THERAPEUTICS AND DRUG DESIGN AGAINST INFECTIOUS DISEASES USING SYNTHETIC ENZYMOLOGY AISHWARYA. S NATIONAL UNIVERSITY OF SINGAPORE 2013 THERAPEUTICS AND DRUG DESIGN AGAINST INFECTIOUS DISEASES USING SYNTHETIC ENZYMOLOGY AISHWARYA. S M.SC (DUAL), SRM UNIVERSITY, INDIA A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF BIOCHEMISTRY NATIONAL UNIVERSITY OF SINGAPORE 2013 DECLARATION I hereby declare that the thesis is my original work and it has been written by me in its entirety. I have duly acknowledged all the sources of information which have been used in the thesis. This thesis is also not been submitted for any degree in any university previously. Aishwarya. S 12 February 2013 Acknowledgement First and foremost, I would like to thank my supervisor Dr. Yew Wen Shan, for his guidance and support throughout this lengthy undertaking. He has been a great support for me throughout. I am grateful to the National University of Singapore for providing me the Graduate Research Scholarship throughout my candidature. Many a thanks to the past and present members of Biochemistry department and the lab members for their various advice, assistance, entertainment and for creating a great working environment throughout my stint at NUS. I would also like to thank Prof. K. Swaminathan who helped me with his suggestions on my thesis. Finally thanks to my family and friends for their love, support and forbearance. Table of contents: Acknowledgements Table of contents List of tables and graphs List of figures Abstract PART 1: Towards the development of inhibitor against the Shikimate pathway enzyme, 3-dehydroquinate synthase from Enterococcus faecalis (EfaroB) 1. Introduction 1.1 Drug Resistance- A serious threat 2 1.2 Enzymes in the Shikimate pathway 3 1.3 Essentiality of Shikimate pathway 4 1.4 Shikimate pathway as a viable drug target 6 1.5 Known inhibitors of the pathway 7 1.6 Specific aims of the project 8 1.7 Enterococcus faecalis- A clinical pathogen 8 1.8 Enzyme mechanism catalyzed by DHQS from Enterococcus faecalis 9 1.9 Natural products as EfaroB inhibitors i|Page 2 10 2. Materials and Methods 11 2.1 Materials 11 2.2 Cloning protocol 11 2.3 Production of electrocompetent cells 12 2.4 Protein Expression and purification 13 2.5 Cloning, expression and purification of Dehydroquinate Synthase (DHQS) from Enterococcus fecalis (EFaroB) 3. 4. 14 2.6 Coupled enzyme Assays of EFaroB and EFaroF 14 2.7 Identification of potential inhibitors of aroB 15 Results for EfaroB purification 17 3.1 SDS-PAGE 17 3.2 Assay Results of EfaroB 18 3.3 Screening for inhibitors 18 Cloning and expression of enzymes for combinatorial biosynthesis 19 4.1. Combinatorial Biosynthesis 19 4.2 Enzymes for combinatorial biosynthesis 19 4.2.1 Chalcone isomerases 20 4.2.1.1 Amplification of Chalcone isomerases from Arabidopsis 20 4.2.1.2 Cloning of Chalcone isomerases 20 4.2.1.3 Expression and Solubility Screening Studies 20 4.3 DMR6 4.3.1 Cloning, Expression and Screening for solubility in DMR6 21 21 4.3.2 Enhancing solubility using β-galactosidase α-complementation 22 ii | P a g e 4.4.1 LDOX 23 4.4.2 Methods 24 4.4.2.1 Amplification and Cloning 24 4.4.2.2 Expression of LDOX in pET15b 24 4.5.1 Hydroxy cinnamoyl transferases (HCT) 24 4.5.2 Amplification and Cloning in to Tom15b 25 5. Results and Discussion 26 5.1 Chalcone Isomerases 26 5.2 Results of DMR6 32 5.3 Cloning results of HCT 41 6. Conclusion 43 7. Future work 45 PART 2: Elucidating the mechanism of OMPDC-catalyzed reaction on a KGPDCscaffold 8. Introduction 48 8.1 Opportunistic enzyme evolution 49 8.2 Functionally diverse enzyme suprafamilies 49 iii | P a g e 8.2.1 3-ketogulonate 6-phosphate decarboxylase (KGPDC) 50 8.2.2 D-arabino-Hex-3-ulose 6-phosphate synthase (HPS) 52 8.2.3 D-ribulose 5-phosphate 3-epimerase (RPE) 53 8.3Beta-alpha barrel 9. Orotidine-5’-monophosphate decarboxylase (OMPDC) 54 56 9.1 Introduction 56 9.2 Structural information of OMPDC 57 9.3 Proposed Mechanisms of Catalysis of OMPDC- catalyzed reactions 58 9.4 Aim of our project 64 9.5 Our hypothesis for the mechanism of OMPDC-catalyzed reaction 64 9.5 Selection of KGPDC as a template to expound the mechanism of OMPDC-catalyzed reaction 10. Materials and Methods 65 70 10.1 Site-Directed mutagenesis 70 10.2 OMPDC-negative E.coli selection strain (WSY102) 71 10.3 Transformation of mutants in to WSY102 71 10.4 Complementation growth Studies 71 10.5 Purification of Methanobacter OMPDC 72 11. Results 73 11.1 Aerobic growth curves 73 11.1.1 Complementation growth curve of Wildtype MtOMPDC in auxotrophic strain (WSY102) 11.1.2 Complementation of growth in KGPDC mutants 11.1.2.1 Results of E33K single mutants of KGPDC 73 74 74 11.1.2.2 Results of E33K/W117S double mutants of KGPDC 76 11.1.2.3 Results of W117S/G171Q double mutants of KGPDC 77 iv | P a g e 11.1.2.4 Results of E33K/G171Q double mutants of KGPDC 80 11.1.2.5 Results of E33K/W117S/G171Q triple mutant 82 4.2 Results for Purification of MtOMPDC 84 12. Discussion 86 13. Future work 88 PART 3: Targeted Drug Discovery against Plasmodium falciparum 14. Introduction 90 14.1 Aim of the project 90 14.2 Human OMPDC 90 14.3 Plasmodium’s OMPDC 91 14.4 Inhibitors to Plasmodium OMPDC in the past 94 15. Species-specific design of Inhibitor 96 15.1 Differing residues between Plasmodium and Human OMPDC enzymes. 97 16. Discussion 100 17. Future Directions 101 References v|Page 102 List of tables and graphs: Tables: Table 1: showing the mutant list based on the differing active site residues between KGPDC and OMPDC 68 Graphs: 4.1.1 Complementation growth curve of Wildtype MtOMPDC in auxotrophic strain (WSY102) 73 4.1.2.1 Results of E33K single mutants of KGPDC 74 4.1.2.1.a SgaH 74 4.1.2.1.b KEF 75 4.1.2.1.c KSP 75 4.1.2.1.d KST 76 4.1.2.2 Results of E33K/W117S double mutants of KGPDC. 76 4.1.2.3 Results of W117S/G171Q double mutants of KGPDC 77 4.1.2.3.a SgaH 78 4.1.2.3.b KEF: 78 4.1.2.3.c KSP 79 4.1.2.3.d KST 79 4.1.2.4 Results of E33K/G171Q double mutants of KGPDC vi | P a g e 80 4.1.2.4.a SgaH 80 4.1.2.4.b KEF 81 4.1.2.4.c KSP 81 4.1.2.4.d KST 82 4.1.2.5 Results of E33K/W117S/G171Q triple mutant: 82 4.1.2.5.a SgaH 83 4.1.2.5.b KEF 83 4.1.2.5.c KST 84 vii | P a g e List of figures: Part 1: Towards the development of inhibitor against the Shikimate pathway enzyme, 3-dehydroquinate synthase 1.1: The seven step reaction catalyzed by Shikimate Pathway. 4 1.2: The end product of the Shikimate pathway, Chorismate branches in to a number of secondary metabolites. 6 1.3: Inhibitors of Shikimate pathway enzymes 8 1.4: Reaction catalyzed by 3-dehydroquinate synthase (aroB). 10 2.1: Coupled enzyme assay for EFaroB. 15 3.1: SDS-PAGE for large scale purification of EFaroB using Tom15b vector. 17 4.1: Reaction catalyzed by Leucoanthocyanidin viii | P a g e dioxygenase (LDOX). 23 4.2: Amplification results of LDOX. 24 4.3: Reaction catalyzed by Hydroxy cinnamoyl transferase (HCT). 25 5.1: Isomerization reaction catalyzed by Chalcone Isomerase (CI). 26 5.2: Amplification result of the Chalcone isomerase, CI3. 27 5.3: Amplification result of the dioxygenase, TT5. 27 5.4: Expression results of CI3 in Tom15b and Rosetta2. 28 5.5: Solubility screening of CI3-1 in Tom15b and M9 medium after 1 and 2 hours of induction with 0.5 mM IPTG. 28 5.6: Screening of CI3-2 in Tom15b and M9 medium. 29 5.7: Screening of CI3-3 in Tom15b and M9 medium. 29 5.8: Screening of CI3-4 in Tom15b and M9 medium at 25 ̊ C. 30 5.9: Screening of CI3 in pET20b and M9 medium. 30 5.10: Screening of CI3 in pET20b and M9 medium at 37 ̊ C. 31 5.11: CI3 in pET20b transformed in to BL21 and over-expressed in LB at 37 ̊C. 31 5.12: CI3 in pET20b and Rosetta2 induced with 0.5mM IPTG. 32 5.13: Amplification results of DMR6 gene. 33 5.14: DMR6 cloned in to Tom15b vector and the extracted plasmid was amplified using T7 pro and T7 term primers before sending for sequencing. ix | P a g e 33 5.15: Amplification of the mutated pMALc4xA2 vector. 34 5.16: DMR6 cloned in to pMALc4xA2 vector. 34 5.17: Randomly mutated DMR6. 35 5.18: Solubility Screening of DMR6 in Tom15b at various induction time at 37 ̊ C in M9 minimal medium. 35 5.19: Solubility Screening of DMR6 in Tom15b at various induction time at 37 ̊ C. 36 5.20: Solubility Screening of DMR6 in Tom15b at various induction time at 37 ̊ C and 25 ̊ C . 37 5.21: Over-expression of DMR6-pET20b in BL21. 37 5.22: Nickel affinity purification of DMR6-pET20b. 38 5.23: Solubility screening of DMR6 in Tom15b vector. Screening was performed at 37 ̊ C and 25 ̊ C at different time intervals starting from 1, 2, 3 and 15 hrs induction with M9 minimal medium. 39 5.24: LDOX expression in pET15b vector and BL21 cell lines after induction with 0.5 mM IPTG at 37 ̊ C and 6 hr induction time. 40 5.25: LDOX Expression at 30̊ C with 0.5mM IPTG after 3 hours x|Page induction. 40 5.26: LDOX expression at 18 ̊ C with 0.5mM IPTG. 41 5.27: Figure showing amplification of HCT. 41 5.28: Amplification result of Pseudomonas polyketide synthase, PhID. 42 Part 2: Elucidating the mechanism of OMPDC-catalyzed reaction on a KGPDC-scaffold 8.1: Reaction catalyzed by KGPDC through the formation of an enediolate intermediate. 51 8.2: Figure showing KGPDC from E. coli. 51 8.3: Reaction catalyzed by HPS shows that the reaction mechanism is similar to the KGPDC in that both requires a metal ion for the catalytic activity. 52 8.4: Reaction catalyzed by RPE. 53 8.5: Crystal structure of RPE obtained from PDB (1RPX) displaying a classical (β/α)8-barrel fold. 55 9.1: Reaction catalyzed by OMPDC shows that the substrate OMP is converted in to UMP through the formation of vinyl carbanion intermediate. 56 9.2: OMPDC of Methanobacter thermoautotrophicum. 58 9.3: Different mechanistic proposals for the reaction xi | P a g e catalyzed by OMPDC. 61 9.4 : The paradigm of Directed Evolution of enzymes. Iterative rounds of mutation and selection will give rise to the target enzyme. 62 9.5: Figure to demonstrate the hypothesis of an OMPDC-catalyzed reaction through the formation of vinyl carbanion intermediate. 66 9.6: Structural Superimposition of Methanobacter OMPDC and E.coli KGPDC. 67 9.7: Superimposed structures of OMPDC and KGPDC showing conserved active site residues. 67 9.8: Sequence alignment of KGPDC and OMPDC orthologues. 69 11.5 Purification of Methanobacter OMPDC at 37 ̊C. 85 Part 3: Targeted Drug Discovery against Plasmodium falciparum 14.1: Human UMPS (OMPDC-containing domain) showing active site xii | P a g e architecture. 91 14.2: Structure of Plasmodium OMPDC (2FFC) bound to UMP. 93 14.3: Close up snapshot of Plasmodium OMPDC bound to UMP. 94 14.4: Chemical structures of inhibitors used in the study of OMPDC. 95 15.1: Human and Plasmodium OMPDC differing catalytic residues. 98 15.2: Sequence alignment of OMPDC from different organisms shows a conserved DKD motif. xiii | P a g e 99 Abstract A number of infectious diseases are known to be caused by microorganisms resulting in death and impairment. Understanding the principle behind the emergence of the disease and the reason for the multi-drug resistance of these pathogenic microorganisms is crucial, in order to develop an anti-infective against these pathogens. Our work was to develop an antimicrobial drug against a Shikimate pathway enzyme and to design inhibitors against the Plasmodium parasite’s Orotidine 5’-monophosphate decarboxylase (OMPDC) enzyme. We also attempted to decipher the OMPDC-catalyzed mechanism on a 3-keto-L-gulonate 6-phosphate decarboxylase (KGPDC) scaffold, as a means of understanding the mechanism in detail. In the first part of the thesis, the enzyme 3-dehydroquinate synthase from Enterococcus faecalis was expressed and purified and tested for its activity. A number of modifying enzymes were also cloned, and attempts were made to express and purify them, for use in the modification of side chains of the inhibitors in the process of combinatorial biosynthesis. The second part of the thesis was a two-pronged approach, where, initially we attempted to understand the mechanism catalyzed by OMPDC by replicating it on the scaffold of its related suprafamily member, KGPDC. By understanding the mechanism, we hoped to develop inhibitors against the OMPDC enzyme of the pathogens. Complementation growth studies were performed and the aerobic growth curves were plotted. In the last part of the thesis, we tried to find the disparity between the human and Plasmodium’s OMPDC enzymes with which we looked forward to a rational design of an inhibitor against Plasmodium OMPDC, hoping that this inhibitor might have a minimal side-effect on the human host if it is developed in to a drug. We found a number of key residues that were distinct between the human host and the pathogen and we propose that if these differing residues can be targeted to develop an efficient drug against the Plasmodium OMPDC enzyme, consequently, the drug might have a minimal attack if administered to the host. xiv | P a g e Abbreviations: PEP Phosphoenol pyruate DAHP 3-deoxy-D-arabino-heptulosonate 7-phosphate ESPS 5-enolpyruvyl shikimate-3-phosphate synthase EfaroB 3-dehydroquinate synthase from Enterococcus fecalis DHQS 3-dehydroquinate synthase VRE Vancomycin resistant Enterococcus NAD+ Nicotinamide adenine dinucleotide NADH Nicotinamide adenine dinucleotide reduced Zn 2+ Zinc Co 2+ Cobalt PCR Polymerase chain reaction CIAP Calf intestine Alkaline phosphatase NEB New England Biolabs dNTP deoxy nucleotide triphosphate IPTG Isopropyl β-D-1-thiogalactopyranoside INT Indole-nitrotetrazolium violet DMF Dimethyl formamide SDS Sodium dodecyl sulphate PAGE polyacrylamide gel electrophoresis ONPG O-nitrophenyl- β-D-galactopyranoside OMPDC Orotidine-5’-monophosphate decarboxylase KGPDC 3-keto L-gulonate 6-phosphate decarboxylase HPS D-arabino-hex-3-ulose 6-phosphate synthase RPE D-ribulose 5-phosphate 3-epimerase OMP Orotidine -5’-monophosphate UMP Uridine 5’-monophosphate BMP 6-hydroxy UMP FUMP 5-fluoro UMP FOMP 5-fluoro OMP EO 1-(erythrofuranosyl) orotic acid OPRT orotate phosphoribosyltransferase Aza-UMP 6-azauridine 5'-monophosphate Part 1: Towards the development of inhibitors against the Shikimate pathway enzyme, 3-dehydroquinate synthase 1 Chapter 1: Introduction 1.1 Drug Resistance- A serious threat Antibacterial agents are compounds that either halt or completely inhibit the growth of bacteria. Although there are several antimicrobials developed against the pathogenic species, the growing number of multi-drug resistant pathogens poses a serious health threat to humans. There is a pressing need for new drugs to be developed against these emerging drug-resistant microorganisms. The microbes exhibit various modes of drug resistance [56], such as: 1) Drug inactivation or modification. 2) Alteration of target site. 3) Alteration of metabolic pathway. 4) Reduced drug accumulation. [1] An important research interest centers on bringing about the alteration in bacterial growth, which can be accomplished by modulating the flux of biochemical pathways, which in turn result in a cascade of events leading to stasis or complete disruption of cell function and growth. One such biochemical pathway that serves as an interesting area of research for potential antibacterial and antifungal agents is the Shikimate pathway. The enzymes of the Shikimate pathway are the prime targets for drug design as the pathway is essential in plants and microbes, but absent in humans, consequently reducing the risk of potential adverse effects from drugs that inhibit this pathway. 2 1.2 Enzymes in the shikimate pathway The Shikimate pathway comprises of seven enzymatic steps, ultimately, giving rise to the precursors of the aromatic amino acids such as phenylalanine, tyrosine and tryptophan [2]. The biosynthesis of these amino acids is vital for the homeostasis of various plants, fungi and bacteria [3]. In addition, this biochemical pathway generates aromatic precursors essential for folic acid (p-aminobenzoic acid) and ubiquinone production [4]. A total of seven enzymes are responsible for the conversion of phosphoenol pyruate (PEP) and erythrose 4-phosphate (E4P) to chorismate (Figure 1.1). Chorismate plays a key role as it branches in to three pathways (Figure 1.2) - the first pathway leading to the biosynthesis of phenylalanine and tyrosine, the second pathway leading to tryptophan biosynthesis and the third pathway leading to folate and ubiquinone biosynthesis[2]. The first step of the shikimate pathway comprises of the condensation of the glycolytic intermediate, Phosphoenol pyruate (PEP), a three-carbon compound and the Pentose Phosphate pathway intermediate, D-erythrose 4-phosphate, a four-carbon compound to give rise to a sevencarbon 6-membered heterocyclic compound, 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP). In the second step, the ring oxygen is exchanged for the exocyclic C7 of DAHP to form a highly substituted cyclohexane derivative (Garner & Hermann, 1984), 3-dehydroquinate [3]. The remaining five steps serve to introduce a side chain and 2 double bonds to the cyclohexane ring. The end product of the Shikimate pathway, Chorismate, becomes a precursor substrate for various primary and secondary metabolites through a series of anabolic catalytic sequences. 3 Figure 1.1: The seven enzymatic reactions of the Shikimate Pathway. The condensation reaction between PEP and D-erythrose 4-phosphate culminates in chorismate production. 1.3 Essentiality of the shikimate pathway These aromatic amino acids not only serve as structural units of proteins, but also in turn, serve as precursors to a range of secondary metabolites with aromatic ring structures, including flavonoids, Vitamin K and lignin [3]. In plants, this pathway provides precursors for the biosynthesis of various polyketides such as chalcones, stilbenes and flavonoids. These plant polyketides are bioactive plant secondary metabolites that have a number of biological 4 reactivities, including anti-microbial, anti-inflammatory, and anti-cancer activities; many of these metabolites act as phytoalexins, plant antibiotics that target crucial metabolic pathways of disease producing microbial pathogens. Natural product libraries can be used to screen for effective lead compounds in the process of drug discovery and development. Primary metabolites such as quinones, which are an essential components in the Electron Transport Chain (ETC), are derived from Chorismate metabolism. In addition, signaling molecules such as phenyl propanoids are some of the products derived downstream of the reaction. It is therefore apparent that the shikimate pathway is crucial and vital for the survival of bacteria, fungi, apicomplexan parasites and plants [3]. 