Đang tải... (xem toàn văn)
... in early stages of bacterial invasion, this study aimed to focus on the effect of MorA signaling on these factors The specific aims of this study were i) To understand the role of MorA in P aeruginosa. .. attachment to host surface via surface appendages and subsequent entry into host cell ii) To study the effect of MorA-c-di-GMP signaling on P aeruginosa secretion that aid in invasion of host iii)... affect invasion by degrading the extracellular matrix? 96 CONCLUSIONS AND FUTURE DIRECTIONS 99 CHAPTER Ser/Thr/Tyr PHOSPHOPROTEOMES OF P PUTIDA AND P AERUGINOSA AND THEIR CROSSTALK WITH CYCLIC DIGUANYLATE
EARLY STAGES OF HOST INVASION BY PSEUDOMONAS AERUGINOSA AND EFFECT OF CYCLIC DIGUANYLATE SIGNALING AYSHWARYA RAVICHANDRAN A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2010 ACKNOWLEDGEMENTS I express my heartfelt gratitude to my supervisor, A/P Sanjay Swarup for his constant guidance and supervision throughout the period of this project. I sincerely thank National University of Singapore for providing me with Research Scholarship to complete this project. I would also like to thank Research Centre for Excellence in Mechanobiology for funding part of this study and support. I am extremely thankful to Dr. Yasushi Ishihama, Keio University, Japan for performing phoshoproteome analysis on our samples without which my publication would not have been possible. Helium-ion imaging was conducted under Dr. Daniel Pickard and I am thankful for his guidance and facility. I extend my sincere gratitude to Dr. Gerard Michel, Centre National de la Recherche Scientifique, France for his kind gesture of sending antibodies and guidance in P. aeruginosa type II secretion systemrelated experiments. I would also like to thank Dr. Zhang Lian-Hui for providing workspace in his laboratory during the initial stages of this project and Dr. Ganesh Anand for his valuable scientific discussions time-to-time. I express my thanks to Malarmathy Ramachandran and Karen Lam who have been very instrumental in helping me with optimization of experimental methods used in this study. I express my gratitude to Protein and Proteomics centre for their mass spectrometry services, Electron microscopy and the confocal microscopy facilities at the Faculty of Medicine, and the Electron microscopy facility at Department of Biological Sciences. In this regard, I thank Ms.Michelle Mok, Ms. Wang Xianhui and Mdm. Loy Gek Luan. My thanks are due to our lab officers Ms. LiewChye Fong, Dennis Heng andJiun Fu. I extend my gratitude to all my lab mates especially Chui Ching, Weiling and Tanujaa for their cooperation, help and constant support. I would also like to thank all theother undergraduates and attachment students who have in one way or other helped this project. I am lucky to have great friends at NUS especially Sheela, Gauri, Sravanthy, Karthik, and Prasanna for their criticism, discussions and moral support. I have been blessed with wonderful family that lives across the globe, a constant source of encouragement and love; especially my parents Dr. Ravichandran and Dr. Rajarajeswari, who inspired me to take up research. A special mention goes to Mrs. Chandrika and Mr. Nagarajan, my guardians in Singapore. Last but not least, my husband Mr. Vigneshwaran and parents-in-law have always been greatly supportive of my career endeavors. I have no words to thank these people, without whom I could not have endured this tough journey. CONTENTS ACKNOWLEDGEMENTS i SUMMARY vii ABBREVIATIONS ix LIST OF TABLES xii LIST OF FIGURES xiii PUBLICATIONS xv CHAPTER 1 INTRODUCTION 1.1 General Introduction 1 1.2 Objectives 3 CHAPTER 2 REVIEW OF LITERATURE 2.1 Bacterial invasion and infection mechanisms 5 2.2 Pseudomonas aeruginosa- an opportunistic pathogen 8 2.2.1 Chronic vs acute infection 9 2.3 Multifactorial nature of P. aeruginosa virulence mechanisms 10 2.4 Host surface-attachment, a key step in P. aeruginosa invasion Role of bacterial appendages in surface attachment 12 15 2.5.1. Flagellum- a primary adhesin 15 2.5.2. Type IV pili-mediated attachment 17 P. aeruginosa internalization by non-phagocytic cells 19 2.6.1.Host signaling pathways necessary for P. aeruginosa invasion 20 Role of secretion systems in bacterial invasion 23 2.5 2.6 2.7 ii 2.7.1. Type II secretion system (T2SS) in P. aeruginosa 25 2.8 Co-ordinated regulation of P. aeruginosa virulence mechanisms 29 2.9 C-di-GMP signaling 32 2.9.1.Role of c-di-GMP signaling in virulence regulation 34 2.9.2. MorA signaling 36 2.10 Bacterial Ser/Thr/Tyr phosphorylation system 38 CHAPTER 3 MATERIALS AND METHODS 3.1 Bacterial strains, plasmids and growth conditions 41 3.2 Gene expression studies 42 3.3 Cloning and genetic manipulation studies 43 3.4 Expression of recombinant proteins 45 3.5 Secretome analysis 46 3.5.1. Elastolytic activity assay 48 3.6 Intracellular protein extraction 49 3.7 Membrane protein preparation 49 3.8 Immunoblotting 50 3.9 Bacterial infection studies 51 3.9.1. Cell culture conditions 51 3.9.2. Infection assays 52 3.10 Extracellular matrix extraction 54 3.11 Sample preparation for Helium-ion microscopy 55 3.12 Phosphoproteome analysis 56 iii 3.12.1. 