosine... cells and drive cancer metastasis 42   Chapter 3. 2 PRL- 3 Confers Resistance to Apoptosis and Up-Regulates GADD34 Phosphorylation 3. 2.1 PRL- 3 Confers Resistance to Apoptosis A MCF7 -PRL- 3 (C104S)... (5’tccaccaccctgttgctgta -3? ??) 33   Chapter Results and Discussion 3. 1 PRL- 3 Promotes Epithelial- Mesenchymal Transition 3. 1.1 PRL- 3 Reduces Paxillin, Phosphorylated Paxillin-Tyr31 and Vinculin Adhesion