5 Figure 1.2: Metabolic fates of Chorismate. The end product of the Shikimate pathway, Chorismate, branches in to a number of secondary metabolites as shown in the above schematic representation [2, 3]. 1.4 Shikimate pathway as a viable drug target The Shikimate pathway’s exclusivity and essentiality in bacteria, plants and fungi has been one of the key rationales for choosing this pathway as a target for the design of herbicides and antimicrobial compounds. It was suggested by Hermann and Weaver (1999) that the absence 6 of this pathway in humans might minimize unwanted side-effects on humans, should the inhibitors against the Shikimate pathway be developed as drugs or therapeutics [5]. An interesting fact about this pathway is that unlike other pathways, there is no individual enzyme that can be termed “crucial” and that, all the enzymes are required for the microorganisms and plants bearing the pathway. In spite of the fact that this pathway can be used as a viable target for drug design, there are no known inhibitors, except for the commercial herbicide, Glyphosate. Glyphosate targets the sixth enzyme, 5-enolpyruvyl shikimate-3phosphate synthase (ESPS), catalyzing the conversion of Shikimate 3-phosphate to 5enolpyruvyl shikimate-3-phosphate. Thus, one of the aims of our project centers on the biosynthesis of inhibitors targeting the enzyme 3-dehydroquinate synthase (DHQS) from the microorganism Enterococcus faecalis (EfaroB), in the Shikimate pathway. 1.5 Known inhibitors of the pathway Previously, various studies have been reported by researchers targeting the Shikimate pathway as a potential novel drug target, including the drug resistant Mycobacterium tuberculosis [6] which causes tuberculosis; Helicobacter pylori, the causative agent of gastric cancer [7, 8] and gastrointestinal illness; Bacillus antharacis [9], the pathogen of Anthrax acute disease; and the apicomplexan parasite Plasmodium falciparum, which causes the life threatening malarial fever [10]. Although many drug targets have been identified, very few targets have been successfully inhibited. A few identified inhibitors of the Shikimate pathway are shown in Figure 1.3. 7 Figure 1.3: Inhibitors of Shikimate pathway enzymes. Inhibitors of DAHP Synthase (DAHPS) are indicated by a and b. Carbaphosphanate which inhibits the 3-dehydroquinate synthase (DHQS), and Glyphosate, the commercially available inhibitor to the first enzyme of the pathway, DAHP Synthase are also illustrated in the figure. 1.6 Specific Aims of the Project The project aims to develop anti-microbial compounds targeting the Shikimate pathway of Enterococcus fecalis, through the combinatorial biosynthesis of novel compounds for further development as inhibitors against the enzymes of Shikimate pathway. 1.7 Enterococcus faecalis- A clinical pathogen Enterococcus fecalis is a gram-positive cocci and a common commensal of the human intestine. This microorganism is noted for its resistance to a number of antibiotics, including vancomycin, the “drug of last resort”; hence this pathogen is also clinically known as Vancomycin-Resistant Enterococcus (VRE). Opportunistic clinical infections caused by this 8 pathogen include UTI (Urinary tract infection), bacteraemia, bacterial endocarditis, diverticulitis and meningitis, sometimes leading to fatality. The high level of antibiotic resistance found in Enterococcus is one factor that might probably contribute to its pathogenicity. 1.8 Enzyme mechanism catalyzed by DHQS from Enterococcus faecalis The focus of this project is on the enzyme 3-dehdyroquinate synthase (DHQS), the enzyme catalyzing the second step in the Shikimate pathway. The EfaroB catalyzes the conversion of 3-deoxy-D-arabino- heptulosone 7-phosphate in to 3-dehydroquinate (fig 1.4). The enzyme requires catalytic amounts of NAD+ and a divalent metal cation for its activity. For the bacterial DHQS enzyme, Co2+ and Zn2+ are required for enzymatic activity. The E. coli enzyme catalyzes a reaction involving an intramolecular oxidation reduction at C5 of DAHP (the substrate of DHQS) with very tight binding of the NAD+ cofactor, the syn- elimination of phosphate, and an alicyclic ring formation. Studies have indicated that the enzyme DHQS catalyzes a redox reaction, with the other identified steps in the overall reaction mechanism proceeding spontaneously. It is also noteworthy that there is no known structural data for the orthologues of this enzyme from Enterococcus fecalis. The EFaroB (Enterococcus fecalis dehydroquinate synthase) has a molecular weight of 39213.8 Da (Protparam). It requires NAD+ as cofactor and divalent metal ions, Zn 2+ and Co 2+ for activity. DHQS is a dimer with two domains in each monomer. DHQS, as supposed, utilizes a complex multi-step mechanism which includes alcohol oxidation, phosphate β-elimination, carbonyl reduction, ring opening and intramolecular aldol condensation (Mary, 2006). Multi-drug resistant Enterococci and vancomycin-resistant Enterococci (VRE), in particular, are opportunistic pathogens and major causes of nosocomial infections in 9 immunocompromised patients. There is currently no known inhibitor targeting the enzyme 3dehydroquinate synthase. Figure 1.4: The 3-dehydroquinate synthase (aroB)-catalyzed reaction. EFaroB converts 3deoxy-D-arabino-heptulosone 7-phosphate to 3-dehydroquinate with the reduction of NAD+ to NADH. 1.9 Natural products as EfaroB inhibitors Screening of natural products for inhibitors was adopted as an initial strategy as this has been proven to be a successful and valuable source of infective agents. Furthermore, screening of natural product libraries usually creates a higher percentage of bioactive hits in comparison to chemical libraries. Finally natural products reveal previously unknown structure-bioactivity relationships (Floss, 2006) [11]. The Flavonoid biosynthetic pathway is one of the best-characterized pathways in plants. This pathway produces the major secondary plant metabolites and many of the flavonoids have been shown to have anti-microbial, antioxidant, anti-inflammatory, and many other beneficial properties [12]. The Flavonoid pathway also serves as an attractive target for metabolic engineering [13]. 10 Chapter 2: Materials and Methods 2.1 Materials All reagents were purchased from Sigma-Aldrich and were of highest quality grade commercially available, unless otherwise stated. Reagents for performing first strand cDNA synthesis and Polymerase chain reaction (PCR) were from Invitrogen. The primers for normal PCR and Quikchange mutagenesis were ordered from Sigma Life sciences. Restriction enzymes and their corresponding buffers were purchased from New England Biolabs (NEB) and Calf intestinal Alkaline Phosphatase (CIAP) was purchased from Promega. The vectors are purchased from Novagen. T4 DNA ligase was purchased from New England Biolabs. The Quikchange mutagenesis kit was purchased from Stratagene. The gel extraction kit and miniprep kit for isolation of plasmid DNA were purchased from Qiagen. 2.2 Cloning protocol A typical PCR mixture (100 µL) contained 1 ng of cDNA, 10 µL of 10X Pfx amplification buffer, 1 mM MgSO4, 0.2 mM of each of the four dNTPs (dATP, dGTP, dCTP, dTTP), 20 pmol of each primer (forward and reverse) and 2.5 U of Pfx DNA polymerase enzyme. The genes were amplified using the following parameters: 94 OC for 2 min, followed by 40 cycles of 94 OC for 1 min, an annealing temperature for 55 OC for 1 min 15 sec, extension at 68 OC for 3 min and a final extension of 68 OC for 10 min. The PCR amplified products were run on a 1% agarose gel and the correct band was excised using a scalpel and subjected to gel purification to extract the pure insert using a Qiagen gel extraction kit. The concentration of the insert was determined by the UV-Vis Spectrophotometer or using GE’s Nanovue TM Spectrophotometer. A double digestion usually follows which can be simultaneous or sequential. 11 In sequential double digestion, a first digestion is performed at 37 OC for 3 hours. This is followed by a quickQIA spin purification using the buffers PB and PE and a purple spin column (Qiagen gel extraction kit). The second digestion can be done at 37 OC for overnight and the double digested reaction mixture is purified with 1% agarose gel electrophoresis and Qiagen gel extraction kit. A similar treatment is applied to the vectors by double digesting and the appropriately restricted vector is treated with alkaline phosphatase (CIAP) to dephosphorylate the 5’- phosphate ends to prevent re-circularization and incubated at 37 OC for 30 min. Ligation is carried out at 15 OC overnight using the double digested insert and the CIAP treated vector. After ligation, the mixture was drop dialyzed against double distilled water using a Millipore 0.025µ VSWP filter membrane for 30 min at room temperature and transformed in to XL1Blue electrocompetent cells and plated on to LB agar plates supplemented with 100 µg/mL ampicillin followed by incubation at 37 OC overnight. The plasmids were extracted using the Qiagen’s miniprep kit and the correct clones were identified by sequencing with T7 forward and T7 reverse primer. Sequencing was done with the AITBiotech. 2.3 Production of electrocompetent cells We used three E.coli strains of electrocompetent cells for our studies, namely E.coli XL1- Blue, BL21 (DE3) cells (stratagene) and Rosetta-gami TM 2 . The cultures were grown in 2 L flasks containing 1 L LB broth., and were inoculated with 2 mL of overnight cultures. XL1-Blue was grown in the presence of 20 µg/mL of tetracycline, E.coli BL21 was grown in the absence of any antibiotic and Rosetta was grown in the presence of 25 µg/mL of chloramphenicol. Cultures were grown until OD600 reaches 0.5 (mid-log phase). All the following steps were carried out at 4 O C. The culture was cooled on ice for 20 min and centrifuged at 4000 x g for 15 min. The cell 12 pellet was resuspended in 1 L of ice-cold sterile double distilled water and centrifuged at 4000 x g for 15 min. This step is again repeated twice with ddH2O and centrifuged at same speed. The cell pellet was resuspended in 40 mL of 10% glycerol and centrifuged at 4000 x g for 10 min. The cell pellet was resuspended with a final volume of 4 mL of 10% glycerol and 60 µL of the suspension is aliquoted in to eppendorfs and stored at -80 OC. 2.4 Protein Expression and purification A large scale purification of the proteins were performed in E.coli BL21 cells, unless otherwise stated. The correct gene insert verified after sequencing is transformed in to BL21 expression cell lines and an overnight culture was grown in LB broth supplemented with 100 µg/mL of ampicillin. This was transferred to large scale flasks containing 1 L LB broth supplemented with 100 µg/mL of ampicillin and allowed to reach an OD 600 = 0.6 and induced with 0.5 mM IPTG(isopropyl β-D- thiogalactosidase) for 4 hours at 37 OC with constant shaking at 220 rpm. The cells were harvested by centrifugation at 6000 rpm for 10 min at 4 OC. The supernatant was discarded and the pellet was resuspended in 60mL of 1x Lysis buffer (5 mM imidazole, 500 mM NaCl, 5 mM MgCl2, 20 mM Tris-HCl, pH7.9). The cell pellet was lysed by sonicated and clarified by centrifugation at 18000 rpm for 45 min at 4 OC. The supernatant containing the His-tagged proteins was purified with a chelating Sepharose column charged with Ni2+. The fractions containing the proteins were pooled, dialyzed in the buffer containing 20 mM Tris-HCl, 100 mM NaCl, pH 8. The purified protein was concentrated using an Amicon Ultra centrifugal filter device and stored at -80 OC. 13 2.5 Cloning, expression and purification of dehydroquinate synthase (DHQS) from Enterococcus fecalis (EFaroB) The EFaroB enzyme was cloned in Tom15b (containing 10x His-tag, a modification of pET15b), expressed and purified by a fellow colleague with the following parameters for purification. The cells were induced with 0.1 mM IPTG (isopropyl β-D- thiogalactosidase) for 8 hours at 37 OC. All the other steps were as previously reported in section 2.4. The purified protein was tested for its enzyme activity using the coupled enzyme assay. 2.6 Coupled enzyme Assays of EFaroB and EFaroF For the ease of detection and screening, we couple the enzymes that catalyzes the first two steps of the pathway to calculate the rate of enzyme reaction. The assay for aroB was coupled to the first enzyme of the pathway, aroF (3-deoxy-D-arabino heptulosonate 7-phosphate synthase) using a diaphorase-catalyzed reaction (Figure 2.1). Diaphorase utilizes the cofactor turnover of NAD+ and this oxidation of NADH (reduced nicotinamide adenine dinucleotide) to NAD+ (Nicotinamide Adenine dinucleotide) is monitored at 340 nm (ε= 6220 M -1 cm-1) by UV2550 Spectrophotometer (Shimadzu). A standard diaphorase-catalyzed assay mixture contains 50mM K+ HEPES buffer (pH7.5), 1.5mM NAD+, 1.5mM INT (Indole-nitrotetrazolium violet) in DMF, 0.05U Diaphorase, 1.5mM phosphoenol pyruate (PEP), 1.5mM D-erythrose 4-phosphate and varying levels of EFaroB (13.6 mg/mL) and 5 µL of DAHP Synthase (aroF). The final reaction volume was 100µL and the reaction was conducted in a 200µL Quartz cuvette. 14 INT INT (Detected at 340 nm) Figure 2.1: Schematic of the coupled-enzyme assay for EFaroB. The turnover of NADH to NAD+ is monitored at 340 nm using a colorimetric detection assay. In this process the cofactor turnover of NADH is coupled to the enzyme Diaphorase which converts the reduced indolenitrotetrazolium violet (INT) to oxidized indole-nitrotetrazolium violet (INT). 2.7 Identification of potential inhibitors of aroB We wanted to identify the potential chemical moieties with inhibitory activities against EFaroB. Using an initial library of 153 polyketide-based flavonoid compounds (Appendix 2) available in the laboratory, we screened our enzyme against the available library of compounds for potential inhitors of EFaroB. Upon identifying compounds with inhibitory activities, we 15 would proceed with modifying the functional groups and subsequent combinatorial biosynthesis of lead compounds based upon the insights obtained from the prior studies, for the development of novel drug compounds. 16 Chapter 3: Results for EfaroB purification 3.1 SDS-PAGE The molecular weight of EFaroB in Tom15b is 39213.8 Da. As seen in Figure 3.1, SDS- PAGE shows the purified protein and also the second lane showing the over-expressed protein in supernatant fraction. The protein was purified using Nickel- affinity column as the 10x His-Tag binds strongly to the divalent ion. Not much of target protein was detected in wash fractions and most of the protein was eluted between the 6th to 18th fractions. The final concentration after dialysis was 13.6 mg/mL. M P S F3 F4 F5 AA5 A6 A7 B10 1 1 2 3 4 6 5 7 8 9 10 37 kDa Figure 3.1: SDS-PAGE results for large scale purification of EFaroB using Tom15b vector. MMarker; P- Pellet; S- Supernatant; F (F3, F4, F5)- Wash fractions; A5, A6, A7, B10- Elution fractions with high A280 in elution peak profile. 17 3.2 Assay Results of EfaroB The purified protein was tested for its activity by coupling with aroF (from E. fecalis) in the presence and absence of 100mM ZnCl2. There was no activity detected. Even when the enzyme was coupled to SST (DHQS from E.coli), no activity was detected. We came to a conclusion that our recombinant enzyme was inactive, presumably due to the lack of a suitable purification procedure. 3.3 Screening for inhibitors Since there was no activity detected in EFaroB we could not proceed further with inhibitor screening. 18 Chapter 4: Cloning and expression of enzymes for combinatorial biosynthesis 4.1. Combinatorial Biosynthesis The fundamentals of combinatorial biosynthesis is to combine genes from different organisms and designing a new set of gene clusters to produce bioactive compounds, leading to the diversification of chemical and natural product libraries. This is done via improvement of enzyme function, alteration of substrate specificities and introduction of novel catalytic activities. Combinatorial biosynthesis can also be used in better production of natural compounds and generation of novel compounds with unique structure and function [13]. The idea of combinatorial biosynthesis is not new; this biosynthetic method has been researched by Horinouchi (2008), in which the focus is on the biosynthesis of non-bacterial and unnatural flavonoids, stilbenoids and circuminoids in an E.coli cell. In our attempt, we wanted to create diversified libraries in our by assembling all the enzymes (from different sources) in a matrix and to add polyketide precursors for precursordirected biosynthesis [13]. In addition, wild type enzymes can be pooled and employed in the biosynthesis, and directed evolution of enzymes can be performed to incorporate new and novel enzyme functions. 4.2 Enzymes for combinatorial biosynthesis In this project, 10 genes were selected to be cloned, expressed and purified for their use as modifying enzymes in the process of combinatorial biosynthesis. These genes were selected on the basis of ease of cloning, availability of cDNA and many other factors. 9 genes were from the plant Arabidopsis thaliana, and one was from Pseudomonas aeruginosa. Genes from 19 Arabidopsis included the chalcone isomerases (CI, CI2, CI3, CI4, CI5, TT5), DMR6 (downy mildew resistant gene), leucoanthocyanidin dioxygenase (LDOX), hydroxy cinnamoyl transferase (HCT) and the gene from Pseudomonas is Polyketide synthase (PhID). 4.2.1 Chalcone isomerases 4.2.1.1 Amplification of Chalcone isomerases from Arabidopsis cDNA was extracted from Arabidopsis using the Superscript first strand synthesis kit purchased from Invitrogen. The standard procedure for amplification and cloning was followed as mentioned earlier for EfaroB in chapter 2. 