2-Dimensional Electrophoresis (2-DE) of P. putida protein samples 3.12.2. Staining for phosphoproteins CHAPTER 4 62 3.12.4. Analysis of LC-MS-MS data 64 CYCLIC DIGUANYLATE SIGNALING AFFECTS P. AERUGINOSA ATTACHMENT AND ENTRY INTO LUNG FIBROBLASTS BACKGROUND 4.2 RESULTS AND DISCUSSION CHAPTER 5 61 3.12.3.Sample preparation for phosphoproteome analysis by Nano-LC-MS-MS 4.1 4.3 56 66 4.2.1. MorA affects bacterial attachment to host in P. aeruginosa 67 4.2.2. Which appendage plays a major role in attachment changes due to MorA- flagellum or pili? 72 4.2.3. Investigation of entry mechanism 74 CONCLUSIONS AND FUTURE DIRECTIONS 75 SECRETION OF EXTRACELLULAR PROTEASES IS AFFECTED BY CYCLIC DIGUANYLATE SENSOR REGULATOR MorAINP. AERUGINOSA 5.1 BACKGROUND 5.2 RESULTS AND DISCUSSION 79 5.2.1. C-di-GMP signaling affects T2SS secretome in P. aeruginosa 81 5.2.2. Biological effects of increased extracellular protease levels 87 iv 5.3 5.2.3. MorA affects invasion efficiency of P. aeruginosa 89 5.2.4. Mechanism of c-di-GMP regulation of P. aeruginosa protease secretion 91 i) RNA levels of protease genes 91 ii) Protein levels of protease genes 93 iii) Levels of T2SS secreton assembly proteins 95 5.2.5. Does MorA affect invasion by degrading the extracellular matrix? 96 CONCLUSIONS AND FUTURE DIRECTIONS 99 CHAPTER 6 Ser/Thr/Tyr PHOSPHOPROTEOMES OF P. PUTIDA AND P. AERUGINOSA AND THEIR CROSSTALK WITH CYCLIC DIGUANYLATE SIGNALING 6.1 BACKGROUND 6.2 RESULTS AND DISCUSSION 6.3 104 6.2.1. Gel-based approach for identification of phosphoproteins 107 6.2.2.Phosphoproteome analysis of P. putida and P. aeruginosa by Nano-LC-MS/MS method 110 6.2.3. Crosstalk of MorA-c-di-GMP signaling and protein phosphorylation 124 CONCLUSIONS AND FUTURE DIRECTIONS 127 CHAPTER 7 REFERENCES CONCLUDING REMARKS 131 132 v APPENDICES Supplementary information on gene cloning done in this 152 I study II Methods for Ser/Thr/Tyr Phosphoproteome analysis 157 III Supplementary information on host cell morphology 161 IV Gene regulatory network of promoters affected by MorA 162 V MALDI-ToF-ToF spectra of secreted proteins affected by MorA 163 VI MorA affects timing of flagellar biogenesis in P. aeruginosa 171 VII Crosstalk of MorA and acetyl phosphate (AcP) signaling 172 vi SUMMARY Bacterial invasion plays a critical role in the establishment of P. aeruginosa infection, which involves surface attachment of bacteria on the host cells followed by internalization/ tissue penetration. Major virulence factors aiding bacterial invasion are surface appendages and secreted proteases. The second messenger cyclic diguanylate (cdi-GMP) is well known to affect attachment of bacteria to surfaces, biofilm formation and related virulence phenomena. MorA, a global regulator containing a GGDEF-EAL domain has been previously shown to affect biofilm formation and timing of flagellar biogenesis in P. aeruginosa PAO1 strain, and fimbriae expression in other clinical strains. These domains are implicated in the turnover of c-di-GMP. This study provides evidence that the global regulator MorA affects P. aeruginosa attachment to host surface and levels of proteases secreted by the type II secretion system (T2SS) hence regulating the invasion capacity of the pathogen. This is the first report on control of c-di-GMP signaling on this secretion system. It was postulated that there may be a common post-transcriptional signal acting between the regulatorMorA and the effectors i.e. T2SS and pili/flagella since all the three are located at the bacterial poles. Results confirm that the effect of MorA signaling on T2SS is post-transcriptional. Data from this study suggest that the effect of MorA on host-surface attachment may be mediated by pili, a key surface appendage. Owing to growing importance of Ser/ Thr/ Tyr protein phosphorylation in bacteria, it was hypothesized to be the common phenomenon bridging the altered c-di-GMP levels and the observed effects on protease secretion and attachment to host surface. A comprehensive phosphoproteome analysis was conducted on P. aeruginosa and P. putida vii that revealed several interesting leads suggesting many virulence and survival mechanisms to be regulated by protein phosphorylation. This analysis uncovered a novel crosstalk between two bacterial signaling paradigms namely- c-di-GMP second messenger signaling and Ser/ Thr/ Tyr protein phosphorylation. Since not many Ser/Thr/Tyr kinases have been characterized in bacteria, a direct correlation of c-di-GMP levels and alteration in protein phosphorylation patterns need further investigation. viii ABBREVIATIONS 2-DE 2-Dimensional electrophoresis ABC ATP-binding cassette AckA acetate kinase AcP acetyl phosphate Acyl-HSL acyl homoserinelactone aGM asialoganglioside gangliotetrasylceramide Amp ampicillin AP alkaline phospahatase BSA bovine serum albumin cAMP cyclic adenosine monophosphate c-di-GMP cyclic di-guanylate monophosphate CF cystic fibrosis CFTR cystic fibrosis transmembrane conductance regulator CHAPS 3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate CMR Comprehensive Microbial Resource Da dalton DGC diguanylate cyclase DMSO dimethyl sulfoxide DTT dithiotreitol ECL enhanced chemiluminescence ECM extra-cellular matrix ECP extra-cellular protein EDTA ethylene-diamine-tetra-acetate ETA exotoxin A GFP green fluorescent protein Gm gentamycin ix GTP Guanosine-5'-triphosphate HAMMOC hydroxy acid-modified metal oxide chromatography HIM Helium ion microscopy HK histidine kinase HPA β-hydroxypropanoic acid IEF isoelectric focusing IPTG isopropyl β-D-1-thiogalactopyranoside KO knockout LA lactic acid LB Luria-Bertani LC-MS-MS liquid chromatography followed by tandem mass spectrometry LPS lipopolysaccharide m/z mass/charge MALDI matrix-assisted laser desorption/ ionization MOI multiplicity of infection OD optical density OE overexpression ORF open reading frame P. aeruginosa Pseudomonas aeruginosa P. putida Pseudomonas putida PAGE polyacrylamide gel electrophoresis PBS phosphate buffered saline PDE phosphodiesterase PGPR plant growth-promoting rhizobacterial pI isoelectric point PMNs polymorphonuclear leucocytes PMT photomultiplier tube x ppm parts per million Pta phosphate acetyl transferase PTM post-transcriptional modification qRT-PCR quantitative Real-time Polymerase Chain Reaction QS quorum sensing RR response regulator RT-PCR reverse transcriptase polymerase chain reaction S or Ser serine SE standard error SEM scanning electron microscope T or Thr threonine T2SS type II secretion system T3SS/TTSS type III secretion system T4P type IV pili T6SS type VI secretion system TCA trichloroacetic acid TEM transmission electron microscopy Tet tetracycline Ti titania ToF time of flight v/v volume by volume w/v weight by volume WT wild type Y or Tyr tyrosine Zr zirconia xi LIST OF TABLES Table 3.1 Bacterial strains and plasmids used in this study 39 Table 3.2 List of primers used for gene expression studies and cloning experiments 42 Table 3.3 Immunoblot conditions for antibodies used in this study 48 Table 3.4 Optimization of parameters for 2-dimentional gel electrophoresis of P. putida proteins 56 Table 5.1 MALDI-ToF-ToF identification of P. aeruginosa secreted proteins affected by MorA 80 Table 6.1 List of identified phosphopeptides from P. putida PNL-MK25 107 Table 6.2 List of identified phosphopeptides from P. aeruginosa PAO1 111 Table 6.3 Specific roles of identified phosphoproteins 116 Table 6.4 Effect of MorA-c-di-GMP signaling on protein phosphorylation 121 Table 6.5 Phosphopeptides of interest for validation functional significance of phosphorylation 124 xii LIST OF FIGURES Figure 2.1 Bacterial infection strategies 7 Figure 2.2 P. aeruginosa virulence factors affecting different stages of infection 11 Figure 2.3 Bacterial secretion systems 24 Figure 2.4 Type II secretion system in P. aeruginosa 26 Figure 2.5 Phenotypes regulated by c-di-GMP and binding sites/domains 33 Figure 2.6 Regulation of flagellum-based motility by c-di-GMP signaling 36 Figure 2.7 Domain structure of MorA in P. putida and P. aeruginosa Figure 2.8 Verification of transcriptional level effect of MorA on T3SS genes Figure 3.1 Strategy for insertion of peptide tag to LasB 43 Figure 3.2 Optimization of P. aeruginosa secreted protein extraction 45 Figure 3.3 Layout of bacterial infection assays 50 Figure 3.4 Optimization of antibiotic concentration and incubation time for efficient clearance of external host-attached bacteria in invasion assay 51 Figure 3.5 Workflow of phosphoproteome analysis 55 Figure 3.6 Optimization of 2-dimentional gel electrophoresis 58 Figure 3.7 Optimization of visualization of phosphoproteins 60 Figure 3.8 Workflow of sample preparation for phosphoproteome analysis 61 Figure 4.1 P. aeruginosa attachment to host cells is affected by MorA 66 Figure 4.2 Host morphological changes correspond to effect of MorA on bacterial attachment 67 xiii Figure 4.3 P. aeruginosa cells actively divide during infection 69 Figure 4.4 Polar and lateral appendages mediate P. aeruginosa host attachment 70 Figure 4.5 Entry mechanisms of P. aeruginosa WT 72 Figure 5.1 Type III effector secretion levels are not affected by MorA 77 Figure 5.2 Levels of secreted proteases are affected by MorA in P. aeruginosa 79 Figure 5.3 Elastase activity in extracellular fraction of P. aeruginosa PAO1 WT and morA KO strains 85 Figure 5.4 Invasion efficiency corresponds to altered elastolytic activity 87 Figure 5.5 RNA levels of major secreted proteases show no change due to MorA 89 Figure 5.6 Elastolytic activity assay for LasB-FLAG construct 91 Figure 5.7 MorA does not affect intracellular levels of LasB Figure 5.8 Levels of T2SS machinery proteins are unaltered by MorA 93 Figure 5.9 Optimization of extracellular matrix analysis 95 Figure 5.10 Mechanism of regulation of proteases secreted via T2SS 97 Figure 6.1 Effect of MorA on protein phosphorylation in P. putida 104 Figure 6.2 Total protein profiles of P. putida WT and morA KO are consistent 105 Figure 6.3 Cellular localization and biological function of identified phosphoproteins 115 Figure 6.4 Phosphorylation sites on T6SS-related proteins 119 Figure 6.5 Effect of c-di-GMP on protein phosphorylation in P. putida and P. aeruginosa 120 xiv LIST OF PUBLICATIONS/CONFERENCES FROM THIS STUDY Publications Ravichandran, A., Sugiyama, N., Tomita, M., Ishihama, Y., Swarup, S. Ser/Thr/Tyr Phosphoproteome Analysis of Pathogenic and Non-Pathogenic Pseudomonas Species.Proteomics 2009, 9, 1-12. Ravichandran, A., Suriyanarayanan, T., Swarup, S. Global regulator MorA controls bacterial invasion via protease secretion in Pseudomonas aeruginosa. Manuscript in preparation. Conferences AyshwaryaRavichandran (Invited speaker), Understanding the cell surface-associated events during bacterial infection processes. In Program, First Asian Helium Ion Microscopy Workshop, National University of Singapore, September 10, 2009. Ishihama, Y., Sugiyama, N., Ohnuma, S.,Tomita, M., Ravichandran, A., Swarup, S. Phosphoproteome Analysis of Pathogenic and Non-Pathogenic Pseudomonas Species. In Program and Abstracts, 57th ASMS Conference on Mass Spectrometry, Philadelphia, USA, May 31-June 4, 2009. Ravichandran, A., Sugiyama, N., Tomita, M., Ishihama, Y., Swarup, S. Phosphoproteome Analysis of Pathogenic and Non-Pathogenic Pseudomonas Species.In Program (abstract accepted), HUPO 8th Annual World Congress, Toronto, Canada, September 26-30, 2009, Pg 68. Ravichandran, A., Ramachandran, M., Pickard, D.S., Swarup, S. Mechanics