4.2.1.2 Cloning of Chalcone isomerases Following this the genes were cloned into different vectors such as pET15b, Tom15b and pET17b. Both the genes and the vectors were digested with NdeI and BamHI, with an additional step of phosphatase treatment to the vectors. After digestion, ligation is performed at 15 ̊C overnight with the same conditions mentioned for EFaroB. Cloning was also done with pET20b vector using different restriction enzymes NdeI and XhoI and ligation was performed. 4.2.1.3 Expression and Solubility Screening Studies The ligation product was then dialyzed for 30 minutes in sterile water before transformation into XL1-Blue cells. After transformation, the correct inserts were verified by sequencing the extracted plasmids. These correct inserts were transformed into BL21 and Rosetta 2 competent cells. In order to screen for protein expression and solubility, constructs were grown overnight in 10 mL LB broth containing the appropriate antibiotics. The overnight cultures were scaled-up 20 and grown up to OD600=0.6. One half of the overnight culture was induced with varying concentrations of IPTG starting from 0.1 mM to 0.5 mM and induced for different time intervals ranging from 1 to 18 hours. The other half that was uninduced served as a control. The cells were harvested by centrifugation at 6000rpm for 10 min and the supernatant was discarded. The pellet was resuspended in 500 µL of 1X lysis buffer on ice and the cells were lysed by a 550 Ultrasonic Dismembrator (MISONIX HEAT SYSTEMS) at an amplitude of 10% for a total process time of 1 min. The lysed cells were centrifuged at 14000rpm for 10 min at 4 O C. The pellet and supernatant were taken in separate eppendorf tubes and the pellet was resuspended in 500 µL of 1X lysis buffer. The induced and uninduced samples were analyzed by electrophoresis on a 15% Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) gel. Screening was also done at different temperatures (37 OC, 25 OC and 15 OC, respectively) and also in M9 minimal medium. IPTG concentrations as low as 0.01mM to as high as 0.5mM were used for the screens. 4.3 DMR6 The gene for DMR6 is a downy mildew resistant gene that has been characterized in Arabidopsis plant. This gene belongs to the 2-oxoglutarate (2-OG) – Fe (II) oxygenase family. The expression of this gene is induced during plant defense. There has been a statement that DMR6 negatively affects plant defense [14]. Despite its recognition as an important gene during plant defense, its exact function is still enigmatic [15]. 4.3.1 Cloning, Expression and Screening for solubility in DMR6 All the procedures followed for gene cloning, protein expression and solubility screening was the same as mentioned in section 4.2 for chalcone isomerase. The selection of vectors was 21 also the same, except that the restriction site for pET20b is NdeI and SalI instead of NdeI and XhoI. 4.3.2 Enhancing solubility using β-galactosidase α-complementation Based on the proposal which states that there exists a strong correlation between βgalactosidase activity and solubility of a protein (Wigley, 2001), we attempted to perform a Quikchange PCR for the vector pMALc4x by inserting two basepairs after the SalI restriction site. This was named as pMALc4xA2. The gene cloned in to pET20b was re-cloned in to pMALc4xA2. The gene would be in frame (translational reading frame) with the α-fragment of lacZ gene. Hence the α-fragment fuses with the C-terminal of the target gene thereby increasing its solubility. The α-fragment interacts with the ω-fragment that commonly occurs in the cytoplasm and the protein is pulled to the supernatant and visible blue colour colonies will be observed on x-gal plates. If there is no interaction, the protein will be present in the insoluble pellet fractions. In an attempt to improve the protein solubility, random mutant libraries were created using Mutazyme ® II DNA polymerase. As amplification was carried out using T7 promoter and T7 terminator primers which anneal to sequences in the vector, approximately 200 base pairs were added to the original gene sequence. These are cleaved off after digestion with the restriction enzymes NdeI and SalI, as previously used for the original gene. The mutant vector containing the gene in-frame with the random mutated gene was ligated and transformed after restriction with their respective vectors. This was plated onto X-gal plates. 22 4.4.1 Leucoanthocyanidin Dioxygenase (LDOX) Leucoanthocyanidin dioxygenases (LDOX) is characterized as a “late gene” in the flavonoid biosynthesis pathway. These enzymes are involved in catalyzing the conversion of leucoanthocyanins to anthocyanins [16] as shown in the Figure 4.1. Figure 4.1: Reaction catalyzed by Leucoanthocyanidin dioxygenase (LDOX). The leucoanthocyanidins are converted to anthocyanidins. 23 4.4.2 Methods 4.4.2.1 Amplification and Cloning The methods for amplification and cloning of LDOX were the same method as followed for other genes mentioned previously. 4.4.2.2 Expression of LDOX in pET15b LDOX was initially cloned into Tom15b. Later the LDOX was cloned into pET15b and the expression was followed according to the method mentioned by Wilmouth (2001) in his paper [17] and also a solubility screen was performed. M 1000 bp LDOX LDOX Figure 4.2: Amplification results of LDOX. The left lane contains the 1kb DNA marker and the highlighted bands shows the result of LDOX which is nearly 1100 bp in size. 4.5.1 Hydroxy cinnamoyl transferases (HCT) Hydroxy cinnamoyl transferase is involved in the phenyl propanoid pathway. The silencing of this gene affects the lignin pathway in plants, and also the metabolic flux is diverted by accumulation of Flavonoid compounds [18]. HCT catalyzes the transfer of functional groups between different compounds, as shown in Figure 4.3. 24 Figure 4.3: Reaction catalyzed by Hydroxy cinnamoyl transferase shows that the gene transfers the functional groups in the reaction. In the above reaction, HCT is shown to transfer coumaroyl and caffeoyl groups. This picture was adopted from Besseau, 2007 [15]. 4.5.2 Amplification and Cloning in to Tom15b The methods for amplification and cloning of HCT were the same method as followed for other genes mentioned previously. 25 Chapter 5: Results and Discussion 5.1 Chalcone Isomerases Chalcone isomerases are also called chalcone-flavanone isomerase due to the reaction they catalyse. These enzymes participate in the flavonoid biosynthesis pathway [19-22] in the isomerisation reaction, thereby converting a chalcone to a flavanone. The reaction is shown below in figure 5.1. Figure 5.1: Isomerization reaction catalyzed by Chalcone Isomerase results in the conversion of chalcone to flavanone. This figure is adopted from Shimada, 2003 [16]. The sequences and the corresponding sizes of Chalcone isomerases is given in Appendix 1. Out of the 6 Chalcone isomerases, only 2 (CI3 and CI4) were successfully amplified and of these only CI3 was cloned and expressed. CI3 has a molecular weight of 32 kDa. It was cloned into four different vectors pET15b, pET17b, Tom15b, pET20b. The plasmid bearing the gene encoding for CI3 was transformed into BL21 and Rosetta2. It was seen that of all these vectors, CI3 seems to have a better expression pattern with pET20b vector. There was relatively low level 26 expression noticed with pET17b, pET15b and Tom15b. Compared to the supernatant, the protein was found to be over-expressing in the pellet, rendering it to be an insoluble protein. Marker Figure 5.2: Amplification result of the chalcone isomerase, CI3 shown in third and fourth lane followed by a 1KB marker in the fifth lane. The size of CI3 corresponds to nearly 1kb. Marker 1000 bp TT5 Figure 5.3: Amplification result of TT5 shown in fourth and fifth lane, the size corresponding to nearly 1000 bp. The first lane contains the 100 bp DNA ladder. 27 L UIP1 UIS1 IP1 IS1 UIP2 UIS2 IP2 IS2 Figure 5.4: Expression results of CI3 in Tom15b and Rosetta2. From left, Ladder, first clone Uninduced pellet (UIP1), Uninduced Supernatant (UIS1), Induced pellet (IP1), Induced Supernatant (IS1). A second clone containing UIP2, UIS2, IP2 and IS2 is shown in lanes 6, 7, 8 and 9 respectively. UIP1 UIS1 IP1 IS1 UIP2 UIS2 IP2 IS2 UIP2 L Figure 5.5: Solubility screening of CI3-1 in Tom15b and M9 medium after 1 and 2 hours of induction with 0.5 mM IPTG. From left, UIP1, UIS1, IP1, IS1 after 1 hour, UIP2, UIS2, IP2, IS2 after 2 hours, UIP3 after 3 hours induction, followed by protein marker. 28 L UIP UIS UIS3 IP3 IS3 6 6 IP6 IS6 1 UIP UIS 12 12 Figure 5.6: Screening of CI3-2 in Tom15b and M9 medium. Ladder, UIS3, IP3, IS3 after 3 hours, UIP6, UIS6, IP6, IS6 after 6 hours induction, UIP12, UIS12 after 12 hour induction. IP 12 IS 12 L UIP UIS _1 _1 IP _1 IS UIP _1 _2 UIS _2 Figure 5.7: Screening of CI3-3 in Tom15b and M9 medium. From left, IP12 and IS12 after 12 hours induction at 37 OC, ladder (L), induction at 25 OC for UIP_1, UIS_1, IP_1, IS_1, UIP_2, UIS_2. The numbers indicate the induction time. 29 IP _2 IS UIP _2 _3 UIS _3 L IP _3 IS UIP _3 _6 UIS _6 IP _6 Figure 5.8: Screening of CI3-4 in Tom15b and M9 medium at 25 OC. IP_2, IS_2, UIP_3, UIS_3, protein marker (L), IP_3, IS_3, UIP_6, UIS_6, IP_6. The numbers indicate the hours of induction. L 1 UIP _1 UIS _1 IP IS _1 _1 UIP UIS _2 _2 IP _2 IS _2 Figure 5.9: Screening of CI3 in pET20b and M9 medium. From left, marker, UIP_1, UIS_1, IP_1, IS_1, UIP_2, UIS_2, IP_2, IS_2 expressed with 0.5mM IPTG and at 37 OC. 30 L UIP UIS IP UIP UIS IS IP IS Figure 5.10: Screening of CI3 in pET20b and M9 medium at 37 OC. The first lane indicates the marker followed by uninduced pellet (UIP), uninduced supernatant (UIS), induced pellet (IP) and Induced Supernatant (IS) after 3 hours of induction with 0.5 mM IPTG. Lane 6-9 contains duplicates of the CI3-pET20b clone. L 1 UIP UIS _1 _1 IP_ 1 IS_ 1 UIP _2 UIS _2 IP _2 IS _2 Figure 5.11: CI3 in pET20b transformed in to BL21 and overexpressed in LB at 37 OC. From left Ladder, UIP_1, UIS_1, IP_1, IS_1, UIP_2, UIS_2, IP_2, IS_2. The numbers following indicate the respective induction time. 31 L UIP IP UIS IS Figure 5.12: CI3 in pET20b and Rosetta2 induced with 0.5mM IPTG. From left, ladder, UIP, IP, UIS, IS after 3 hours of induction at 37 OC. Results of DMR6 DMR6 has 1026 base pairs with a molecular weight of 41 kDa. The correct sequence of the gene is mentioned in Appendix 1. This gene was successfully cloned into all vectors and further expression was studied. DMR6 cloned in Tom15b was found over-expressing in insoluble fraction when induced with 0.5 mM IPTG. In pET17b, the cloning was not successful and further expression studies could not be carried out. After cloning into pET20b, some fraction of the protein seemed to express in the soluble fraction but when large scale purification was done and the concentration was checked, the protein was less than 0.05 mg/mL rendering it impossible to determine its rate of activity. When the protein was sub-cloned into pMALc4xA2 and sent for sequencing, the sequence was not correct. Nevertheless, we were able to conclude that the protein is highly insoluble. We further attempted to increase the solubility by mutating the protein and cloning it into pMALc4xA2; however, my attempts were not successful. 32 Marker DMR6 1000 bp Figure 5.13: Amplification results of DMR6 gene. The first lane contains 100bp DNA ladder. The last lane contains the amplified DMR6 which corresponds to nearly 1100 bp. Marker Figure 5.14: DMR6 cloned in to Tom15b vector and the extracted plasmid was amplified using T7 pro and T7 term primers before sending for sequencing. 33 pMALc4xA2 NdeI digested Marker Double digested 1000 bp Figure 5.15: Amplification of the mutated pMALc4xA2 vector. The first lane is a 100 bp ladder and the next lane with a dark band corresponds to the actual size of the vector pMALc4xA2 (template). The next lane is a band showing pMALc4xA2 (template) after digestion with restriction enzymes NdeI and SalI before cloning with DMR6 (double digested). The last lane contains the pMALc4xA2 after amplifying with vector specific primers to amplify only a region of the gene which corresponds to nearly 1kb size. 1 kb ladder 100 bp ladder Figure 5.16: DMR6 cloned in to pMALc4xA2 vector. The size corresponds to nearly 1500 bp. DMR6 34 1 kb ladder DMR6 DMR6 Figure 5.17: Randomly mutated DMR6. The first two lanes contain the markers and the third IS7 IP7 IP6 IS6 IS5 IP5 IS3 IP4 IS4 IP3 IS2 IS1 IP2 L IP1 and fourth lane contains the high frequency and medium frequency mutations respectively. 37 kDa Figure 5.18: Solubility Screening of DMR6 in Tom15b at various induction time at 37 ̊ C in M9 minimal medium. The first lane corresponds to the protein marker. Lanes 2, 3, corresponds to IP1, IS1 after 1 hr induction with 0.01 mM IPTG in M9 minimal medium. Lanes 4, 5 corresponds to IP2, IS2 after 1 hr induction with 0.05 mM IPTG. Lanes 6, 7 corresponds to IP3, IS3 after 1 hr induction with 0.1 mM IPTG. Lanes 8, 9 corresponds to IP4, IS4 after 1 hr induction with 0.5 mM IPTG. Lanes 10, 11 represent IP5, IS5 after 2 hr induction with 0.01 mM 35 IPTG. Lanes 12, 13 represents IP6, IS6 after 2 hr induction with 0.05 mM IPTG. Lanes 14, 15 IS14 IP14 IP13 IS13 IS10 IP11 IS11 IP12 IS12 IP10 IS9 IP9 IS8 L IP8 represent IP7, IS7 after 2 hr induction with 0.1 mM IPTG. 37 kDa Figure 5.19: Solubility Screening of DMR6 in Tom15b at various induction time at 37 OC. Lane 1 represents protein marker followed by lanes 2 to 15 representing IP8, IS8 after 2 hr induction with 0.5 mM IPTG; IP9, IS9 after 3 hr induction with 0.01 mM IPTG; IP10, IS10 after 3 hr induction with 0.05 mM IPTG; IP11, IS11 after 3 hr induction with 0.1 mM IPTG; IP12, IS12 after 3 hr induction with 0.5 mM IPTG; IP13, IS13 after 6 hr induction with 0.01 mM IPTG; IP14, IS14 after 6 hr of induction with 0.05 mM IPTG respectively. 36 IS21 IP20 IS20 IP21 IP19 IS19 IP18 IS18 IP17 IS17 IS15 IP16 IS16 IP15 L 37 kDa Figure 5.20: Solubility Screening of DMR6 in Tom15b at various induction time at 37 OC (lanes 2 to 5) and 25 OC (lanes 6 to 15). Lane 1 represents protein marker. Lanes 2 to 15 corresponds to IP15, IS15 after 6 hr induction with 0.1 mM IPTG; IP16, IS16 after 6 hr induction with 0.5 mM IPTG; IP17, IS17 after overnight induction with 0.01 mM IPTG; IP18, IS18 after overnight induction with 0.05 mM IPTG; IP19, IS19 after overnight induction with 0.1 mM IPTG; IP20, IS20 after overnight induction with 0.5 mM IPTG; IP21, IS21 after overnight induction with 1 mM IPTG. All the overnight expression was carried out at lower temperature (25 OC). UIP IP UIS IS L Figure 5.21: Overexpression of DMR6-pET20b in BL21. From left, UIP, IP, UIS, IS after 3 hours of induction using 0.5 mM IPTG at 37OC in LB broth containing appropriate antibiotics. 37 IP IS F3 Purified protein fractions F1 F2 L L Figure 5.22: Nickel affinity purification of DMR6-pET20b. From left the lanes corresponding are protein marker in lane 1, purified protein fractions in lanes 2-7, Wash fractions in lane 810(F1, F2, F3), Induced pellet, Induced supernatant, ladder. IP1 IS1 (a) L 0.01mM IP1 IS1 IP1 0.05mM IS1 IP2 IS1 IP 0.1mM 1 0.5mM 0.01mM 38 IS3 IP3 IP3 IS3 IP3 IS3 IP3 IP2 IS2 IS2 IP2 IS2 IP2 IS2 L 0.01 0.05mM 0.1mM 0.5mM 0.01 0.05mM 0.1mM O.5mM mM mM (b) IS3 IP6 IS6 IP15 IS15 IP15 IS15 IP15 IS15 0.5mM 0.5mM 0.05mM 0.5mM 0.1mM (c) Figure 5.23: Solubility screening of DMR6 in Tom15b vector. Screening was performed at 37 O C and 25 OC at different time intervals starting from 1, 2, 3 and 15 hrs induction with M9 minimal medium. The first gel (a) shows Protein marker, IP_1, IS_1 after induction with 0.01 mM, 0.05 mM, 0.1 mM and 0.5 mM IPTG, IP_2 induced with 0.01 mM IPTG in order respectively. The gel picture (b) shows ladder, IS_2 after induction with 0.01 mM IPTG, IP_2, IS_2 induced with 0.05 mM, 0.1 mM, 0.5 mM IPTG, IP_3, IS_3 induced with 0.01 mM, 0.05 mM, 0.1 mM and IP_3 induced with 0.5mM IPTG respectively. The gel picture (c) shows ladder, IS_3 induced with 0.5 mM IPTG, IP_6, IS_6 induced with 0.5 mM IPTG, IP_15, IS_15 induced with 0.05 mM, 0.1 mM, 0.5 mM IPTG respectively. The cells induced for long hours of 39 expression were incubated at lower temperatures of 25 OC. The numbers following the IP and IS, UIP IP IS IP IP UIP IS L IP indicates the number of hours of induction. Figure 5.24: LDOX expression in pET15b vector and BL21 cell lines after induction with 0.5 IS IP L UIS L UIP IS IP UIS UIP mM IPTG at 37 OC and 6 hr induction time. Figure 5.25: LDOX Expression at 30 OC with 0.5mM IPTG after 3 hours induction. From left, lane 1 to 4 - uninduced pellet (UIP), Uninduced supernatant (UIS), induced pellet (IP), Induced supernatant (IS), lanes 5, 6- protein marker, lanes 7-10 duplicate of UIP, UIS, IP, IS. 40 L UIP IP UIS IS Figure 5.26: LDOX expression at 18 OC with 0.5mM IPTG. Lane 1 represents protein ladder. Lanes 2-5 represents Uninduced pellet (UIP), Uninduced supernatant (UIS), Induced pellet (IP), Induced supernatant (IS). Cloning results of HCT HCT is a 1302bp gene which is shown in the agarose gel picture (fig 5.27). We attempted to clone HCT in Tom15b, but the cloning procedure was not successful. So we could not further proceed any other protocol with this gene. 100 bp ladder HCT HCT Figure 5.27: Figure showing amplification of HCT. The first lane shows a 100 bp ladder and the two dark bands correspond to HCT gene with a size matching nearly 1200 bp. 41 Amplification results of Pseudomonas aeruginosa polyketide synthase (PhID) 1 kb ladder PhID PhID Figure 5.28: Amplification result of Pseudomonas polyketide synthase, PhID. The gene size corresponds to nearly 1kb. The first lane represents the 1 kb DNA ladder. 