of initial stages of P. aeruginosa infection process. In Program and Abstracts, The 3rdMechanobiology Workshop, National University of Singapore, November 3-5, 2009, Pg 72. Ravichandran, A., Sugiyama, N., Tomita, M., Ishihama, Y., Swarup, S. Ser/Thr/Tyr Phosphoproteome Analysis of Pathogenic and Non-Pathogenic Pseudomonas Species.In Program and Abstracts, Joint 5th Structural Biology and Functional Genomics and 1st Biological Physics International Conference, National University of Singapore, December 9-11, 2008, Pg 152. Ravichandran, A., Lam Mok Sing, K.M., Ramachandran, M., Lim, C.T., Low, B.C., Jin, S., Swarup, S. Mechanics of initial attachment of P. aeruginosa PAO1 to human host cells. In Program and Abstracts, 2ndMechanobiology Workshop, National University of Singapore, November 3-5, 2008. Ravichandran, A., Sugiyama, N., Tomita, M., Ishihama, Y., Swarup, S. Ser/Thr/Tyr Phosphoproteome Analysis of Pathogenic and Non-Pathogenic Pseudomonas Species.In xv Program and Abstracts,13thBiological Sciences Graduate Congress, National University of Singapore, December 15-17, 2008, Pg 36. Ravichandran, A., Heng, M.W., Swarup, S. Regulatory effect of c-di-GMP signalling on metabolic and other pathways in Pseudomonas aeruginosa. Presented at the BactPath9 program, Monash University, Melbourne, Australia, September, 2007. Ravichandran, A., Heng, M.W., Sugiyama, N., Ishihama, Y., Swarup, S. Effects of cyclic-di-GMP signaling on protein phosphorylation and secretion in Pseudomonas sp. In Program and Abstracts, 12th Biological Sciences Graduate Congress, University of Malaya, Kuala Lumpur, Malaysia, December 17-19, 2007. Ravichandran, A., Heng, M.W., Choy, W.K., Swarup, S. MorA, the regulator of biofilm formation in P. aeruginosa also affects the levels of virulence-associated extra-cellular proteases. In Program and Abstracts, Joint Third AOHUPO and Fourth Structural Biology and Functional Genomics Conference, National University of Singapore, December 4-7, 2006, Pg 231. Ravichandran, A., Heng, M.W., Choy, W.K., Swarup, S. MorA, the regulator of biofilm formation in P. aeruginosa also affects the levels of virulence-associated extra-cellular proteases. In Program and Abstracts, 11th Biological Sciences Graduate Congress, Chulalongkorn University, Bangkok, Thailand, December 14-17, 2006, Pg 101. xvi CHAPTER 1 INTRODUCTION 1.1 General Introduction P. aeruginosa is a well established opportunistic and nosocomial pathogen with an ability to adapt to eclectic environments and grow utilizing a wide range of substrates. It possesses an array of virulence determinants which aid in colonization on biotic and abiotic surfaces as well as in dissemination. Extensive studies have been performed on P. aeruginosa virulence mechanisms and their regulation (Ramos, 2004). With numerous crosstalks and complex overlaps discovered in different strains under various conditions, this area of study is thriving as novel regulation mechanisms are being unraveled constantly. The reason is that the pathogen is highly adaptable to changes in its environment and devises new methods of survival/infection by manipulating its multifactorial virulence mechanisms (Ramos & Filloux, 2007). Hence, there are unclear or unknown regulatory mechanisms to be explored. Initial stages of P. aeruginosa infection include attachment to host surface followed by internalization into host cells eventually leading to invasion of tissue. Known key adhesins include the surface appendages- flagellum and pili. Their interaction with host causes changes at the host-pathogen interface leading to internalization of P. aeruginosa. Both pili and flagella are nanomachines known to be regulated by complex mechanisms at various levels such as transcriptional, post-transcriptional, assembly and function (Jarrell 2009). To penetrate tissues, P. aeruginosa secretes various proteins that cleave the host connective tissue and/or gains access to more host cells. Though P. aeruginosa possess almost all of the many Gram-negative secretion machineries discovered to date, 1 significance of type II and type III secretion systems have been well-established and widely studied (Wooldridge 2009). The type II secretion system of P. aeruginosa secretes many proteases and lipases which cleave the extracellular matrix components such as fibronectin, elastin and collagens while type III secretion system (T3SS) injects proteins directly into host cytoplasm leading to cytoplasmic rearrangements and morphological changes aiding in invasion of host tissue. These virulence factors are known to be affected by quorum sensing mechanism involving small molecule trafficking and/or levels of nucleotide second messengers namely cyclic-AMP and cyclic diguanylate monophosphate (c-di-GMP) in P. aeruginosa and other Gram-negative pathogens. In recent years, the significance of c-di-GMP second messenger signaling is becoming apparent in the regulation of a multitude of cellular process and virulence mechanisms in all classes of bacteria (Tamayo et al., 2007). In particular, c-di-GMP levels have been reported to impart significant effects flagellar motility and attachment to surfaces (Wolfe & Visick, 2008). Though such common phenotypes are known to be affected by this molecule, its mechanism of action and the level of regulation have been known to be distinctive across the different bacterial species studied. Since several proteins involved in the turnover of c-di-GMP in each species have been found, it is believed that each protein may respond to unique environmental cues and alter c-di-GMP levels in a temporal/ spatial manner to bring about phenotypic changes. Hence, each case showing a phenotypic difference poses a challenge in understanding the underlying mechanism. Our laboratory studies one such protein MorA, a membrane-localized global sensor regulator with domains involved in c-di-GMP turnover (Choy et al., 2004). We have previously reported that MorA affects timing of flagellar biogenesis, flagellar number and 2 surface attachment in P. putida, and biofilm formation in P. aeruginosa. We have further evidence that MorA also affects timing of flagellar biogenesis and swimming speeds in P. aeruginosa. More details can be found in secion 2.9.2. Others have also shown that MorA regulates colony morphology and twitching motility via another appendage, namely fimbriae in a P. aeruginosa strain isolated from cystic fibrosis lung (Meissner et al., 2007). This species being pathogenic, effect on its surface appendage may have an impact on its ability to attach and infect host cells. Though MorA has not been shown to affect T3SS, similar proteins P. aeruginosa and other species are well-known to regulate this secretion system (Kulasekara et al., 2006). 1.2. Objectives The overall aim of this study was to investigate the role of MorA-c-di-GMP signaling in P. aeruginosa virulence mechanisms. As previous studies have proven that function of bacterial surface appendages and protein secretion are critical in early stages of bacterial invasion, this study aimed to focus on the effect of MorA signaling on these factors. The specific aims of this study were i) To understand the role of MorA in P. aeruginosa attachment to host surface via surface appendages and subsequent entry into host cell ii) To study the effect of MorA-c-di-GMP signaling on P. aeruginosa secretion that aid in invasion of host iii) To investigate the mechanism(s) by which MorA may control host invasion of P. aeruginosa 3 In this thesis, the second chapter (Chapter 2) provides review of bacterial invasion mechanisms, relevant virulence properties of P. aeruginosa and their regulation, known c-di-GMP signaling mechanisms and Ser/Thr/Tyr phosphorylation in bacteria. Chapter 3 gives the details of all the materials and methods that were used during the entire study. Chapter 4 discusses effect of MorA on P. aeruginosa-host attachment, bacterial surface structures aiding interaction, and changes at the host-pathogen interface leading to internalization. In the next chapter (Chapter 5), the focus is on secreted proteases that are shown to be affected by MorA signaling and their biological significance. Experiments to investigate the mechanism of MorA regulation on protease secretion are also illustrated. Lastly, Chapter 6 provides evidence that protein phosphorylation could be a likely mechanism for large-scale post-transcriptional affects of c-di-GMP signaling. A comparative interspecies analysis of Pseudomonas phosphoproteomes indicates that the key survival and virulence pathways of Pseudomonas sp. may involve Ser/Thr/Tyr phosphorylation. 4 CHAPTER 2 REVIEW OF LITERATURE 2.1. Bacterial invasion and infection mechanisms Invasive bacteria actively induce their own uptake by phagocytosis in normally nonphagocytic cells and then either establish a protected niche within which they survive and replicate in the cytosol or vacuole, or disseminate from cell to cell by means of an actin-based motility process. Through their interactions, pathogens can modify epithelium function to enhance their penetration across the epithelial barrier and to exploit mucosal host defenses for their own benefit. Apoptosis and antiapoptosis, as well as cell cycle– and inflammation-related signaling pathways, are reprogrammed after infection to help the cell to survive the stress induced by the infection. The success of an infection depends on the messages that the two players -the bacterium and the host cellsend to each other. The mechanisms underlying bacterial attachment, entry, phagosome maturation, and dissemination reveal common strategies as well as unique tactics evolved by individual species to establish infection. To enter nonphagocytic cells such as intestinal epithelial cells, some microbial pathogens express a surface protein which can bind eukaryotic surface receptors often involved in cell-matrix or cell-cell adherence. These interactions trigger a cascade of signals, including protein phosphorylations and/or recruitment of adaptors and effectors, and activation of cytoskeleton components. These events lead to the formation of a vacuole that engulfs the bacterium through a “zippering” process in which relatively modest cytoskeletal rearrangements and membrane extensions occur (Cossart & Sansonetti 5 2004). The Yersinia outer-membrane protein invasin strongly binds to integrin receptors that are normally implicated in adherence of cells to the extracellular matrix (Isberg & Barnes 2001). Similarly in L. monocytogenes, internalins A and B contribute to bacterial entry, and both processes are dependent on the presence of raft microdomains, suggesting that for entry, Listeria take advantage of raft microdomains, which are known to be enriched in receptors and signaling molecules. Pathogens can also bypass the first step of adhesion and interact directly with the cellular machinery that regulates the actin cytoskeleton dynamics by injecting effectors through a dedicated secretory system. The effector molecules cause massive cytoskeletal changes