42 Chapter 6: Conclusion Based on the enzyme assay carried out for the enzyme EfaroB, we were not able to monitor any detectable activity. Hence, we could not screen for the inhibitors from the available library of compounds. Nonetheless, these flavonoids were found to have some inhibitory effect at least in micromolar range (µM) on the other enzymes of the Shikimate pathway, as tested by my colleagues. We have tried cloning, expressing and purifying nearly 10 genes for further use as modifying enzymes in combinatorial biosynthesis. Of these 10 enzymes, only CI3, DMR6 and LDOX were successfully cloned and during expression studies, only CI3 and DMR6 were expressing, but CI3 was insoluble and DMR6 was very slightly soluble after complementation in β-galactosidase. We attempted to enhance the solubility of these genes in different vectors such as pET15b, Tom15b, pET17b, pET20b and pMALc4xA2. Although the vector pET20b was found to increase the expression level, no evident increase in the protein solubility was observed in these different constructs. In our next attempt we exploited the varying growth conditions to reduce the rate of protein expression and to monitor the exact condition where the protein is expressed in its soluble form. Protein expression was also carried out in M9 minimal medium where only negligible amount of protein expression was observed when compared to the growth in LB medium. Our last attempt was to introduce random mutations into the genes CI3 and DMR6, respectively. Once solubility is favoured, we planned to test for its activity. Results show that solubility is not favoured by these mutation because either the number of mutations would not be 43 enough for the protein to express in soluble fraction or the gene might not have been inserted in the translational frame with the pMALc4xA2. Finally with the little amount of protein (DMR6) expressed in soluble fraction by the pET20b vector, I proceeded with the large scale expression of DMR6 and concentrated the protein. But since the yield and concentration was negligible, further optimization might be required to increase the solubility. 44 Chapter 7: Future work The aim of this project is to develop an inhibitor against the Shikimate pathway enzyme, dehydroquinate synthase (EFaroB). From our results, it is quite obvious that the concentration of the protein was not enough for detection of its activity. Hence further optimization of the protein needs to be done for detecting its activity, in order to inhibit the protein using our available library of compounds Also, neither the structure of DMR6 nor its function is known, it would be feasible to explore the gene for its structural and functional studies. Although many homologues of Chalcone isomerases have been widely studied, the gene of interest in our study, CI3 from Arabidopsis, has no structural evidence reported till date. So exploring the structural details and furthermore the functional aspects of these proteins might aid in using these proteins as modifying enzymes in the process of combinatorial biosynthesis. The structure and function of LDOX has been studied earlier but the results for expression were not reproducible when attempted. Further optimization is required for increasing the expression and solubility of the protein. Once the solubility of the gene is enhanced using β-galactosidase α-complementation, we had proposed to assay for the β-gal activity for the mutants. Our proposal included the addition of the spectrophotometric substrate O-nitrophenyl- β-D-galactopyranoside (ONPG) to detect the β-gal activity by measuring the absorbance at 420 nm in a Spectrophotometer. ONPG, although a colourless substrate, is hydrolyzed to a yellow coloured product, nitrophenol by the βgalactosidase enzyme. 45 The rate of activity for EFaroB has to be determined for which further optimization in increasing the yield of protein is required. Once the rate of activity is detected, we can use the inhibitors in our lab to identify the compounds which can act as inhibitors against the enzyme and also the concentration of these inhibitors needed to inhibit the enzyme can be measured. Further, modifying enzymes purified can be used to make modification in the identified inhibitors to enhance the efficiency of those inhibitors. 46 PART 2: Elucidating the mechanism of OMPDC-catalyzed reaction on a KGPDC-scaffold 47 Chapter 8: Introduction Despite the conventional remark that enzymes are specific biocatalysts, it is also possible to exploit enzymes to catalyze other relevant or irrelevant reactions instead of the original function for which they are physiologically specialized or evolved for. This property of an enzyme is called its promiscuity, which forms the basis for functional plasticity. Promiscuity is a key factor in evolution of new proteins performing new functions, as it serves as evolutionary starting points and highlight the unique evolutionary features of promiscuous enzyme functions. By understanding how enzyme structures evolve through the study of enzyme families, superfamilies, and suprafamilies, one can decipher and closely examine how enzymes, through nature itself, can achieve astonishing catalytic proficiencies. Having knowledge of these nature’s strategies, it is possible to replicate similar mechanisms in the laboratory setting to evolve new catalysts and engineer novel protein folds to catalyze closely related or novel functions. “Genomic enzymology”[57] is a term used by Gerlt and Babbitt to describe the expansive strategy made possible to understand the interdependence of structure and function in enzymes thereby gaining insight into the hidden constraints that nature has engineered into a given structural template [57]. This necessitates the incorporation of structural and functional studies of homologous enzymes. In this project we aim to study the mechanism of Orotidine-5’-monophosphate decarboxylase (OMPDC) by using the template of its related-suprafamily member, 3-keto Lgulonate 6-phosphate decarboxylase (KGPDC). 48 8.1 Opportunistic Enzyme evolution Over the years, random genetic mutations occur within an organism’s genetic code, of which, beneficial mutations are preserved, that may be crucial for survival. Nature is an opportunist in expanding its biochemical repertoire through the process of natural evolution. According to Wise et al. (2002), an enzyme’s evolution might be attributed to two complementary strategies: either to catalyze a new transformation of the same compound, gaining the next step in a nascent metabolic pathway or the subtle shift occurring in a substratebinding site might lead to an altered function of an enzyme in order to retain the aspects of the original chemistry, thereby retaining the originality of the reaction [58]. Our project focuses on directed evolution of enzymes which mimics the natural evolution in vitro, by operating on a molecular level where no new organisms are created and a sharp focus is laid on specific molecular property only. Consequently, the basic concepts of diversification, selection and amplification are maintained in directed evolution. 8.2 Functionally diverse Enzyme Suprafamilies Suprafamily of enzymes share very little sequence identity (less than 20%) but retain their common (β/α)8 barrel. The OMPDC suprafamily of enzymes contain four enzymes identified till date, including: Orotidine-5’-monophosphate decarboxylase (OMPDC) that catalyses the conversion of Orotidine monophosphate (OMP) to Uridine monophosphate(UMP) in the de novo synthesis of pyrimidines; 3-ketogulonate 6 phosphate decarboxylase (KGPDC) is another member of OMPDC suprafamily catalyzing the conversion of 3-ketogulonate 6phosphate (KGP) to L-xylulose-5-phosphate in the fermentative utilization of L-ascorbate in a 49 few enteric bacteria; and D-arabino-hex-3-ulose 6-phosphate synthase (HPS) and D-ribulose 5phosphate 3-epimerase (RPE). A sequence alignment of the suprafamily of enzymes, OMPDC and KGPDC respectively, shows the conservation of key residues of the active site (Figure 15.2). Both OMPDC and KGPDC belong to the (β/α)8 barrel family of enzymes. Despite conservation of the positions of a few functional groups among these suprafamily members, the active site residues differ in the identity and mechanistic utility. Accounting for this diversity, we try to exploit the KGPDC scaffold by mutating the critical residues that would result in an OMPDC-catalyzed reaction. 8.2.1 3-ketogulonate 6-phosphate decarboxylase (KGPDC) 3-ketogulonate 6-phosphate decarboxylase (KGPDC) is an enzyme involved in the Lascorbate utilization of certain microorganisms. This enzyme catalyzes the conversion of 3ketogulonate 6-phosphate to L-xylulose 5-phosphate and carbondioxide [23]. The reaction catalyzed by KGPDC is a metal-ion dependent mechanism and it involves Mg2+ for the formation and stabilization of intermediates. Till date nearly 14 structures of KGPDC has been deposited in PDB. The structure of wildtype KGPDC bound to L-gulonate 6-phosphate is shown in Figure 8.2. The reaction catalyzed by KGPDC is shown in Figure 8.1. 50 Figure 8.1: Reaction catalyzed by KGPDC through the formation of an enediolate intermediate. The picture is generated using chemdraw originally adopted from [1]. Figure 8.2: Figure showing KGPDC from E. coli. The file was obtained from PDB and the picture generated using Chimera. 51 8.2.2 D-Arabino-Hex-3-ulose 6-phosphate synthase (HPS) D -Arabino-Hex-3-ulose 6-phosphate synthase (HPS) is another remarkable member of the OMPDC suprafamily. This enzyme is involved in the formaldehyde assimilation in the ribulose monophosphate pathway (RuMP). HPS catalyzes the aldol condensation between D ribulose 5-phosphate and formaldehyde to form D -arabino-Hex-3-ulose 6-phosphate. The evidence that HPS belongs to the OMPDC suprafamily is shown by sequence homology results [24, 25]. Not much is explored regarding this enzyme structure and till date very little structural information is available. Even so, it has been thought that even this enzyme might possess a (β/α)8 barrel just like the other members of the suprafamily [23]. The mechanism catalyzed by this enzyme is dependent on the Mg2+ just like KGPDC and the reaction proceeds via the 1,2enediol formation as shown in Figure 8.3. Figure 8.3: Reaction catalyzed by HPS shows that the reaction mechanism is similar to the KGPDC in that both requires a metal ion for the catalytic activity. 52 8.2.3 D-ribulose 5-phosphate 3-epimerase (RPE) The last member of the OMPDC suprafamily of discussion here is D -ribulose 5phosphate 3-epimerase (RPE). As the name suggests, this enzyme catalyzes the epimerization reaction of D -ribulose 5-phosphate to D -xylulose 5-phosphate. This mechanism operates in the pentose phosphate pathway. Just like other suprafamily enzymes there is structural evidence to prove the existence of a similar (β/α)8 fold in these enzymes [26, 27]. Now the enzyme is characterized biochemically and the evolutionary origins are also revealed by Akana (2006). The mechanism catalyzed by RPE is metal ion independent and it binds the same substrate as HPS, D -ribulose 5-phosphate, catalyzing an epimerization reaction. There are 6 RPE structures currently available with PDB and the protein structure is shown in Figure 8.5. RPE is a dimer of (β/α) 8 fold as seen from the figure. There has recently been controversy regarding the metal-ion dependence of the enzyme as Streptococcus pyrogenes RPE is activated by Zn2+ metal ion. The reaction catalyzed by RPE is shown in Figure 8.4. Figure 8.4: Reaction catalyzed by RPE. The substrate for RPE and HPS is the same but RPE catalyzes the epimerization of D -ribulose 5-phosphate to D -xylulose 5-phosphate. 53 8.3 Beta-alpha barrel Nearly 10% of the structurally characterized proteins expectedly possess the classical (β/α)8-barrel fold, at least for one domain [28]. The barrel has a cylindrical core that is contributed by eight (β/α)-units hydrogen bonded to each other with the central core occupied by the β-strands and the α-helices located at the periphery. The hydrophobic cores are located between the β-sheets and the flanking α-helices, thus forming four quarter barrels [(β/α)2subdomains] [29]. These (β/α)8-barrel scaffold might have evolved by a two-fold gene duplication where two identical half-barrels would have formed at the end of first duplication and subsequent fusion of these half-barrels and the second gene duplication might usually result in homologous enzymes that might perform distinct functions. Structural evidence for the evolution of (βα)8-barrel fold from the half barrel through a series of gene duplification comes from the works of Hocker and coworkers [30, 31]. Since this (β/α)8-barrel is thought to provide a structural platform for the divergent evolution of enzymes[32], this scaffold can be well-suited for evolution of function by choosing an appropriate active site architecture and exploiting its functional plasticity to catalyze a particular function. The following chapters deal with the functionally distinct enzyme suprafamilies of the enzyme OMPDC and our attempts to elucidate the mechanism of OMPDC-catalyzed reaction on a KGPDC scaffold by rational design by mutating the critical residues of KGPDC enzyme to catabolize the OMPDC-catalyzed mechanism, in a hope of understanding the reaction mechanism of OMPDC. 54 Figure 8.5: Crystal structure of RPE obtained from PDB (1RPX) displaying a classical (β/α) 8barrel fold. The structure is generated using Chimera. 55 Chapter 9: Orotidine 5’-monophosphate decarboxylase (OMPDC) 9.1 Orotidine 5’-monophosphate decarboxylase Orotidine 5’- monophosphate decarboxylase, is one of the most remarkable enzymes that catalyze the conversion of Orotidine 5’-monophosphate (OMP) to Uridine 5’-monophosphate (UMP) (Fig 9.1), a precursor involved in the synthesis of pyrimidines downstream of the pathway. OMPDC is an extremely proficient enzyme, in that, unlike other decarboxylases, OMPDC doesn’t require any metals or cofactors for catalyzing a reaction with a higher rate enhancement of 1017. Although a detailed interrogation has been made in various studies to explain the mechanism of OMPDC-catalyzed reaction, the actual mechanism is still under debate and remains contentious. Based on the understanding of the previous work, we endeavor to shed light on the mechanism of OMPDC by replicating the reaction of OMPDC on an evolutionarily related enzyme’s scaffold. Figure 9.1: Reaction catalyzed by OMPDC shows that the substrate OMP is converted to UMP through the formation of vinyl carbanion intermediate. The structure is generated using Chemdraw. 56 9.2 Structural information of OMPDC Assuming that there is a concept of “conservation of catalysis” during protein evolution, we chose an appropriate template, as a means of imitating nature to utilize the mechanistically diverse suprafamily of enzymes. So the enzyme we employed in our studies is 3-keto Lgulonate-6-phosphate decarboxylase (KGPDC) from the L-ascorbate utilization pathway. KGPDC belongs to the OMPDC suprafamily of enzymes which shares a common (β/α) 8 fold, a characteristic of this family. Although the enzyme originally lacks the activity for our target enzyme, the active-site scaffold would be re-wired, that, with very few mutations, we can consequently achieve the catalysis of the required target reaction. The conserved active site architecture has restrained the evolution in the OMPDC suprafamily. Although OMPDC and KGPDC shares less than 20% identity in their primary amino acid sequence, with no common mechanistic attribute, it still did not go unnoticed. The common active site architecture shared among these two enzymes is evident. 57 Figure 9.2: OMPDC of Methanobacter thermoautotrophicum. The protein structure is available in PDB and the above picture was generated using Chimera. 9.3 Previously proposed mechanisms of catalysis of OMPDC-catalyzed reactions Although there are several proposals suggested by various groups of researchers to explain the mechanism catalyzed by the OMPDC enzyme, till date, there is no single proposal that is widely accepted. The first attempt to explain the mechanism of OMPDC-catalyzed reaction was by Silverman and Groziak (1982) who proposed an addition-elimination reaction on the C5 carbon where they explained the attack of a nucleophile to stabilize a bond. Silverman and Groziak proposed an addition-elimination reaction in which a nucleophile on the enzyme forms a covalent bond at C5 and protonates C6 [33]. Concurrent loss of the 4 carboxylate as carbon 58 dioxide and the nucleophile would yield product UMP without the formation of an anionic intermediate. However, no kinetic isotope effect was observed for isotopically labeled 5-13C or 5-2H OMP, eliminating nucleophilic attack at C5 as the mechanistic pathway (Fig 9.3a). Another proposal put forward a concerted protonation and decarboxylation that would bypass the generation of a high energy anionic intermediate [34, 35] (Fig. 9.3b). D2O solvent kinetic isotope effects and 13 C labeled carboxylate kinetic isotope effects showed that decarboxylation, determined to be the rate-limiting step, was separate from protonation (Acheson, 1990). In 50/50 D2O/H2O the measured product isotope effect is unity (i.e. equivalent amounts of protonated and deuterated product were observed spectroscopically), providing further evidence that protonation does not help initiate nor is concurrent with the rate determining step [36]. Additionally, a 102 -fold rate enhancement of decarboxylation and H6 exchange for 5-fluoroOMP and 5-fluoroUMP indicate an anionic intermediate that is stabilized by the inductively electron withdrawing fluorine (Fig. 9.3b) [37]. Overall, accumulated experimental evidence favors a two step reaction with a negatively charged intermediate over the concerted reaction. Several propositions utilized protonation as a means to stabilize the anionic charge of the intermediate since. Beak and Siegel (1976) suggested a zwitterionic or ylide mechanism where protonation of O2 yields a positively charged quaternary amine at N1 that could inductively stabilize the neighboring negative charge on C6 (Fig. 9.3c). A similar zwitterionic intermediate is found in thiamin pyrophosphate-catalyzed reactions. Lee and Houk proposed a similar delocalization scheme in which the anionic intermediate forms a carbene resonance structure with charge delocalized to O4 (Fig. 9.3d) [33]. Their proposal suggested that a conserved lysine, aided by a hydrophobic protein interior, transfers a proton to O4 to yield a neutral intermediate. It was also noted that the transition state 59 analogue 6-hydroxyUMP (BMP, Fig. 9.3b), a remarkably strong inhibitor with a Ki of 9x10-12 M1 for yeast OMPDC, not only mimics the anion at C6, but can also generate an anion at O4 similar to the Lee and Houk intermediate (Fig. 9.3b). However, in the year 2000, four crystal structures of OMPDC, from E. coli, M. thermoautotrophicum, S. cerevisiae, and P. falciparum, were published simultaneously. O2 and O4 form hydrogen bonds with the enzyme and play an important role in binding and in orientation of the substrate. However, the crystal structures showed that neither O2 nor O4 have nearby acidic proton donors, signifying that neither oxygen becomes fully protonated. 