that trigger the formation of a macropinocytic pocket, loosely bound to the bacterial body. Both Shigella and Salmonella use this mechanism to enter the cell. Contact between bacteria and a cell is mediated by the type III secretory system (TTSS). The protein components of the translocon are associated with membrane rafts enriched in signaling molecules. Following this, a macropinocytic pocket is formed involving localized but massive rearrangements of the cell surface, characterized by the formation of intricate filopodial and lamellipodial structures. Figures 2.1A and 2.1B show the overall internalization and dissemination process of Salmonella typhimurium and Shigella flexneri. Once in close contact with the epithelium, Salmonellae induce degeneration of the enterocyte's microvilli, followed by profound membrane "ruffling" localized to the area of bacteria–host cell attachment. This is accompanied by extensive endocytosis and internalization of the bacteria into host cells as described above. The bacterial adhesins leading to bacterial internalization are not only 6 A Salmonella B Shigella Figure 2.1. Bacterial infection strategies. A. Salmonella enterica typhimurium crossing the epithelial barrier by entering via either M cells or enterocytes. B. Shigella entry into rectal and colonic mucosa via M cells. Both A and B show changes in membrane structure (membrane ruffling) due to binding of bacterial protein translocon with signaling molecules in lipid raft-rich areas of host membrane. Subsequent events include M cell destruction and subepithelial invasion by bacteria of macrophages. A & B adapted from (Sansonetti & Phalipon 1999). limited to invasin or TTSS; other bacterial surface structures including appendages and surface polysaccharides in other pathogens are also capable of inducing host cellular changes to gain entry into host. These have been discussed in detailed in the context of P. aeruginosa later in this chapter. 7 2.2. Pseudomonas aeruginosa- an opportunistic pathogen Pseudomonas aeruginosa is a ubiquitous bacterial species in the environment commonly inhabiting soil and water. It possesses a large genome encoding eclectic arrays of metabolic, catabolic, and virulence-related proteins and regulatory systems that define its infinite ability to adapt to a wide range of environments and hosts (Stover et al., 2000). Healthy individuals are generally not susceptible to P. aeruginosa infection; nevertheless, several underlying conditions such as extensive burns, eye trauma, mechanical ventilation, human immunodeficiency virus infection and malignancy increase the risk of an acute spell (Fleiszig & Evans 2003); (Sadikot et al., 2005). It can cause urinary tract infections, respiratory system infections, dermatitis, corneal infections, soft tissue infections, bacteremia, bone and joint infections, gastrointestinal infections and a variety of systemic infections. The main reason for chronic P. aeruginosa infections in hospital environment and in cystic fibrosis (CF) patients are attributed to its ability to establish biofilms in lungs, on implanted medical device or damaged tissue. A very typical microbiological diagnostic finding is the recovery of various P. aeruginosa phenotypes from chronically infected respiratory tract specimens of CF patients. Apart from the beststudied mucoid P. aeruginosa phenotype (Govan and Deretic, 1996), it is known that dwarf colonies can be isolated from the chronically infected CF lung (Zierdt & Schmidt 1964). These ‘small colony variants’ (SCV) show increased antibiotic resistance to a broad range of antimicrobial agents and their recovery in CF patients could be correlated with parameters revealing poor lung function and inhaled antibiotic therapy (Haussler et al., 1999). Treatment becomes problematic by the significant intrinsic resistance of P. aeruginosa and the emergence of multidrug- resistant strains (Zaborina et al., 2006); 8 (Obritsch et al., 2005). Considering the morbidity and mortality associated with P. aeruginosa pathology, it is clear that new therapeutic strategies are needed. 2.2.1. Chronic vs acute infection P. aeruginosa isolates from environmental and human sources yield two well-defined phenotypes (Govan & Deretic 1996); (Hanna et al., 2000). Isolates from the environment and patients with acute infections exhibit determinants associated with acute virulence, including the expression of a full-length lipopolysaccharide (LPS) side chain, flagella for motility, extracellular toxins, and proteases, as well as a type III secretion system (T3SS) that directly injects effectors into the host (Pier 1998); (Roy-Burman et al., 2001). On the other hand, strains from chronically infected CF patients are generally not motile; express lower levels of extracellular toxins, proteases, and T3SS-related proteins; and possess LPS molecules with a penta-acylated lipid A modified by palmitate or aminoarabinose (Govan & Deretic 1996); (Pier 1998); (Ernst et al., 1999). Moreover, these strains also overexpress extracellular polysaccharides that form a matrix for microcolony formation leading to surface attachment and further develop into differentiated structures called biofilms. Biofilm formation is the major characteristic for maintaining the chronic state of infection in CF patients, as bacterial biofilms are highly resistant to phagocytosis and adapt to a metabolic state that makes antimicrobial treatments inefficient (Drenkard & Ausubel 2002) (Gillis et al., 2005; Singh et al., 2000; Whiteley et al., 2001). Characteristically, gradients of nutrients and oxygen exist from the top to the bottom of biofilms and these gradients are associated with decreased bacterial metabolic activity and increased doubling times of the bacterial cells; it is these more or less dormant cells 9 that are responsible for some of the tolerance to antibiotics (Høiby et al., 2010). For laboratory studies, PAK and PAO strains are widely used to study acute infection. 