15N kinetic isotope effect studies performed with the 15N-labeled picolinic acid show no bond order change, which contradicted the formation of a quaternary ammonium intermediate at or before decarboxylation, and was the final death knell for the zwitterionic mechanism. Today, with the wealth of knowledge available, we attempt to arrive at a possible mechanism for the OMPDCcatalyzed reaction. 60 Figure 9.3: Different mechanistic proposals for the reaction catalyzed by OMPDC. The structure was drawn using Chemdraw based on the information published by Miller(2002) [33] 61 Figure 9.4: The paradigm of Directed Evolution of enzymes. Iterative rounds of mutation and selection will give rise to the target enzyme. The abundantly available crystal structures of OMPDC reveal that the residues of the conserved DxKxxD motif point toward the C6 carboxylate group. The functional significance of the two conserved aspartates is unclear, and this discovery prompted Wu et al. to suggest that OMPDC utilizes ground state destabilization. The concept of ground state destabilization originates from the Circe effect introduced by Jencks. Wu et al. proposed that the positively charged lysine allures the substrate carboxylate into the proper active site conformation, but the neighboring negatively charged aspartates provide electrostatic stress that encourages 62 decarboxylation. The strain is felt only by the Michaelis-Menton complex, thereby decreasing ΔΔG between the ground state and transition state. However, the hypothesis for ground state destabilization was explained by Florian et al., who stated that desolvation costs outweigh destabilization benefits[38]. Although the catalytic rate would increase with the increase in the hydrophobicity, desolvation would increase KM and consequently kcat/KM would not improve. Ground state destabilization of the enzyme-substrate complex could utilize conformational changes to position the conserved aspartates effectively. The costs of desolvation or structural changes towards a catalytic conformation could be compensated by the intrinsic binding energy of the phosphate group. OMPDC decarboxylates the orotidine analogue 1(erythrofuranosyl)orotic acid (EO) very slowly—kcat/KM is 2.1 x 10-2 M-1s-1. In the presence of phosphite dianion, EO decarboxylation accelerates almost 105-fold. Restoration of the phosphoryl moiety reconstitutes the original OMP kinetics, provided that the entropic effect of binding two substrate pieces is taken into account. Catalytic activation by the addition of phosphite supported the Jencksian concept that enzymes redirect binding energy to “pay for catalysis”. In spite of extensive interrogation, the drive behind OMPDC catalysis is not completely clear and remains contentious. In reality the enzyme probably uses multiple elements to decarboxylate OMP, of which two possible mechanisms are described herein: carbene-like 8 resonance facilitated by hydrogen bonding—rather than proton transfer—and hydrophobic destabilization of the OMP carboxylate group. Mechanistic hypotheses explored in this thesis examine OMPDC from M. thermoautotrophicus as a model enzyme. 63 Aim of our project: To elucidate the reaction mechanism catalyzed by the enzyme Orotidine 5’monophosphate decarboxylase (OMPDC) on the scaffold of its related suprafamily member, 3keto-L- gulonate 6- phosphate decarboxylase (KGPDC). 9.5 Our hypothesis for the mechanism of OMPDC-catalyzed reaction In our hypothesis, we propose that the OMPDC catalyzed mechanism proceeds via the formation of a vinyl carbanion intermediate and the detailed mechanism deduced based on the previous studies, is as follows: as soon as the substrate is captured, the substrate binding group closes over the substrate thereby allowing the substrate to be held in its place. The residues for the substrate binding loop is contributed by the seventh β-strand and fifth β-strand and the corresponding residues actively participating in this step is glutamine (Q185 in Methanobacter OMPDC) and serine (S127 in Methanobacter). This loop closure is due to the hydrogen bonding between the Q185 to 5’-phosphate and O2 of pyrimidine and the N3 of S127. After the substrate is captured, the carboxylate group of OMP substrate is positioned proximal to the active site residues aspartate (D70 in Methanobacter) and lysine (K72 in Methanobacter) from the first domain and another aspartate (D75 in Methanobacter) from the second domain. The carboxylate groups of OMP and the aspartate (D70) experiences an electrostatic repulsion and as a result, the substrate destabilization occurs, thereby initiating the decarboxylation reaction. The removal of the carboxyl group might be responsible for the formation of a high-energy intermediate, and the ensuing transition state stabilization follows. This might be initiated by the lysine residue (K72) by stabilizing the negative charge imparted on the cleavage of carboxylate group. This function 64 of lysine in stabilizing the transition state is a probabilistic explanation for the enzyme catalysis in the absence of metals and cofactors, with a high proficiency. The final step in the mechanism is the product formation and subsequent release if the product, UMP. The phosphate group of the substrate binds to the phosphate binding loop as evidenced in the literature. The schematic explanation of this hypothesis is shown in the figure below (Fig 9.5). 9.5 Selection of KGPDC as a template to explore the mechanism of OMPDC-catalyzed reaction KGPDC is a member of the OMPDC suprafamily and it shares the conserved active site architecture but catalyze a chemically-distinct reaction. The reaction of KGPDC involves the conversion of 3-keto L-gulonate 6-phosphate to L-xylulose 5-phosphate. Unlike OMPDC, this is a metal dependant enzyme which depends on Mg2+ for its activity. Although both are decarboxylation reactions, the presence of water molecules on si and re face of the intermediate supply the necessary protons for product formation, in the case of KGPDC, while the source of protonation is explained by the presence of a lysine residue in OMPDC. Structure based sequence alignment of KGPDC and OMPDC reveals the critical residues involved in the catalysis of the respective reactions. The DKD motif is conserved in both OMPDC and KGPDC. 65 A.Substrate closure B. C. Figure 9.5: The OMPDC-catalyzed reaction through the formation of a vinyl carbanion intermediate. 66 Figure 9.6: Structural Superposition of Methanobacter OMPDC and E.coli KGPDC. Figure 9.7: Superimposed structures of OMPDC and KGPDC showing conserved active site residues. 67 Table 1: Mutants based on the differing active site residues between KGPDC and OMPDC. OMPDC KGPDC residues Mutants Lys42 Glu33 E33K Gln185 Gly171 G171Q Ser127 Trp117 W117S residues Based on the structure based sequence alignment of OMPDC and KGPDC, differing catalytic residues are shown in Table 1 above. With the expectation that the differing catalytic residues might account for the difference in the mechanism of each of these enzymes, mutations can be introduced into the template (KGPDC) scaffold to effect a gain-of-function for the OMPDC-catalyzed reaction. 68 Figure 9.8: Sequence alignment of KGPDC and OMPDC. The sequences of the four orthologues of KGPDC SgaH (from E. coli), KEF (Enterococcus fecalis), KSP (Streptococcus pneumonia) and KST (Salmonella typhimurium) with the OMPDC of Human, yeast, Methanobacterium and Plasmodium are shown, respectively. It is evident that the D-K-D motif and R203 are conserved throughout the suprafamily and highlighted in red. The differing residues are highlighted in other colours. 69 Chapter 10: MATERIALS AND METHODS In our study we selected four orthologues of KGPDC from Escherichia coli (SgaH), Enterococcus faecalis (KEF), Salmonella typhimurium (KST) and Streptococcus pneumonia (KSP), respectively, for mutational studies. The OMPDC orthologue from Methanobacter thermoautotrophicus (MtOMPDC maintained on a pET15b vector) was used as a control. 10.1 Site-Directed mutagenesis The frozen stocks of the enzymes were verified for its correct sequence after plasmid extraction. The table describes the primers used for mutation. Site directed mutants of KGPDC were constructed using Quikchange kit (Stratagene), according to manufacturer’s instructions. The method uses a double-stranded DNA vector with the insert in context and a set of primers complementary to opposite strands of the vector. Temperature cycling using the primers generates a mutated plasmid containing staggered nicks. A typical reaction (50 µL) contains 30 ng of plasmid template, 5 µL of 10X Pfu ultra amplification buffer, 125 ng of each complementary primers, 0.2 mM of each of the four dNTPs and 2.5 U of PfuUltra DNA polymerase. The mutated plasmid was generated using the following parameters: 95 OC for 30 sec, followed by 18 cycles of 95 OC for 30 sec, 55 OC for 1 min and 68 O C for 17 min. Following temperature cycling, the products were incubated with 1 µL of DpnI endonucleases (Stratagene) and incubated at 37 O C for 2-3 hours. DpnI being specific for methylated and hemi-methylated DNA digests the parental DNA, thus allowing the selection of mutation containing synthesized DNA. This is followed by dialysis at room temperature for 30 min and transformation in to XL1-Blue competent cells. The plasmids were extracted and transformed in to BL21 cells for expression. 70 These single mutants are used as templates for creation of double and triple mutants. The mutant primers employed in the study are designed based on the instructions given in Quikchange protocol and the corresponding sequences of primers are shown in appendix 3. 10.2 OMPDC-negative E.coli selection strain (WSY102) The OMPDC-negative E.coli selection strain (WSY102) was constructed using the method described by Datsenko and Wanner [39] and the frozen stocks were available in our lab using which the electrocompetent cells were prepared according to the methods mentioned earlier. 10.3 Transformation of mutants into WSY102 The mutants were transformed into WSY102 competent cells, in the same way as transformation carried out in an XL1-Blue competent cells and plated on to LB agar plates containing the antibiotics Ampicillin (100 µg/mL), Chloramphenicol (25 µg/mL) and Kanamycin (50 µg/mL). These plates were incubated overnight at 37 OC. 10.4 Complementation growth studies In our study, we undertook a very powerful selection strategy for exploring the correct mutants of KGPDC that can be complemented to perform the OMPDC-catalyzed reaction. We used the wild-type orthologues of KGPDC which included SgaH, KEF, KSP and KST, respectively, for our experiments. The OMPDC orthologue from Methanobacter was used as a control . The mutated strains were grown in M9 minimal medium and the aerobic growth was monitored. The aerobic growth studies in liquid cultures were performed at 37 OC. The colonies 71 obtained from the LB agar plates were grown in LB broth containing the antibiotics Ampicillin (100 µg/mL), Chloramphenicol (25 µg/mL) and Kanamycin (50 µg/mL). This overnight culture is pelleted and the pellet was resuspended in 1X M9 minimal salts medium and subcultured in 1X M9 minimal medium containing glucose and one set without glucose to serve as control. Aliquots of 30 µL was inoculated into 13x100 mm borosilicate glass culture tubes (Fisher Scientific) fitted with steel lanced culture tube closures containing 3 mL of 1X M9 minimal medium containing 50 mM glucose, 1 mM IPTG and 100 µg/mL Ampicillin. The cell density of the aerobic growth was measured at OD600 using a Spectrophotometer. We also plated the cultures on to M9 minimal agar medium containing 50mM glucose, 1mM IPTG and 100µg/mL Ampicillin and incubated the plates at 37 OC within humidified boxes. The results of the readings measured during the aerobic growth study were plotted as a graph using MS-excel against the time scale. 10.5 Purification of Methanobacter OMPDC The OMPDC-pET15b clone was obtained from the laboratory and the purification of MtOMPDC was followed according to previously described protocol by Wood (2009). The MtOMPDC in pET15b vector was transformed into BL21 and the liquid culture of LB containing the transformed MtOMPDC in pET15b was over-expressed with 0.5 mM IPTG and incubated for 18 hours at 37 O C. The protein was purified using the nickel affinity chromatography in an FPLC system. The purified protein was then concentrated and frozen as pellets in liquid nitrogen. The enzyme concentration was determined at 280 nm using an extinction coefficient of 6085 M-1 cm-1. 72 Chapter 11: Results 11.1 Aerobic growth curves 11.1.1Complementation growth curve of Wildtype MtOMPDC in auxotrophic strain (WSY102) The OMPDC from Methanobacter serves as a control strain to study the complementation of growth in an auxotrophic strain devoid of OMPDC activity. The presence of the OMPDC complements the growth of the WSY102 in a M9 minimal medium. By comparing the results of wild-type OMPDC and mutant KGPDC, the growth pattern can be observed. MtOMPDC OD at 600nm 0.5 0.4 0.3 0.2 MtOMPDC 0.1 0 -50 0 50 100 150 Time (Hours) Graph 1: Growth curve of MtOMPDC complemented in WSY102 auxotrophic strain and grown on M9 minimal medium. 73 11.1.2 Complementation of growth in KGPDC mutants 11.1.2.1 Results of E33K single mutants of KGPDC The single mutants of E33K were created using Quikchange mutagenesis as mentioned in the experimental protocol. The results of the single mutants were verified by sequencing and the verified clones were inoculated into M9 minimal medium to study the complementation of growth which is indicative of OMPDC activity. From the results, we could infer that the single mutation of E33K alone is not sufficient to effect OMPDC activity. No significant pattern was observed in the growth of E33K mutants in M9 minimal medium. In the graph, the blue line indicated the M9 minimal medium in the absence of glucose and red and green colour represented the duplicate growth curves of the mutants as observed in M9 minimal medium containing glucose. 11.1.2.1.a SgaH 0.5 SgaH E33K mutant- WSY102- M9 Minimal OD at 600nm 0.4 0.3 0.2 SgaH 0.1 Linear (SgaH) 0 -50 0 50 100 150 Time (Hours) Graph 2: Growth curve of SgAH E33K mutant-WSY102-M9 Minimal Medium. 74 11.1.2.1.b KEF 0.5 KEF E33K- WSY102- M9 Minimal OD at 600nm 0.4 0.3 KEF 0.2 Linear (KEF) 0.1 Linear (KEF) 0 -50 0 50 100 150 Time (Hours) Graph 3: Growth curve of KEF E33K mutant-WSY102-M9 Minimal Medium. 11.1.2.1. c KSP 0.5 OD at 600nm 0.4 0.3 0.2 KSP 0.1 0 -20 0 20 40 60 80 100 120 Time (Hours) Graph 4: Growth curve of KSP E33K mutant- WSY102- M9 Minimal Medium. 75 11.1.2.1.d 0.5 OD at 600nm 0.4 KST KST E33K mutant- WSY102- M9 Minimal 0.3 0.2 KST 0.1 0 0 50 100 150 Time (Hours) Graph 5: Growth curve of KST E33K mutant- WSY102- M9 Minimal Medium. 11.1.2.2 Results of E33K/W117S double mutants of KGPDC The single mutants of E33K were used as templates for creating the double mutants of E33K/W117S. The aerobic growth curve of these double mutants are shown below. The graph is plotted after growing these orthologues in the presence of glucose. We could infer that no positive growth pattern was observed even after two mutations. 76 0.0045 0.004 0.0035 OD at 600nm 0.003 0.0025 SgaH 0.002 KSP 0.0015 KEF 0.001 KST 0.0005 0 -0.0005 0 5 10 15 20 Time (Hours) Graph 6: : Growth curve of E33K/W117S double mutants of SgAH, KEF, KSP and KST in WSY102- M9 Minimal Medium. 11.1.2.3 Results of W117S/G171Q double mutants of KGPDC The single mutants of W117S were used as a template to construct these double mutants, the results of which are shown below. After 72 hours, we were able to detect some growth in the M9 liquid medium with the double mutant of W117S and G171Q. In order to deconvolute these results, we tried plating 100 µL of the culture of the mutants transformed into WSY102 onto M9 minimal agar plates and incubated in a moist chamber at 37 OC. No colonies were observed even after 2 weeks of incubation. 77 11.1.2.3.a SgaH OD at 600nm 0.45 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 -100 SgaH W117S SgaH Avg 0 100 200 300 400 Time (Hours) Graph 7: Growth curve of SgAH W117S mutant- WSY102- M9 Minimal Medium 11.1.2.3.b KEF 0.25 OD at 600nm 0.2 0.15 KEF W117S 0.1 KEF W117S Avg Glu 0.05 0 -100 0 100 200 300 400 Time (Hours) Graph 8: Growth curve of KEF W117S mutant- WSY102- M9 Minimal Medium. 78 11.1.2.3.c KSP 0.045 0.04 0.035 0.03 KSP W117S 0.025 0.02 KSP W117S Avg Glu 0.015 0.01 0.005 0 -100 0 100 200 300 400 Graph 9: Growth curve of KSP W117S mutant- WSY102- M9 Minimal Medium. 11.1.2.3.d KST 0.6 OD at 600nm 0.5 0.4 0.3 KST W117S 0.2 KST W117S Avg Glu 0.1 0 0 100 200 300 400 Time (Hours) Figure 5: Growth curve of KST W117S mutant- WSY102- M9 Minimal Medium. 