2.3. Multifactorial nature of P. aeruginosa virulence mechanisms The cornucopia of knowledge available on mechanisms of virulence and pathogenesis of P. aeruginosa reveals its reliance not on a single virulence factor, but rather the precise and delicate interplay between different factors leading from one stage of infection to the next, as well as activation of both local and systemic inflammatory responses (van Delden 2004). Colonization of the gastrointestinal tract in certain cases indicate that the organism can coexist with the host without causing any harm; but in critically ill patients, spread from the gut can be a major cause for systemic sepsis (Zaborina et al., 2006). Infection by P. aeruginosa follows a developmental programme involving discrete steps: surface attachment, biofilm formation with antibiotic-resistant population encased in an extracellular polymeric matrix (Costerton et al., 1995; Costerton et al., 1999; Toole et al., 1998) or tissue penetration and cellular damage that lead to apoptosis and necrosis of the host cells. The expression of an arsenal of tissue-destructive enzymes and multiple mechanisms for attachment and replication in host tissues to enable these processes are very typical of P. aeruginosa infection. Besides, these some of the virulence determinants are employed to evade the host defense mechanisms. A broad view of virulence determinants affecting the different stages of infection is shown in Figure 2.2. 10 A B Figure 2.2. P. aeruginosa virulence factors affecting different stages of infection. A. The blue rounded rectangles represent the different infection stages of the bacterium. The arrows below indicate the virulence factors affecting one or multiple stages as shown by the respective arrow heads. B. A representative P. aeruginosa cell showing selected virulence factors and interactions. 11 2.4. Host surface-attachment, a key step in P. aeruginosa invasion The first step in entry is adhesion to the host cells. P. aeruginosa attaches to host tissue with the aid of surface structures such as pili, flagella, lipopolysaccharide (LPS), and surface polysaccharides (Sadikot et al., 2005). The appendages- pili and flagella are described in detail in subsequent sections of this chapter. Lectins are sugar-binding proteins and contribute to adhesion by interacting with the carbohydrate moiety of glycosphingolipids or mucin. P. aeruginosa produces two lectins, LecA (PA-IL) (galactose binding) and LecB (PA-IIL) (mannose/fucose binding), which are both involved in biofilm formation (Tielker et al., 2005; Diggle et al., 2006). Produced in the cytoplasm, these bind to specific carbohydrate ligands located at on the bacterial outer membrane. In addition to mannose affinity, both have been shown to interact with the ABO(H) and P blood group glycosphingolipid antigens which may contribute to the tissue infectivity and pathogenicity of P. aeruginosa (Gilboa-Garber et al., 1994). Additionally LecB is also shown to be involved in pilus biogenesis and controlled by quorum sensing (Sonawane et al., 2006; Winzer et al., 2000). The LPS endotoxin is known to adhere to CFTR leading to ingestion into epithelial cells which support killing of the bacteria (Pier et al., 1997). Hence, LPS modification such as those found in clinical isolates, could affect the efficient uptake and subsequent bacterial clearance. Production of alginate, an exopolysaccharide composed of repeating polymers of mannuronic and glucuronic acid, leads to a mucoid phenotype. Recent reports have attributed two important virulence phenotypes- biofilm formation and swarming motility to rhamnolipids (Davey et al., 2003; van Delden 2004; Caiazza et al., 2005) as well. Other potential adhesins include multidrug efflux pump MexAB (Hirakata et al., 2002; Kondo 12 et al., 2006) and LPS. Such adhesins may be the prime targets for the host immune system. Host cell factors involved in binding P. aeruginosa adhesins leading to internalization are as follows: i) A large number of studies have implicated asialoganglioside gangliotetrasylceramide (aGM1) in pilin-mediated binding and invasion, although the magnitude of its contribution remains controversial (Soong et al., 2004). P. aeruginosa pili show specificity toward those with the Galβ1-4GlcNAc disaccharide available, aGM1 and asialoganglioside GM2 (aGM2) (Gupta et al., 1994; Sheth et al., 1994; Ramphal et al., 1991). This disaccharide moiety is specifically recognized by the C-terminal domain of the PilA subunit (Lee et al., 1994). Interestingly, aGM1 is more prevalent on the surface of primary CF cells and a CF bronchial cell line than on wild-type airway cells, suggesting at least one mechanism by which the lungs of CF patients are more susceptible to P. aeruginosa infections (Saiman & Prince 1993; Imundo et al., 1995). ii) The role of CFTR as a receptor for LPS-mediated adhesion has been shown by several reports though it may be cell type- specific (Pier 2000; Pier et al., 1997; Zaidi et al., 2004). CFTR is found to localize at the site of bacterial binding to the apical surface of polarized respiratory