79 11.1.2.4 Results of E33K/G171Q double mutants of KGPDC The single mutants of E33K were used as a template to construct these double mutants, the results of which are shown in the following page. Just as the W117S/G171Q, the double mutants of E33K/G171Q were showing a sluggish growth pattern after 100 hours. The blue and red colors shown in the graph below represented the growth of these mutants in the absence of glucose and the green and purple color represented the growth pattern observed in the presence of 50 mM D-glucose. The clones that were growing in the liquid medium were inoculated on the M9 agar plates. But no colonies were observed on the plates. This time we repeated the experiment on liquid medium again and the results were consistent with those observed earlier with liquid medium. This ruled out the option of possible contaminants in the medium. We deduced that these double mutation are insufficient for OMPDC activity and proceeded with selection using triple mutants. OD at 600nm 11.1.2.4.a -50 SgaH 0.5 0.45 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 SgaH 0 50 100 150 Time (Hours) Graph 10: Growth curve of SgAH E33K/G171Q double mutants- WSY102- M9 Minimal Medium 80 OD at 600nm 11.1.2.4.b KEF 0.5 0.45 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 KEF 0 50 100 150 Time (Hours) Graph 11: Growth curve of KEF E33K/G171Q double mutant- WSY102-M9 Minimal Medium. OD at 600nm 11.1.2.4.c -50 KSP 0.5 0.45 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 KSP 0 50 100 150 Time (Hours) Graph 12: Growth curve of KSP E33K/G171Q double mutant- WSY102-M9 Minimal Medium. 81 11.1.2.4.d KST OD at 600nm 0.5 0.45 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 -50 KST 0 50 100 150 Time (Hours) Graph 13: Growth curve of KST E33K/G171Q double mutant-WSY102-M9 Minimal medium. 11.1.2.5 Results of E33K/W117S/G171Q triple mutant The triple mutant of E33K/W117S/G171Q was constructed from double mutants and the results are shown in the following page. The growth was observed in triple mutant but the growth pattern was not so uniform even with duplicate copies. In one of the triple mutant orthologues (KST) a positive growth curve was observed just like the pattern observed for wild type OMPDC. Another orthologue, KSP did not successfully transform after triple mutation, and also the sequencing result of the triple mutant was not correct. So we could not proceed further with the growth studies. 82 OD at 600nm 11.1.2.5.a SgaH 0.45 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 -100 SgaH G171Q SgaH G171Q Avg Glu 0 100 200 300 400 Time (Hours) Graph 14: Growth curve of SgAH E33K/W117S/G171Q triple mutant- WSY102-M9 Minimal medium. 11.1.2.5.b KEF 0.45 0.4 OD at 600nm 0.35 0.3 0.25 0.2 KEF G167Q 0.15 KEF G167Q Avg Glu 0.1 0.05 0 -100 0 100 200 300 400 Time (Hours) Graph 15: Growth curve of KEF E33K/W117S/G171Q triple mutant- WSY102- M9 Minimal Medium. 83 OD at 600nm 11.1.2.5.c KST 0.5 0.45 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 -100 KST G171Q KST G171Q Avg Glu 0 100 200 300 400 Time (Hours) Graph 16: Growth curve of E33K/W117S/G171Q triple mutant-WSY102-M9 Minimal Medium. 11.2 Results for Purification of MtOMPDC The OMPDC from Methanobacter is a 25kDa protein and is seen in the gel picture provided below. The expression was checked at 37 OC and also 25 OC for 18 hours, the protein over-expressing at both conditions. But for large scale purification of the protein, the experimental protocol mentioned in the reference paper was followed and the protein was over expressed at 37 OC for 18 hours after induction with 0.5 mM IPTG. The recombinant protein contains 6-his tag and is purified by a nickel affinity chromatography. The results are shown in the following page (fig 11.14). 84 L F1 F2 F3 Purified Protein Fractions IS IP L Figure 11.6: Purification of Methanobacter OMPDC at 37 OC. The lane 1 contains the protein ladder (L), lanes 2,3 and 4 contains the wash fractions(F1, F2, F3), lanes 5-11 contains the purified protein, lane 12 contains the supernatant(IS), lane 13 contains the pellet(IP) and the lane 14 contains the protein marker(L). 85 Chapter 12:Discussion In nature, the enzymes are evolved to perform an astonishing array of reactions. Deciphering the mechanism of catalysis of these enzymes by exploring the possibilities of protein engineering not only serves to elucidate the function of these enzymes and the structural insights, but also aids in the therapeutic application. There are not many proven successes in protein engineering since this is still a relatively difficult and intractable field. One notable success is the de novo design of the stable protein whose topology has not been observed in nature [40]. The knowledge of structure-function relationships of the conservation of the residues in the catalytic motifs or the active site architecture can be exploited to identify an appropriate protein scaffold for protein engineering [41-43]. OMPDC and KGPDC belong to the active-site architecture constrained suprafamily where the active site architecture is conserved through the orientation and placement of residues. In a study conducted on 24 pairs of homologous enzymes by Bartlett, 6 pairs enzymes that share no common mechanistic attribute but with a conserved active site architecture has been identified [44]. One of them is the OMPDC suprafamily [45, 46]. 12.1 Aerobic growth of Mutant libraries The aerobic growth curves, as observed, do not show a significant growth pattern with the single mutant E33K. However with the double mutants of E33K and G171Q, a deliberate growth pattern was observed after 100 hours in case of all these KGPDC orthologues, but with no proper consistency. No growth was observed with the double mutant of E33K/W117S. 86 In order to evaluate the accuracy of these results, we tried plating the E33K/G171Q double mutants that showed a considerable growth in liquid media, onto M9 minimal agar plates. To our disappointment, even after 2 weeks no colonies were observed on M9 plates. With this we came to a conclusion that these mutations are not enough for the KGPDC orthologues to complement the function of OMPDC-catalyzed reaction. In the same way, the growth patterns observed with the double mutant of W117S/G171Q and the triple mutant of E33K/W117S/G171Q was also rechecked for the consistency of the results. All these provided clues that these 3 critical mutations alone are not enough for the KGPDC orthologues to complement the OMPDC function and that further mutations are needed which might be decided on rational basis or through an error prone PCR and subsequent transformation of these mutated KGPDC orthologues in to the OMPDC auxotrophic strain might allow powerful selection of a clone that can catalyze the OMPDC catalyzed reaction. Sequencing results might reveal the critical mutations that might be needed for KGPDC to complement OMPDC function. 12.2 Purification of MtOMPDC The OMPDC from Methanobacter was isolated and purified according to available protocols and we obtained a yield of 21.8 mg/mL of protein after concentration. This concentrated protein was frozen as pellets using liquid nitrogen and stored at -80 OC to carry out further assays. 87 Chapter 13: Future work We had planned to assay for the activity of the wild-type OMPDC enzyme in the presence of a highly reactive fluorinated-substrate as performed earlier. Also we will perform the assay for the mutant KGPDC soon after it is found complementing the OMPDC function. In order to complement the function of OMPDC on a KGPDC domain, sometimes cavitation might be required so that the bulkier substrate OMP can be accommodated in the active site which was designed for accommodating the substrate KGP otherwise. Further mutations might be rationally designed and also random mutagenesis using error prone PCR can be planned and further transformation into WSY102 might allow a powerful selection strategy for declaring the correct clone. Studies on the loop dynamics might be necessary in the case of OMPDC and essentially the length, sequences and position of the loop, torsional symmetry, overall topology of the loop, acceleration of the loop and the information of hinge region of the loop. These may aid in arriving at an elucidation of the reaction mechanism of the OMPDC-catalyzed reaction. 88 PART 3: Targeted Drug Discovery against Plasmodium falciparum 89 Chapter 14: Introduction According to WHO, the morbidity and the mortality rate due to the malarial disease increases every year and the occurrence is mainly supercilious in under-developed and developing countries. For many years, artemisinin protracts to be an effective drug against the malarial parasite. Due to the rampant prophylactic use of artemisinin and ACT (Artemisininbased combination therapies), the malarial parasite gains resistance which has been reported recently [47-49]. In an effort to combat malaria, it is crucial that new drugs have to be developed with novel mechanisms [4]. 14.1 Aim of the project Using the structural and sequence disparity between the Plasmodium’s OMPDC and Human OMPDC, we propose to develop an inhibitor that specifically targets Plasmodium falciparum’s OMPDC. 14.2 Human OMPDC In humans, OMPDC does not exist as a monomeric enzyme but exists as a dimer of UMP Synthase performing the reactions catalyzed by OPRTase (Orotate phosphor ribosyl transferase) and OMPDC (Orotidine-5’-monophosphate decarboxylase). UMP synthase (UMPS) catalyzes the last two steps of de novo pyrimidine nucleotide synthesis and has been recognized as a potential cancer drug target. OMPDC is contained in the C-terminal domain of UMPS. OMPDC is cofactor-less, yet is a tremendously efficient enzyme. There have been never-ending arguments over the reaction catalyzed by OMPDC. Recent studies of OMPDC conducted by Gerlt and their team proposes a non-covalent decarboxylation mechanism via high-energy intermediate (vinyl-carbanion). 90 Currently there are 36 crystal structures of human OMPDC deposited in RCSB-Protein data bank (PDB) which includes the enzyme in complex with substrate, product, and nucleotide inhibitors. Unexpectedly, simple compounds can replace the natural nucleotides and induce a closed conformation of OMPDC [50], defining a tripartite catalytic site. In order to be used as an efficient drug, these inhibitors must meet to maximize therapeutic effects and minimize crossspecies activity. Figure 14.1 Human UMPS (OMPDC containing domain) showing active site architecture. The active site residues are shown in forest green and the enzyme UMPS is shown in cyan. The right panel shows the close up view of OMPDC bound to the substrate UMP with active site residues colored by element using Chimera. 14.3 Plasmodium’s OMPDC As seen in the previous part, the enzyme OMPDC operates in the de novo pyrimidine biosynthesis pathway culminating in cytosine and thymine nucleotides. There is an alternate 91 pathway to the de novo pathway which is the salvage pathway which salvages the pyrimidine nucleotides. Some eukaryotic parasites, such as Plasmodium falciparum (the causative agent for malaria), are able to utilize only the de novo pathway. Hence the inhibition of the intraerythrocytic parasite’s OMPDC which operates in the de novo pathway might be a promising target, in an effort to combat the battle against the disease caused by the malarial parasite. Plasmodium’s OMPDC is approximately a 38 kDa protein and studies also suggests that the protein is a homodimer and the active site residues are contributed by the dimeric interface [51]. Currently, there are 11 structures of Plasmodium falciparum, with and without ligands, deposited in Protein Data Bank (PDB). These structural informations give a great wealth of information to specifically target a drug against the malarial parasite’s OMPDC. Based on the disparity between human and Plasmodium’s OMPDC, a drug that acts as an exclusive inhibitor of the Plasmodium’s OMPDC which might have a minimal or no effect on its human host. In Plasmodium parasites, pyrimidine nucleotides are synthesized de novo via a six-step pathway. One of the steps in the de novo pathway for the biosynthesis of pyrimidines involves the addition of a ribosyl phosphate group to orotic acid by orotate phosphoribosyltransferase (OPRT), resulting to orotidine 5'-monophosphate (OMP). Subsequently, orotidine 5'monophosphate decarboxylase (OMPDC) catalyses the removal of the carboxyl group from OMP to produce, uridine monophosphate (UMP), from which all pyrimidine nucleotides can be derived. This decarboxylation step is accelerated by a factor of 10 17 without the benefit of a catalytic cofactor by OMPDC, making it the most efficient of all enzymes. Despite the enormous availability of the structures of OMPDC in many organisms in apo form and in complexes with UMP and its analogs, including 6-hydroxyuridine 5'-monophosphate 92 (BMP) and 6-azauridine 5'-monophosphate (aza-UMP), the mechanism of decarboxylation of OMP to UMP remains uncertain. In spite of conserved active site residues and geometry, OMPDC sequences are highly divergent (less than 30% sequence identity within the family) and split into four major subfamilies identified by sequences and the length of the loop at the end of the 7th β strand, which closes off the active site during catalysis.8 Although overall sequence identity can be very low, all OMPDCs fold into a dimer of (β/α)8 barrels with precisely placed and highly conserved. It has been suggested by Langley (2008) that the conformational flexibility observed in the phosphate-binding loop and the β5α loop might be a reason in the sequestration of the substrate and further release of the product[51]. Figure 14.2: Structure of plasmodium OMPDC (2FFC) bound to UMP. The protein is shown in white while the ligand is shown in yellow. The active site residues contributing to the catalytic activity are shown in other colours. 93 Thr225 Thr226 Pro295 Gln200 Arg325 Asn135 Lys133 Figure 14.3: Close up snapshot of Plasmodium OMPDC bound to UMP. The ligand is shown in yellow colour and the protein is shown in grey colour. Other functional groups are: Green -Thr 225 and Thr 226 , Salmon- Lys133 and Lys169, Magenta- Gln 300, Cyan- Pro295, Orange redAsp41 & Asp 167 , Sea Green- Asn 135, Bubblegum pink- Arg325 . These numberings are according to the Plasmodium species. This image is generated from Chimera. 14.4 Inhibitors to Plasmodium OMPDC in the past Literature studies shows that even though there are so many available inhibitors screened for its activity, these compounds are considered unsuitable to be used as therapeutics because the inhibitory constants (Ki) are in micromolar (µM) range and so further optimization is required for these compounds or new compounds have to be screened for their use as effective drugs. Few inhibitors that have been used in the past by the researchers [52] is shown in Figure 14.4. 94 Figure 14.4: Chemical structures of inhibitors used in the study of OMPDC [51] (a) OMP, the substrate of OMPDC (b) UMP, the product obtained from the catalysis of OMPDC-catalyzed reaction (c) AzaUMP, (d) BMP, (e) Pyrazofurin 5′-monophosphate, (f) XMP, and (g) allopurinol-3 riboside 5’-monophosphate . These structures are drawn using Chemdraw. 95 Chapter 15: Species-specific design of Inhibitor Inhibiting the pyrimidine biosynthetic pathway enzyme, OMPDC has more pitfalls than advantages. This includes the toxic effects of blocking the pyrimidine pathway which might lead to blockage in the synthesis of important downstream products [53], interference with the immune cells that are involved in the defense mechanism of the host [54], and the risk in orotic aciduria being induced [50] . Time and again, it is not new to use these inhibitors as effective drug compounds against the pathogens at least for a short-term treatment for various infections. The prime thing of focus in using these compounds as a species-specific inhibitor should be that these compounds must have a minimal cross-reactivity with the human host, thereby avoiding any negative impact caused by the drug while administering for human infections. In the past, literature work claims the activity of 6-iodo uridine to act as an anti-malarial compound [55] by having a covalent inhibition with the catalytic lysine residue in the catalytic triad [D-x-K-x-x-D]. since these residues are not absent from humans, being highly conserved residues, the idea of using 6-iodo uridine as an anti-malarial compound has to be ruled out to avoid the problems due to inadequate species-specificity. There is a suggestion made in one work [50], to develop an inhibitor molecule by exploiting the CO2 binding cavity by substituting the C6 carbon in order to produce a kink in the substrate-enzyme complex (OMP-OMPDC). Also the author suggests the use of a substrate that can be converted by OPRT in to an inhibitor compound which might target the malarial parasite specifically. One should also expect the tediousness in designing these inhibitors which might have a higher potential against a specific-species. In our work, we proposed to exploit the differing 96 functional residues between Human and Plasmodium, thereby the inhibitor developed is specific against the sequence of Plasmodium meanwhile being less detrimental to the host. 15.1 Differing residues between Plasmodium and Human OMPDC enzymes The common D-x-K-x-x-D pattern is seen in all the orthologues of OMPDC. The phosphate dianion binding site at R203 position is also retained and conserved throughout the family. Albeit these commonness, there are two residues found differing between the human and plasmodium’s OMPDC. Despite the conserved regions among all these Plasmodium species, the phosphate binding loop is of varied length and sequence (Fig 15.2). In the malarial structures of UMP complexes, the OD1 oxygen of an Asparagine residue (N104) is positioned to form bifurcated hydrogen bonds with the 2′- and 3′ -hydroxyls of the ribose. The analogous residue in the human structure is a histidine (H283). The bacterial enzymes have a Glycine at this position. Another difference is that the human enzymes have additional Serine (S257) hydrogen bonding the 3′ - hydroxyl of the ribose. This residue is replaced by a Glycine residue in the malarial structures (G21, or an Alanine in most prokaryotic structures), and a water molecule makes the analogous hydrogen bond. The residues N104 and G21 of the malarial structures are replaced by H283 and S257 in the human structure (Figure 15.1). More minor differences between human and malarial enzymes include the conservative substitution of several residues of the R5- loop (T195 replaced by S372 and N196 replaced by S373), and a methionine residue projecting from the R5-loop (M371) of the human enzyme is replaced by M168B from the B-subunit of the malarial enzyme (Figure 15.1) while the corresponding position of M371 in Plasmodium is a T194 residue. 97 Figure 15.1: Human and Plasmodium OMPDC differing catalytic residues [51]. The catalytic residues N104 and G21 of the malarial structures are replaced by H283 and S257 respectively in the human structure. The T195 residue in Plasmodium is substituted by a more similar S372. Black colour represents the malarial OMPDC residues while pink colour represents the human OMPDC residues. The green colour represents the product, UMP. 98 Figure 15.2: Sequence alignment of OMPDC from different organisms shows a conserved DKD motif. The sequences were retrieved from NCBI and an alignment was done using the clustalx2 software. 99 Chapter 16: Discussion From the above bioinformatics analysis of the structures of human and Plasmodium OMPDC, very few clues are available to the species-specific inhibitor design. From the structure-based sequence alignment, it is revealed that only two differing residues are of considerable interest: N104 and G21. The available information suggests that the Asparagine residue is involved in hydrogen bonding with the 2’- and 3’- hydroxyl groups in case of Plasmodium. In the case of humans, this asparagine is replaced with a histidine in the corresponding region. All the other bacterial species show a glycine in the same position. In the bacterial species, not much emphasis is laid on the catalytic importance of this residue, except the information that this residue is found near the regions of catalysis. The next important residue is glycine that hydrogen bonds the 3’-hydroxyl of ribose moiety in Plasmodium. In humans, this residue is replaced by serine while the bacterial species contain an alanine in the corresponding position. Other least important residues such as threonine, T195 (Plasmodium) which corresponds to serine, S372 (Human) and the methionine (change in the position of the residue) are of least importance in our topic. Since threonine and serine are related class of amino acids containing similar functional group, we did not target these residues. As discussed previously in part 1 of the thesis, we attempted to screen for inhibitor compounds against the available flavonoid library in our laboratory. 100 Chapter 17: Future Directions From these initial results of Bioinformatics analysis, it is possible to conclude that we can design small hydrophobic compounds targeting the N104 and G21 residues. It is clear from the available information that 6-aza UMP and XMP bind preferentially to the Plasmodium’s OMPDC when compared to human OMPDC. Hence, a further detailed analysis is required to analyze the protein-inhibitor complex and efforts can be made to exploit the function of OMPDC. As mentioned in the previous part of this thesis, once the mechanism of OMPDC is clearly elucidated, it might serve as constructive information in order to study the Plasmodium’s OMPDC enzyme. Also, as per the suggestion by Wittmann (2008) [50], an attempt can be made to synthesize an inhibitor compound from OPRT, thereby increasing the specificity of the drug against Plasmodium falciparum. The availability of the library of flavonoid compounds (Appendix 2) in our laboratory does not stop us from trying to screen these compounds as inhibitors against the Plasmodium’s OMPDC enzyme. 101 References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. Li, X.Z. and H. Nikaido, Efflux-mediated drug resistance in bacteria: an update. Drugs, 2009. 69(12): p. 1555-623. Herrmann, K.M., The Shikimate Pathway: Early Steps in the Biosynthesis of Aromatic Compounds. Plant Cell, 1995. 7(7): p. 907-919. Herrmann, K.M., The shikimate pathway as an entry to aromatic secondary metabolism. Plant Physiol, 1995. 107(1): p. 7-12. Frederickson, M., et al., Selective Inhibition of Type II Dehydroquinases. J Org Chem, 1999. 64(8): p. 2612-2613. Herrmann, K.M. and L.M. Weaver, The Shikimate Pathway. Annu Rev Plant Physiol Plant Mol Biol, 1999. 50: p. 473-503. Duncan, K., Identification and validation of novel drug targets in tuberculosis. Curr Pharm Des, 2004. 10(26): p. 3185-94. Han, C., et al., Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori. FEBS J, 2006. 273(20): p. 4682-92. Han, C., et al., Discovery of Helicobacter pylori shikimate kinase inhibitors: bioassay and molecular modeling. Bioorg Med Chem, 2007. 15(2): p. 656-62. Barcellos, G.B., R.A. Caceres, and W.F. de Azevedo, Jr., Structural studies of shikimate dehydrogenase from Bacillus anthracis complexed with cofactor NADP. J Mol Model, 2009. 15(2): p. 147-55. Roberts, F., et al., Evidence for the shikimate pathway in apicomplexan parasites. Nature, 1998. 393(6687): p. 801-5. Floss, H.G., Combinatorial biosynthesis--potential and problems. J Biotechnol, 2006. 124(1): p. 242-57. Veitch, N.C. and R.J. Grayer, Flavonoids and their glycosides, including anthocyanins. Nat Prod Rep, 2008. 25(3): p. 555-611. Horinouchi, S., Combinatorial biosynthesis of non-bacterial and unnatural flavonoids, stilbenoids and curcuminoids by microorganisms. J Antibiot (Tokyo), 2008. 61(12): p. 709-28. Van Damme, M., et al., Identification of arabidopsis loci required for susceptibility to the downy mildew pathogen Hyaloperonospora parasitica. Mol Plant Microbe Interact, 2005. 18(6): p. 58392. van Damme, M., et al., Arabidopsis DMR6 encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. Plant J, 2008. 54(5): p. 78593. Pelletier, M.K., J.R. Murrell, and B.W. Shirley, Characterization of flavonol synthase and leucoanthocyanidin dioxygenase genes in Arabidopsis. Further evidence for differential regulation of "early" and "late" genes. Plant Physiol, 1997. 113(4): p. 1437-45. Turnbull, J.J., et al., Purification, crystallization and preliminary X-ray diffraction of anthocyanidin synthase from Arabidopsis thaliana. Acta Crystallogr D Biol Crystallogr, 2001. 57(Pt 3): p. 425-7. Besseau, S., et al., Flavonoid accumulation in Arabidopsis repressed in lignin synthesis affects auxin transport and plant growth. Plant Cell, 2007. 19(1): p. 148-62. Shimada, N., et al., A cluster of genes encodes the two types of chalcone isomerase involved in the biosynthesis of general flavonoids and legume-specific 5-deoxy(iso)flavonoids in Lotus japonicus. Plant Physiol, 2003. 131(3): p. 941-51. Kuittinen, H. and M. Aguade, Nucleotide variation at the CHALCONE ISOMERASE locus in Arabidopsis thaliana. Genetics, 2000. 155(2): p. 863-72. 102 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. Ralston, L., et al., Partial reconstruction of flavonoid and isoflavonoid biosynthesis in yeast using soybean type I and type II chalcone isomerases. Plant Physiol, 2005. 137(4): p. 1375-88. Jez, J.M., et al., Structure and mechanism of the evolutionarily unique plant enzyme chalcone isomerase. Nat Struct Biol, 2000. 7(9): p. 786-91. Wise, E.L., et al., Evolution of enzymatic activities in the orotidine 5'-monophosphate decarboxylase suprafamily: crystallographic evidence for a proton relay system in the active site of 3-keto-L-gulonate 6-phosphate decarboxylase. Biochemistry, 2004. 43(21): p. 6438-46. Gerlt, J.A. and P.C. Babbitt, Divergent evolution of enzymatic function: mechanistically diverse superfamilies and functionally distinct suprafamilies. Annu Rev Biochem, 2001. 70: p. 209-46. Traut, T.W. and B.R. Temple, The chemistry of the reaction determines the invariant amino acids during the evolution and divergence of orotidine 5'-monophosphate decarboxylase. J Biol Chem, 2000. 275(37): p. 28675-81. Akana, J., et al., D-Ribulose 5-phosphate 3-epimerase: functional and structural relationships to members of the ribulose-phosphate binding (beta/alpha)8-barrel superfamily. Biochemistry, 2006. 45(8): p. 2493-503. Jelakovic, S., et al., Structure and catalytic mechanism of the cytosolic D-ribulose-5-phosphate 3epimerase from rice. J Mol Biol, 2003. 326(1): p. 127-35. Miller, B.G., et al., Anatomy of a proficient enzyme: the structure of orotidine 5'-monophosphate decarboxylase in the presence and absence of a potential transition state analog. Proc Natl Acad Sci U S A, 2000. 97(5): p. 2011-6. Wierenga, R.K., The TIM-barrel fold: a versatile framework for efficient enzymes. FEBS Lett, 2001. 492(3): p. 193-8. Hocker, B., et al., Dissection of a (betaalpha)8-barrel enzyme into two folded halves. Nat Struct Biol, 2001. 8(1): p. 32-6. Barona-Gomez, F. and D.A. Hodgson, Occurrence of a putative ancient-like isomerase involved in histidine and tryptophan biosynthesis. EMBO Rep, 2003. 4(3): p. 296-300. Schmidt, D.M., et al., Evolutionary potential of (beta/alpha)8-barrels: functional promiscuity produced by single substitutions in the enolase superfamily. Biochemistry, 2003. 42(28): p. 838793. Miller, B.G. and R. Wolfenden, Catalytic proficiency: the unusual case of OMP decarboxylase. Annu Rev Biochem, 2002. 71: p. 847-85. Appleby, T.C., et al., The crystal structure and mechanism of orotidine 5'-monophosphate decarboxylase. Proc Natl Acad Sci U S A, 2000. 97(5): p. 2005-10. Begley, T.P., T.C. Appleby, and S.E. Ealick, The structural basis for the remarkable catalytic proficiency of orotidine 5'-monophosphate decarboxylase. Curr Opin Struct Biol, 2000. 10(6): p. 711-8. Toth, K., et al., Product deuterium isotope effect for orotidine 5'-monophosphate decarboxylase: evidence for the existence of a short-lived carbanion intermediate. J Am Chem Soc, 2007. 129(43): p. 12946-7. Van Vleet, J.L., et al., Carbon isotope effect study on orotidine 5'-monophosphate decarboxylase: support for an anionic intermediate. Biochemistry, 2008. 47(2): p. 798-803. Warshel, A., et al., Remarkable rate enhancement of orotidine 5'-monophosphate decarboxylase is due to transition-state stabilization rather than to ground-state destabilization. Biochemistry, 2000. 39(48): p. 14728-38. Datsenko, K.A. and B.L. Wanner, One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A, 2000. 97(12): p. 6640-5. 103 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. Kuhlman, B., et al., Design of a novel globular protein fold with atomic-level accuracy. Science, 2003. 302(5649): p. 1364-8. Babbitt, P.C. and J.A. Gerlt, New functions from old scaffolds: how nature reengineers enzymes for new functions. Adv Protein Chem, 2000. 55: p. 1-28. Gulick, A.M., et al., Evolution of enzymatic activities in the enolase superfamily: identification of the general acid catalyst in the active site of D-glucarate dehydratase from Escherichia coli. Biochemistry, 2001. 40(34): p. 10054-62. Minshull, J., et al., Predicting enzyme function from protein sequence. Curr Opin Chem Biol, 2005. 9(2): p. 202-9. Bartlett, G.J., N. Borkakoti, and J.M. Thornton, Catalysing new reactions during evolution: economy of residues and mechanism. J Mol Biol, 2003. 331(4): p. 829-60. Wise, E.L., et al., Structural evidence for a 1,2-enediolate intermediate in the reaction catalyzed by 3-keto-L-gulonate 6-phosphate decarboxylase, a member of the orotidine 5'-monophosphate decarboxylase suprafamily. Biochemistry, 2003. 42(42): p. 12133-42. Yew, W.S., et al., Evolution of enzymatic activities in the orotidine 5'-monophosphate decarboxylase suprafamily: mechanistic evidence for a proton relay system in the active site of 3keto-L-gulonate 6-phosphate decarboxylase. Biochemistry, 2004. 43(21): p. 6427-37. Dondorp, A.M., et al., Artemisinin resistance in Plasmodium falciparum malaria. N Engl J Med, 2009. 361(5): p. 455-67. Lim, P., et al., Pfmdr1 copy number and arteminisin derivatives combination therapy failure in falciparum malaria in Cambodia. Malar J, 2009. 8: p. 11. White, N.J., Qinghaosu (artemisinin): the price of success. Science, 2008. 320(5874): p. 330-4. Wittmann, J.G., et al., Structures of the human orotidine-5'-monophosphate decarboxylase support a covalent mechanism and provide a framework for drug design. Structure, 2008. 16(1): p. 82-92. Langley, D.B., et al., Structure and inhibition of orotidine 5'-monophosphate decarboxylase from Plasmodium falciparum. Biochemistry, 2008. 47(12): p. 3842-54. Bello, A.M., et al., Structure-activity relationships of C6-uridine derivatives targeting plasmodia orotidine monophosphate decarboxylase. J Med Chem, 2008. 51(3): p. 439-48. Christopherson, R.I., S.D. Lyons, and P.K. Wilson, Inhibitors of de novo nucleotide biosynthesis as drugs. Acc Chem Res, 2002. 35(11): p. 961-71. Quemeneur, L., et al., Restriction of de novo nucleotide biosynthesis interferes with clonal expansion and differentiation into effector and memory CD8 T cells. J Immunol, 2004. 173(8): p. 4945-52. Bello, A.M., et al., A potent, covalent inhibitor of orotidine 5'-monophosphate decarboxylase with antimalarial activity. J Med Chem, 2007. 50(5): p. 915-21. http://en.wikipedia.org/wiki/Antibiotic_resistance 57. Margaret E. Glasner, John A. Gerlt, and Patricia C. Babbitt (2007) :Mechanisms of Protein Evolution and Their Application to Protein Engineering in Advances in Enzymology and Related Areas of Molecular Biology Volume 75: Protein Evolution pp 193-239. 58. Science 15 March 2002 Wise DOI:10.1126/science.295.5562.1975c 104 Appendix 1- List of available flavonoids in the lab No. Y001 Y002 Y003 Y004 Y005 Y006 Y007 Y008 Y009 Y010 Y011 Y012 Y013 Y014 Y015 Y016 Y017 Y018 Y019 Y020 Y021 Y022 Y023 Y024 Y025 Y026 Y027 Y028 Y029 Y030 Y031 Y032 Y033 Y034 Y035 Y036 Y037 Y038 Y039 Y040 Y041 Name of Compound (-) Shikimic acid (-)-Catechin (-)-Epicatechin (-)-Epicatechin gallate (-)-Epicatechol (-)-Epi-gallo-Catechin (-)-Fisetinidol (+) Catechin ( Catechin (+) Epicatechol (+)-Taxifolin 1,2-Catechol Co-polymer 2,3-DihydroxyBenzoic acid 2,4-DihydroxyBenzoic acid 2,4-Dimethoxycinnamic acid 2',6'-Dihydro-4'-Methoxy-DihydroChalcone 2,6-Dihydroxyacetophenone 2-Hydroxychalcone 2-MethoxyCinnamic acid 2-Phenylchromone 3',4'-DihydroxyFlavone 3,4-Dihydroxyhydrocinnamic acid 3,5,7-TrihydroxyFlavone (aka Galangin from Extrasynthese) 3:4 Dimethoxycinnamic acid 3-HydroxyCoumarin 3-HydroxyFlavone 4,4'-TrihydroxyFlavone 4',5,7-TrihydroxyFlavanone 4',6,7-TrihydroxyisoFlavone 4-hydroxyChalcone 4-HydroxyCinnamic acid 4-Hydroxy-Coumarin 4'-HydroxyFlavanone 4-MethoxyCinnamic acid 4-MethylCinnamic acid 5,7-Dihydroxy-3',4',5'-TrimethoxyFlavone 5,7-Dihydroxy-4'-MethoxyFlavone 5-HydroxyFlavone 5-HydroxyFlavonone 6-HydroxyFlavone 7,4'-DihydroxyFlavanol Molecular Weight 174.16 290.28 290.28 442.37 290.28 306.28 274.27 290.28 290.28 290.28 304.27 154.13 154.13 208.22 272 152.15 224.27 178.19 222.24 254.25 182.17 270.25 208.21 162.15 238.25 270.25 270.25 270.25 224.27 164.16 162.15 240.27 178.19 162.19 344.33 284.26 238.25 238.25 238.25 254.24 Y042 Y043 Y044 Y045 Y046 Y047 Y048 Y049 Y050 Y051 Y052 Y053 Y054 Y055 Y056 Y057 Y058 Y059 Y060 Y061 Y062 Y063 Y064 Y065 Y066 Y067 Y068 Y069 Y070 Y071 Y072 Y073 Y074 Y075 Y076 Y077 Y078 Y079 Y080 Y081 Y082 Y083 Y084 Y085 Y086 Y087 Y088 Y089 Y090 Y091 7-HydroxyFlavone Acacetin Aesculine Alpha-MethylCinnamic acid Apigenin Apigenin-7-glucoside Apigeninidin Chloride Apiin Biochanin B-Methyl-Umbelliferone Butein Butin Chalcone Chalcone Chrysin Cinnamic acid Coumarin Cyanidanol-3 Cyanidin Chloride Cyanin chloride Daidzein Daidzin Daphnetin Datiscetin D-Catechin Tetrahydrate Delphinidin chloride DihydroFisetin Dihydroquercetin (aka Taxifolin) Dihydrorobinetin Diosmetin Diosmin Epicatechin (aka Y003) Epigallocatechin gallate Eriodictyol Eriodictyol-7-glucoside Ferrulic acid Ferulic acid Fisetin Fisetinidin Chloride Flavanone Flavanone hydrazone Flavanone-azine Flavene Flavone Flavonol Flavonol Na-salt Flavonone Formononetin Fustin Galangin 238.25 284.28 340.28 162.19 270.25 432.38 290.69 564.5 284.26 176.17 272.27 270.25 208.27 208.27 254.25 148.16 146.15 290.28 322.7 646.95 254.25 416.38 178.15 286.25 362.28 338.7 288.26 304.27 304.27 300.28 608.56 290.28 458.37 288.27 450.39 194.19 194.19 286.25 306.68 224.27 238.29 444.52 782 222.25 238.25 261.25 272 268.28 288.26 270.25 Y092 Y093 Y094 Y095 Y096 Y097 Y098 Y099 Y100 Y101 Y102 Y103 Y104 Y105 Y106 Y107 Y108 Y109 Y110 Y111 Y112 Y113 Y114 Y115 Y116 Y117 Y118 Y119 Y120 Y121 Y122 Y123 Y124 Y125 Y126 Y127 Y128 Y129 Y130 Y131 Y132 Y133 Y134 Y135 Y136 Y137 Y138 Y139 Y140 Y141 Gallic acid Genistein Genistin Gossypin Hamamelitannin Hesperetin Hesperidin Homoorientin Isoquercitrin Isorhamnetin Kaempferol Kinetin Leucocyanidin hydrate Linarin Luteolin Luteolin 3'-7-Diglucoside Luteolin 4'-glucoside Luteolin 7-glucoside Luteolinidin Chloride Marein Maritimein MethylChalcone Mono-7-Rutin Morin Morin dihydrate Morin hydrate Morin, Reagent Myricetin Myricitrin Naringenin Naringin Orientin Phenylacetic acid Phloretin Phloridzin Phloridzin dihydrate P-hydroxy-phenylacetic acid Puerarin Quebrachitol Quercetin Quercetin dihydrate Quercitrin Quercitrine Rhamnetin Rhoifolin Robinetin Robinin Rutin Rutin ex Sarrasin (Buckwheat) Rutinose 170.13 270.25 432.38 648.49 484.37 302.29 610.57 448.38 464.38 316.28 286.25 215.21 324.27 592.56 286.25 610.52 448.38 448.38 306.68 450.4 448.38 223.27 610 302.24 338.24 320.24 302.24 318.25 464.38 272.27 580.55 448.38 136.15 274.28 436.41 472.41 152.15 416.38 194.19 302.25 338.25 448.38 448.38 316.28 578.53 302.25 740.67 610.53 610.53 326.3 Y142 Y143 Y144 Y145 Y146 Y147 Y148 Y149 Y150 Y151 Y152 Y153 Y154 Sakuranetin Sakuranetin monohydrate Scopoletin Silybin Sinapic acid Sulfuretin Tangeretin tannic acid Techtochrysin Tectochrysin Umbelliferone Veratric acid Vitexin 286.29 304.29 192.17 482.45 224.22 270.25 372.38 772.57 268.28 268.28 162.15 182.18 432.38 Appendix 2: Nucleotide Sequences of enzymes used in the project TT5 Wild type Chalcone Flavanone Isomerase (741 bp) ATGTCTTCATCCAACGCCTGCGCCTCTCCGTCACCGTTCCCCGCCGTCACGAAGCTTC ATGTAGACTCCGTCACGTTTGTACCGTCCGTCAAGTCACCGGCCTCCTCCAATCCATT ATTCCTCGGCGGCGCCGGTGTCCGAGGCCTTGATATCCAAGGTAAATTCGTGATCTT CACCGTCATTGGAGTATACCTAGAGGGTAACGCCGTTCCTTCTCTATCTGTCAAGTG GAAGGGAAAAACTACGGAGGAGCTAACAGAATCTATCCCGTTCTTCCGTGAAATAG TCACCGGTGCGTTTGAGAAGTTTATCAAGGTGACAATGAAACTGCCGTTAACGGGAC AACAATATTCGGAGAAAGTGACGGAGAATTGTGTGGCTATATGGAAACAATTAGGG CTTTATACGGACTGTGAAGCTAAAGCTGTGGAGAAGTTCTTGGAGATCTTCAAGGAA GAAACATTCCCTCCCGGTTCATCGATCCTCTTCGCTCTCTCCCCTACCGGCTCTCTTA CGGTTGCGTTTTCGAAAGATGATAGTATCCCTGAAACCGGGATCGCTGTGATCGAGA ACAAATTGTTGGCGGAGGCGGTTCTGGAATCTATCATCGGGAAGAACGGTGTGTCA CCTGGCACTAGGTTAAGTGTTGCAGAAAGATTATCTCAGCTAATGATGAAGAACAA GGACGAAAAGGAAGTTAGTGATCACTCTGTTGAGGAAAAACTAGCCAAAGAGAACT GA DMR6 Wild type oxidoreductase flavonoid biosynthetic process (1026 bp) ATGGCGGCAAAGCTGATATCCACCGGTTTCCGTCATACTACTTTGCCGGAAAACTAT GTCCGGCCAATCTCCGACCGTCCACGTCTCTCTGAAGTCTCTCAACTCGAAGATTTC CCTCTCATCGATCTCTCTTCCACTGATCGATCTTTTCTCATCCAACAAATCCACCAAG CTTGTGCCCGATTCGGATTTTTTCAGGTCATAAATCACGGAGTTAACAAACAAATAA TAGATGAGATGGTGAGTGTTGCGCGTGAGTTCTTTAGCATGTCTATGGAAGAAAAAA TGAAGCTATATTCAGACGATCCAACGAAGACAACAAGATTATCGACGAGCTTCAAT GTGAAGAAAGAAGAAGTCAACAATTGGAGAGACTATCTAAGACTCCATTGTTATCC TATCCACAAGTATGTCAATGAGTGGCCGTCAAACCCTCCTTCTTTCAAGGAAATAGT AAGTAAATACAGTAGAGAAGTAAGAGAAGTGGGATTTAAAATAGAGGAATTAATAT CAGAGAGCTTAGGTTTAGAAAAAGATTACATGAAGAAAGTGCTTGGTGAACAAGGT CAACACATGGCAGTCAACTATTATCCTCCATGTCCTGAACCTGAGCTCACTTACGGT TTACCTGCTCATACCGACCCAAACGCCCTAACCATTCTTCTTCAAGACACTACTGTTT GCGGTCTCCAGATCTTGATCGACGGTCAGTGGTTCGCCGTTAATCCACATCCTGATG CTTTTGTCATCAACATAGGTGACCAGTTACAGGCATTAAGTAATGGAGTATACAAAA GTGTTTGGCATCGCGCTGTAACAAACACAGAAAATCCGAGACTATCGGTCGCATCGT TTCTGTGCCCAGCTGACTGTGCTGTCATGAGCCCGGCCAAGCCCTTGTGGGAAGCTG AGGACGATGAAACGAAACCAGTCTACAAAGATTTCACTTATGCAGAGTATTACAAG AAGTTTTGGAGTAGGAATCTGGACCAAGAACATTGCCTCGAGAATTTTCTAAACAAC TAA CI2 Wild type Chalcone-flavanone isomerase family protein (630 bp) ATGGGAACAGAGATGGTCATGGTTCACGAGGTTCCTTTTCCTCCACAGATCATCACT TCCAAGCCACTCTCTCTTCTGGGCCAAGGGATCACAGACATTGAGATCCACTTTCTT CAAGTGAAGTTCACTGCGATCGGAGTTTACTTAGATCCTTCAGATGTTAAAACACAT CTTGATAACTGGAAAGGCAAAACCGGAAAAGAACTCGCCGGCGATGATGACTTCTT CGACGCCCTTGCCTCCGCGGAGATGGAGAAGGTTATAAGAGTGGTGGTGATAAAGG AGATAAAAGGAGCTCAGTACGGAGTGCAGCTAGAGAATACGGTGAGAGATCGTTTG GCTGAGGAGGATAAGTACGAGGAAGAAGAAGAAACTGAGCTCGAGAAGGTCGTTG GCTTTTTCCAGTCCAAGTACTTCAAAGCTAACTCCGTTATCACTTACCATTTCTCAGC CAAAGATGGCATTTGCGAGATCGGGTTTGAGACGGAAGGTAAAGAAGAGGAGAAA CTGAAGGTGGAGAATGCGAATGTGGTGGGAATGATGCAGAGATGGTATTTGTCCGG AAGTCGTGGAGTCTCACCGTCGACTATTGTCTCCATCGCTGATTCAATCTCCGCAGTT TTAACCTAA CI3 Wild type Chalcone isomerase (840 bp) ATGGTTTCGTTTCGCTTCCCTTTCTCGTTTTCTCAGCCCCCGCGTGCCACCACGTCATT CTCCGGATTCTCCATTTCCGCTGTCGCTGTCTCCGTCACCGTTGGCGCCGCAGCCGCC GGAGCTGCGATCGCGGCGTCCCGGAATCCCAGCCATCCGATTCTAGAGTGGGCCTTC TCCTCTCACCGTTCGTCTCTTTCACCATGGGGATCTATAACTCTAGCAGACGAATCCG TTGTCGAACCTAAGACCGGTTTCTCGTTTCCCGCTTCAATCGGAGATTCCCGGCGATT ACTCGGCGTCGGCCTGAGGAAGAAGAGCTTACTGGGATTGAAGAACATCGATGTCT ACGCCTTCGGCGTGTATGCTGATTGTGATGATGTGAAGAAACTTGTGGGAGACAAGT ACGCAAATCTTCCAGCTTCAGAGATCAGGGGAAACAAGTCATTCATGGATGATCTCA TGGAAGCCGATATTAAGATGACGATAAGGCTACAGATTGTCTACGGCAAACTCAAC ATCCGATCCGTGCGTAATGCTTTCCAAGAGTCTGTTGGAAACAGACTCAAGAAGTTC GGTGGCTCAGACAATGACGAGTTGCTTCAAAGCTTCACTAGCCTCTTCAAAGATGAG TATAAGATTCCAAGAAACTCCACCATTGATTTGACAAAAGATCCGGGCCATGTACTC AGCGTTGCAATTGAGGGGAACCATGTCGGGAGTGTGAAGAGCCATCTCTTGTGTAG ATCAATCTTAGACTTGTACATTGGTGAAGAACCGTTTGATAAGAATGCAAGAGAAG ATTTTCTAGACAATGCAGCTTCTCTAGCCTTCGACAACTAG HCT Wild type quinate O-hydroxycinnamoyl transferase / shikimate O-hydroxycinnamoyl transferase (1302 bp) ATGAAAATTAACATCAGAGATTCCACCATGGTCCGGCCTGCCACCGAGACACCAAT CACTAATCTTTGGAACTCCAACGTCGACCTTGTCATCCCCAGATTCCATACCCCTAGT GTCTACTTCTACAGACCCACCGGCGCTTCCAATTTCTTTGACCCTCAGGTCATGAAG GAAGCTCTTTCCAAAGCCCTTGTCCCTTTTTACCCTATGGCTGGTCGCTTGAAGAGAG ACGATGATGGTCGTATTGAGATCGATTGTAACGGTGCTGGTGTTCTCTTCGTTGTGG CTGATACTCCTTCTGTTATCGATGATTTTGGTGATTTTGCTCCTACCCTTAATCTCCGT CAGCTTATTCCCGAAGTTGATCACTCCGCTGGCATTCACTCTTTCCCGCTTCTCGTTT TGCAGGTGACTTTCTTTAAATGTGGGGGAGCTTCACTTGGGGTTGGGATGCAACATC ACGCGGCAGATGGTTTCTCTGGTCTTCATTTTATCAACACATGGTCTGATATGGCTCG TGGTCTTGACCTAACCATTCCACCTTTCATTGATCGAACACTCCTCCGAGCTAGGGA CCCGCCACAGCCTGCTTTTCATCATGTTGAATATCAGCCTGCACCAAGTATGAAGAT ACCTCTTGATCCGTCTAAATCAGGACCTGAGAATACCACTGTCTCTATATTCAAATT AACACGAGACCAGCTTGTTGCTCTTAAGGCGAAATCCAAGGAGGATGGGAACACTG TCAGCTACAGCTCATACGAGATGTTGGCAGGGCATGTGTGGAGATCAGTGGGAAAG GCGCGAGGGCTTCCAAACGACCAAGAGACGAAACTGTACATTGCAACTGATGGAAG GTCTAGACTACGTCCGCAGCTGCCTCCTGGTTACTTTGGGAATGTGATATTCACTGC AACACCATTGGCTGTTGCAGGGGATTTGTTATCTAAGCCAACATGGTATGCTGCAGG ACAGATTCATGATTTCTTGGTTCGTATGGATGATAACTATCTGAGGTCAGCTCTTGAC TACCTGGAGATGCAGCCTGATCTGTCAGCCCTTGTCCGCGGTGCACATACCTACAAG TGCCCAAATTTGGGAATCACAAGCTGGGTTAGATTACCTATTTATGATGCAGACTTT GGTTGGGGTCGTCCTATCTTTATGGGACCTGGTGGAATTCCATACGAGGGTTTGTCTT TTGTGCTACCAAGTCCTACTAATGATGGCAGCTTATCCGTTGCCATTGCCCTCCAATC TGAACACATGAAACTGTTTGAGAAGTTTTTGTTTGAGATATGA CI4 Wild type chalcone isomerase (1127 bp) ATGTCAAATATGGATCCTAATTCAGTTTTACCTAAGAGAAGTTTCTTACAACATGAG TTGTTTTCACAATTACATATACCTGGAAGCTTAGCTTTCGAAGCATTTAGTTGTATCT CTAAGTTTACAGGAGCTTTGCTTTGTTGGTTTTCACATGGAAACTTGCAAAAAGAAG TATCTAAACATCAATGGGGATTAACTTGTAAGAGCCGTGATTCTTTAAAACATGTGT TTGAACATAGGAACGTCTCTGTGTTCCCATTTCACTATGTATCAAAAGATATTAGTCC TGGCTTCTTTGGAAACATATCTAAATCCACTATTCAGCATTTTGTTAATGAAGCTGAG AGGCTACATTCGTGTTCTTTGCTCTCTTTGGCGGCTGCGATGATACCGTCTTTGAATG TCATGTCTGCAAATGGACTTGCTCTGCCACTAGGGAGTAATGATGTTAAACTTAGGG AGAACATTGAACATAGGACTTGTCCGGAGAACACTGAACATAGGACTTGTCAGGTG GGATGTGAAGAATATAGTGGTTTGAGTTTTCAAAAATTAGACTGGACAAGACAATC AGTGGAGCCTAGGACGGGGATCGAGTTCCCGATGTTGTTGAAGGAGAATGCTTCGC GATCGAATTCTGAGGTGCTTGTTGCAACGGGATCTCGGACAATGAAAATTATCAGAA TTAAATCTCTAAAAGTATATGCATTTGGTTTTTATGTTCACCCTTCCTCGGTCTGTCA GAAGCTTGGCCGAAAGTATGCCTCGGTTCCAGCAAGCAAACTTGACAAATGCGATG ACTTATACAAAGACCTTCTTAGGGAGGATATTGTTATGAGTGTGAGGCTTGTGGTTA ACTACAATGGCTTGAAGATCAATACTGTGAGAGATGTTTTCGAGAAATCTCTGCGTG CTCGCTTGGTTAAGGCAAATCCAAAAACTGATTTCAATTGTTTGAATGATTTTGGTTC ATTCTTTAGACAAGACATTCCAATACCCGCGGGAACAATAATAGACTTTCGGCGAAC AGAAGATGGACAGCTAATCACAGAGATTGGTGGTAACCTGATTGGAGCTGTCCGAA GCAAGGATCTTTGCAGAGCATTTTTTGGTATGTACATTGGAGATGTTCCGGTGTCAG AGCAGACAAAGGAGGAGATTGGTAGAAAAGTGGTGGGAATCATAAAGAGATGCTG A CI5 Wild type Chalcone isomerase (864 bp) ATGGATGGGATTCTTGCAGCTGTTCCATCTGCAGTGTGTGTCTCTCTACGCATTTCTT GTCGGAATCTGGATAATGCTGAATCCATCTATCATTTTCCCGGCAAATCCTTGAATC GAGTTTCAGTGCTTCAAACTGGGAACTACGTCTCTCGTAAAGGCAATTCGTTGCTTA AAAACCGACATTGTGGTGAAATTTCCCGTGTGATCGTAAAATCCGCCGCTTCTTCAG TTGGAAATGCAGAGGACTACGCTGAAGAAACGGCTACAAGTGTAAAGTTTAAGAGA TCAGTGACATTACCGGGTTGTTCTAGCCCGTTGTCTTTGCTCGGCACTGGGTTTAGGG AGAAAAAGTTTGCTATCATCGGTGTCAAAGTCTATGCTGCGGGTTATTATGTGAATG AATCTATCTTGAGCGGGTTAAGCGCTTGGACAGGGCGATCTGCTGATGAGATCCAAA GAGATTCATCACTGTTTGTTTCCATTTTCCAAGCTCAAGCAGAGAAATCGTTGCAGA TTGTTCTTGTGAGAGATGTTGATGGTAAAACCTTCTGGGATGCATTGGATGAAGCCA TTTCACCGAGAATCAAATCTCCATCTTCTGAGGATACAACTGCTCTCTCTACATTCCG TGGGATTTTCCAAAACAGACCTCTCAACAAAGGAAGTGTCATACTCTTGACTTGGAT CAACACTTCTAATATGCTTGTTTCTGTTTCGTCGGGAGGATTACCAACGAATGTGGA TGCAACGATCGAGTCAGGTAATGTTACATCTGCTCTGTTTGATGTGTTCTTTGGGGAT TCTCCAGTTTCTCCTACATTGAAATCCTCAGTGGCTAACCAATTAGCCATGACCCTAG TGTAA CI Wild type Chalcone isomerase (672 bp) ATGCCGCTGCCTTCCGTGACGCCACTCCACGTCGACGCATTTACTTTTCCTCCGGCTG TTGAGTCGCCCGCTTCCCACAAAAGACTTTTCCTCGGTGGTGCAGGCAAGTTCGTGA TTGTGACGGTCATCGGAGTCTACCTTGAAGCCATGGCACTGCCGTCAATCTCCGCTA AGTGGAAAGGCAAGAATGCAAAGGAGTTGACGGAATCCGTCCCTTTCTTCCGCCAA CTCGTCACAGGTGAGTTTGAGAAATTGGCAAGGGTGACGATGAAAAAGAGGTTAAC GGGGATACAATACTCGGAGAAAGTAGTAGAAAACTGTGAGGAGATCATGAAAGCGT CAGGGAAATACACAAGATCCGAAGCCAAAGCCATTGACCAATTCTTGATGGTCTTC AAAAACCAAGATTTCCCTCCCGGCTCTTCAATCATCTTCGCTATCTGTCCTAAAGGCT CTCTCACAATTGCATTTTCGAAAGAGGAGAGAGTCCCGAAAACTGGAAAAGCGGTT ATCAAGAATAAGTTGTTGGGTGAGGCAGTTCTTGAGTCGATGATAGGGAAGAATGG TGTATCCCCTGCGACAAGGAAGAGCCTCGCTGAGAGATTATCTAAGCTGATGAACA AAAAAGACCCGTACAACGAAGCTAACGTCAACGTTGCTACAAAAAATTGA LDOX AT4G22880 Leucoanthocyanidin dioxygenase, putative / anthocyanidin (1071 bp) ATGGTTGCGGTTGAAAGAGTTGAGAGTCTAGCAAAAAGCGGAATCATATCGATTCC AAAAGAATATATTCGTCCAAAAGAAGAGCTCGAGAGCATCAACGATGTTTTCCTAG AAGAGAAGAAAGAAGACGGTCCTCAAGTTCCCACAATCGATCTAAAGAACATCGAG TCAGACGATGAAAAGATCCGTGAGAATTGTATTGAGGAGCTGAAAAAGGCATCTTT GGATTGGGGAGTGATGCATTTGATCAACCATGGAATACCAGCTGATCTAATGGAGC GTGTCAAGAAAGCCGGAGAAGAGTTTTTCAGTTTGTCTGTGGAAGAGAAGGAGAAG TATGCAAACGATCAAGCCACTGGAAAGATTCAAGGCTATGGAAGTAAATTGGCTAA CAACGCGAGTGGACAATTGGAATGGGAAGATTACTTCTTTCATCTTGCGTATCCTGA AGAGAAGAGAGATCTATCAATTTGGCCTAAGACACCAAGTGATTACATAGAAGCAA CGAGTGAGTACGCGAAGTGTCTTCGTTTGCTAGCGACTAAAGTCTTCAAGGCTCTCT CTGTCGGTCTAGGTTTAGAGCCTGACCGTCTAGAGAAAGAAGTTGGTGGTTTAGAAG AGCTTCTTCTACAAATGAAGATAAATTACTATCCAAAATGTCCTCAGCCTGAGCTAG CACTCGGTGTGGAAGCTCACACCGATGTAAGCGCTTTAACTTTCATTCTACACAACA TGGTTCCGGGTTTGCAGCTTTTCTACGAGGGCAAATGGGTCACTGCAAAATGTGTTC CTGATTCGATTGTGATGCACATTGGGGATACTTTGGAGATTCTTAGTAATGGGAAGT ATAAGAGTATACTTCATCGTGGGTTGGTGAATAAGGAGAAGGTTAGGATTTCTTGGG CTGTGTTTTGTGAACCCCCAAAGGATAAGATTGTTCTTAAGCCGTTGCCGGAGATGG TGAGTGTTGAGTCTCCGGCTAAGTTTCCTCCACGGACTTTTGCTCAACATATTGAGCA TAAGTTGTTTGGGAAGGAACAAGAGGAATTGGTATCCGAGAAAAATGATTAA Pseudomonas aeruginosa LESB58 complete genome sequence (1050 bp) ATGTCGACGCTCTGTCTTCCCCACGTACTGTTTCCGCAACACATCATTACCCAGCAG CAAATGATCGAGCACCTGCAACAGTTGCACCGCGACCACCCGCAGCTGGCCCTGGC CGCGCGGATGATCCGCAACACCGAGGTCAGGCAACGCCACCTGTTGCTGCCGATCG AGGCGTTGACGGCACACCGGGGCATCGCACGGCGCAGCGAGTTATACGAACAGGAG GCCCGGCGGATGTCTTCCCGTGCAGCCCGTCAGGCTTTACGTAACGCCGGCCTGCGC CCGCAGGATATCCGCATGGTCGTCGTGACCTCCTGTACCGGTTTCATGATGCCGTCG CTGACCGCTCACCTGATCAATGACCTGGGCTTGCCGGGCTCCACCGTCCAGTTGCCC ATCGCTCAGTTGGGGTGTGTGGCCGGAGCAGCCGCCATTGCCCGCGCTTACGATTTC TCCAGGCAGGGACCGGACCGTCATGTGCTGCTGGTGTCCCTGGAGTTTTCCTCGTTG TGCTACCAGCCGCAGGATGCCCAATTGCAATCCTTCGTTGCCGGCGCGCTGTTCGGC GATGCCGTCTCCGCCTGCGTGCTGCGTGCCGACGATGGGGCGAAGGGATTCAGGGT CGAAGCCACCGGCTCCTTCTTTCTTCCTGACAGCGAGCACTACATTCGCTACGAGGT ACTCGATACCGGTTTTCATTTTCGCCTGGACAAGGCGGTAATGAAGGCGATCTCGGC GGTGGCGCCGGAGATGGAGCGGCTCAGCCGCGAGCATTTCGACCAGGTATGCGCCC GTTGCGACTTTTTCATATTCCACACGGGCGGCCGCAGGATACTCGACGAACTGGTGG CCCATCTGACGCTCGCCGAGGAGCAGGTCGCGCCGTCGAGAGCCAGCCTCGCCGAG GTCGGCAACGTGGCCAGCGTGGTGGTTTTCGATGTGCTTCGCAGGCTTTTCGAAAAT CCGCCGGAAGCTGGCGCCAGGGGCTTGTTGGCCGCCTTCGGCCCAGGCTTCAGTGCG GAGATGGCGCTGGGACAGTGGACGGACTGA KSP wild type sequence (666 bp) ATGACAAAAAGAATACCTAATTTACAAGTTGCATTAGACCATTCAGACTTGCAAGG AGCGATTAAAGCAGCTGTTTCTGTTGGTCAGGAAGTAGATATTATCGAAGCTGGAAC TGTTTGCTTGCTTCAAGTTGGAAGTGAACTGGCTGAAGTCTTGCGTAGCCTTTTCCCA GATAAGATTATTGTGGCAGACACAAAATGTGCTGATGCTGGTGGAACAGTTGCTAA AAATAATGCGGTTCGTGGAGCAGACTGGATGACTTGTATCTGTTGTGCAACCATCCC TACTATGGAAGCAGCTCTAAAGGCTATCAAGACTGAACGAGGAGAACGAGGCGAAA TCCAGATCGAGCTTTATGGCGATTGGACTTTTGAACAAGCTCAGCTTTGGCTAGATG CAGGTATTTCACAAGCTATTTATCACCAATCTCGTGATGCTCTTCTTGCTGGTGAAAC TTGGGGTGAAAAAGACCTTAATAAGGTTAAAAAACTCATTGACATGGGCTTCCGTGT ATCTGTAACAGGTGGTCTAGATGTAGATACTCTCAAACTCTTTGAAGGTGTTGATGT CTTTACCTTTATCGCAGGTCGTGGAATTACAGAGGCTGCGGATCCAGCAGGAGCAGC GCGTGCCTTCAAGGATGAAATCAAACGAATTTGGGGGTAA KEF wild type sequence (639 bp) ATGAAAAGACCAAACTTACAAATCGCTTTAGATCATAATAGCTTAGAAGACGCTTTA GCAGATTGTATGAAAGTCGGAGAAATTGTGGATATTATCGAAGTTGGCACTATTTTG TGTTTACAAGAAGGCCAAAAAGCAATTCGTTGTTTAAAACGCATGTTTCCTAATAAA ACGATTGTTGCTGATACAAAATGTGCTGATGCGGGCGGTACAGTTGCTCGTAATGTC GCACAAGCAGGCGCTGATTTCATGACGGTCATTTGTTGCGCCACCTTACCAACGATG GCTGCAGCTCAAAAAGAAGTCCGAGAATTACAAGTAGAACTATATGGAAATTGGAC AATGCAACAAGCTCGACAATGGCGAGAATTAGGGATTAATCAGGTGATTTATCATC AAAGTAGAGATGCTCTTTTAGCTGGCGGCAGTTGGGGAGAGAAAGATTTGAATAAA GTTCAAGAACTAATTGACTTAGGCTTTGAAGTGTCCGTCACAGGTGGTTTAACTGTC GAAACGCTTGAATTGTTTCAAACAATGGCAGTTGCAACATTTATTGCGGGCCGTGGG ATTACTGAATCAAAAAATCCTGAACAAGCAGCCAAAGATTTTCAAAAAAAAATCGA TCAGATTTGGAAGTGA KST wild type sequence (663 bp) ATGAGCCGACCATTACTGCAACTGGCGCTCGACCACACCAGTCTGGAAGCAGCCCA ACGCGATGTCGCCCTGCTACAGGATCATGTCGATATCGTTGAGGCCGGAACCATCCT TTGTTTAACCGAAGGCCTTAGCGCGGTGAAAGCCCTGCGAGCGCAGTGCCCGGAAA AAATCATCGTCGCCGACTGGAAAGTGGCCGATGCCGGTGAAACCCTGGCGCAGCAG GCTTTTGGCGCTGGCGCTAACTGGATGACTATCATCTGCGCCGCGCCGCTCGCGACC GTCGAGAAAGGCCATGCCGTCGCGCAATCCTGCGGCGGTGAAATTCAAATGGAGCT GTTCGGCAACTGGACGCTGGACGACGCCCGAGACTGGTATCGCACCGGCGTGCGTC AGGCGATTTATCATCGCGGACGCGATGCGCAGGCCAGCGGGCAACAGTGGGGAGAA GCGGACCTGGCACGCATGAAGGCGTTGTCCGACATCGGCCTTGAACTATCGATTACC GGCGGCATTACCCCAGCGGATCTGCCGCTGTTCCGCGACATTAACGTTAAGGCATTT ATCGCCGGACGTGCGCTGGCAGGTGCCGCCCATCCGGCGCAGGTCGCCGCCGAATT CCACGCCCAAATTGACGCCATTTGGGGAGAAAAGCATGCGTAA SgaH Wild type sequence (651 bp) ATGTCATTACCGATGTTGCAAGTCGCGCTGGACAACCAGACTATGGATAGCGCCTAC GAAACCACTCGCCTGATTGCCGAAGAAGTCGACATTATCGAAGTGGGCACCATTCTG TGCGTGGGCGAAGGCGTGCGTGCGGTTCGTGACCTGAAAGCGCTCTACCCGCACAA AATCGTACTGGCAGACGCCAAAATTGCCGATGCAGGCAAAATCCTTTCGCGTATGTG CTTCGAAGCCAACGCTGACTGGGTGACGGTAATTTGCTGTGCGGATATCAACACCGC CAAAGGCGCGCTGGACGTGGCAAAAGAGTTTAACGGCGACGTGCAGATCGAACTGA CCGGTTACTGGACCTGGGAACAGGCGCAACAGTGGCGCGATGCAGGCATTGGGCAG GTGGTTTATCACCGCAGCCGTGACGCGCAGGCCGCAGGCGTGGCGTGGGGCGAAGC GGACATCACCGCGATCAAACGTCTTTCCGATATGGGCTTCAAAGTCACCGTCACCGG AGGCCTGGCGCTGGAAGATCTGCCGCTGTTCAAGGGTATTCCGATTCACGTCTTTAT CGCGGGCCGTAGTATCCGTGATGCCGCTTCTCCGGTGGAAGCCGCACGTCAGTTCAA ACGTTCCATCGCTGAACTGTGGGGCTAA APPENDIX 3: SEQUENCES OF MUTANT PRIMERS Mutant Primer Sequences KEF E33K FOR 5’-GAGAAATTGTGGATATTATCAAGGTTGGCACTATTTTGTGTTTAC-3’ KEF E33K REV 5’-GGCCTTCTTGTAAACACAAAATAGTGCCAACCTTGATAATATCCAC-3’ KSP E33K FOR 5’-GGTCAGGAAGTAGATATTATCAAAGCTGGAACTGTTTGCTTGC-3’ KSP E33K REV 5’-GCAAGCAAACAGTTCCAGCCTTGATAATATCTACTTCCTGACC-3’ KST E33K FOR 5’-GGATCATGTCGATATCGTTAAAGCCGGAACCATCCTTTGTTTAAC-3’ KST E33K REV 5’-GTTAAACAAAGGATGGTTCCGGCTTTAACGATATCGAC-3’ SgaH W117S FOR 5’-GACCGGTTACTCGACCTGGGAAC-3’ SgaH W117S REV 5’-GTTCCCAGGTCGAGTAACCGGTC-3’ KEF W117S FOR 5’-ACTATATGGAAATTCGACAATGCAACAAG-3’ KEF W117S REV 5’-CTTGTTGCATTGTCGAATTTCCATATAG-3’ KSP W117S FOR 5’-GCTTTATGGCGATTCGACTTTTGAACAAG-3’ KSP W117S REV 5’-CTTGTTCAAAAGTCGAATCGCCATAAAGC-3’ KST W117S FOR 5’-GTTCGGCAACTCGACGCTGGACG-3’ KST W117S REV 5’-CGTCCAGCGTCGAGTTGCCGAAC-3’ SgaH G171Q FOR 5’-GTCACCGGACAGCTGGCGCTG-3’ SgaH G171Q REV 5’-CAGCGCCAGCTGTCCGGTGAC-3’ KEF G171Q FOR 5’-CGTCACAGGTCAATTAACTGTCG-3’ KEF G171Q REV 5’-CGACAGTTAATTGACCTGTGACG-3’ KSP G171Q FOR 5’-CTGTAACAGGTCAACTAGATGTAG-3’ KSP G171Q REV 5’-CTACATCTAGTTGACCTGTTACAG-3’ KST G171Q FOR 5’-GATTACCGGCCAAATTACCCCAG-3’ KST G171Q REV 5’-CTGGGGTAATTTGGCCGGTAATC-3’ [...]... of infectious diseases are known to be caused by microorganisms resulting in death and impairment Understanding the principle behind the emergence of the disease and the reason for the multi -drug resistance of these pathogenic microorganisms is crucial, in order to develop an anti-infective against these pathogens Our work was to develop an antimicrobial drug against a Shikimate pathway enzyme and. .. CI3 in Tom15b and Rosetta2 28 5.5: Solubility screening of CI3-1 in Tom15b and M9 medium after 1 and 2 hours of induction with 0.5 mM IPTG 28 5.6: Screening of CI3-2 in Tom15b and M9 medium 29 5.7: Screening of CI3-3 in Tom15b and M9 medium 29 5.8: Screening of CI3-4 in Tom15b and M9 medium at 25 ̊ C 30 5.9: Screening of CI3 in pET20b and M9 medium 30 5.10: Screening of CI3 in pET20b and M9 medium... amplified using the following parameters: 94 OC for 2 min, followed by 40 cycles of 94 OC for 1 min, an annealing temperature for 55 OC for 1 min 15 sec, extension at 68 OC for 3 min and a final extension of 68 OC for 10 min The PCR amplified products were run on a 1% agarose gel and the correct band was excised using a scalpel and subjected to gel purification to extract the pure insert using a Qiagen... poses a serious health threat to humans There is a pressing need for new drugs to be developed against these emerging drug- resistant microorganisms The microbes exhibit various modes of drug resistance [56], such as: 1) Drug inactivation or modification 2) Alteration of target site 3) Alteration of metabolic pathway 4) Reduced drug accumulation [1] An important research interest centers on bringing... herbicides and antimicrobial compounds It was suggested by Hermann and Weaver (1999) that the absence 6 of this pathway in humans might minimize unwanted side-effects on humans, should the inhibitors against the Shikimate pathway be developed as drugs or therapeutics [5] An interesting fact about this pathway is that unlike other pathways, there is no individual enzyme that can be termed “crucial” and that,... available, unless otherwise stated Reagents for performing first strand cDNA synthesis and Polymerase chain reaction (PCR) were from Invitrogen The primers for normal PCR and Quikchange mutagenesis were ordered from Sigma Life sciences Restriction enzymes and their corresponding buffers were purchased from New England Biolabs (NEB) and Calf intestinal Alkaline Phosphatase (CIAP) was purchased from Promega... might have a minimal side-effect on the human host if it is developed in to a drug We found a number of key residues that were distinct between the human host and the pathogen and we propose that if these differing residues can be targeted to develop an efficient drug against the Plasmodium OMPDC enzyme, consequently, the drug might have a minimal attack if administered to the host xiv | P a g e Abbreviations:... ligation, the mixture was drop dialyzed against double distilled water using a Millipore 0.025µ VSWP filter membrane for 30 min at room temperature and transformed in to XL1Blue electrocompetent cells and plated on to LB agar plates supplemented with 100 µg/mL ampicillin followed by incubation at 37 OC overnight The plasmids were extracted using the Qiagen’s miniprep kit and the correct clones were identified... (Protparam) It requires NAD+ as cofactor and divalent metal ions, Zn 2+ and Co 2+ for activity DHQS is a dimer with two domains in each monomer DHQS, as supposed, utilizes a complex multi-step mechanism which includes alcohol oxidation, phosphate β-elimination, carbonyl reduction, ring opening and intramolecular aldol condensation (Mary, 2006) Multi -drug resistant Enterococci and vancomycin-resistant Enterococci... cell function and growth One such biochemical pathway that serves as an interesting area of research for potential antibacterial and antifungal agents is the Shikimate pathway The enzymes of the Shikimate pathway are the prime targets for drug design as the pathway is essential in plants and microbes, but absent in humans, consequently reducing the risk of potential adverse effects from drugs that inhibit .. .THERAPEUTICS AND DRUG DESIGN AGAINST INFECTIOUS DISEASES USING SYNTHETIC ENZYMOLOGY AISHWARYA S M.SC (DUAL), SRM UNIVERSITY, INDIA A... order to develop an anti-infective against these pathogens Our work was to develop an antimicrobial drug against a Shikimate pathway enzyme and to design inhibitors against the Plasmodium parasite’s... the human host and the pathogen and we propose that if these differing residues can be targeted to develop an efficient drug against the Plasmodium OMPDC enzyme, consequently, the drug might have