cells, possibly at specialized lipid domains. Other studies do not support a role for CFTR as a receptor for internalization. P. aeruginosa enters cells that express no detectable CFTR, such as A549 and MDCK cells (Plotkowski et al., 1999). Very recently it was reported that CFTR is necessary for 13 the clearance of phagocytosed P. aeruginosa by macrophages (Di et al., 2006). Although macrophages are professional phagocytes, this new function of CFTR might explain persistence of P. aeruginosa in CF patients. Alternatively, or in addition, the loss of CFTR may contribute to persistence by virtue of the decrease in internalization into lung epithelial cells, which would normally then be shed into the airways. iii) Fibronectin and α5β β 1 integrins have been shown to be involved in adherence of P. aeruginosa to dedifferentiated respiratory cells in an ex-vivo model of injured airway epithelium. The bacteria colocalized with β1 and α5 integrins (Roger et al., 1999). Using primary monocytes and neutrophils derived from a CR3-deficient individual afflicted with leukocyte adhesion deficiency (loss of CD18 integrin), 5 of 10 tested strains were internalized less efficiently compared to wild-type monocytes and neutrophils (Heale et al., 2001). iv) In Chinese Hamster Ovary (CHO) cells and mucin-producing lung epithelial cells lines, adherence was dependant on an ethanol extractable compound, identified as cholesterol and cholesterol esters. Consistent with this notion, bacterial adherence was reduced in CHO cells treated with lovastatin or in cholesterol-requiring insect cells grown in cholesterol-deficient medium (Rostand & Esko 1993). These findings indicate that the integrity of the lipid bilayer and its fluidity are essential and may reflect entry through lipid rafts. 14 2.5. Role of bacterial appendages in surface attachment The initial stages of attachment of the bacteria to the host cells is notably influenced by the bacterial surface appendages namely flagella and pili. Since these are studied extensively in this report, their role in virulence is described in detail in the following sections. 2.5.1. Flagellum- a primary adhesin The single polar flagellum of Pseudomonas aeruginosa is an important virulence and colonization factor of this opportunistic pathogen. The flagellar structure consists of two parts: the secretion apparatus (MS ring complex) and the axial structure. The major components of the axial structure are FlgG for the rod, FlgE for the hook, and FliC for the filament, each of which assembles with the aid of its corresponding cap protein. The cap protein for each substructure is FlgJ for the rod, FlgD for the hook and FliD for the filament. The former two serve as transient scaffolding proteins and thus are absent from the completed flagellum. Minor components are FlgB,C,F that connect the MS ring complex with the rod, and FlgK and FlgL that connect the hook and the filament. P. aeruginosa has a four-tiered transcriptional regulatory circuit that controls flagellar biogenesis (Dasgupta et al., 2003). Dedicated flagellar genes fleQ, fleS, fleR, fliA, flgM and fleN encode proteins that participate in the regulation of the flagellar transcriptional circuit. In addition, expression of the flagellum is coordinately regulated with other P. aeruginosa virulence factors by the alternative sigma factor σ54, encoded by rpoN. P. aeruginosa flagellins are classified as type-a or type-b based on aminoacid sequence, antigenecity and molecular weight. Structural analysis has identified two sites of 15 glycosylation in each monomer where a novel glycan is attached (Schirm et al., 2004; Verma et al., 2006). Flagellin from P. aeruginosa PAK (type a) is modified with a heterologous glycan of up to 11 monosaccharide units with a rhamnose linkage at S191 and S195. In contrast, the glycan from P. aeruginosa PAO (type b) flagellin is simpler and linked to the protein at T189 and S260 via a deoxyhexose monosaccharide to which an unidentified unique 209Da modification is attached distally. The genomic islands (GI) for both strains are similar in location, between flgL and fliC. The genetic content of PAK GI (14 ORFs) has been shown to be variable amongst other strains indicative of variability in glycan structure of type-a flagellins (Arora et al., 2004; Arora et al., 2001). On the contrary, GI of PAO strain contains only four ORFs, reflective of the simpler glycan structure on type-b flagellins. Studies with GI mutants have demonstrated that glycosylation is not required for flagellar assembly or motility but critical for virulence (Arora et al., 2005). Additionally, it appears to play a role in the proinflammatory action (interleukin 8 release) (Verma et al., 2005). Mutants defective in certain flagellar genes such as the flagellar cap fliD are non-motile and non-adhesive (Arora et al., 1998). A fliC mutant, which is non-motile and does not synthesize flagellin retains adhesion to mucin (Simpson et al., 1992), which suggests that either mucin is a structural component of the flagellar apparatus or it utilizes the flagellar export and secretion machinery (Feldman et al., 1998). This puzzle was later solved by Scharfman et al., when they identified that FliD of PAO strain (type-B flagellin) do bind to mucins bearing Lewis x (Lex) and sialyl- Lex derivatives and FliC bound only to Lex derivatives of mucin (Scharfman et al., 2001). In contrast, mutation in the fliD gene of strain PAK did not change the binding of the fluorescent conjugates compared to that 16 with the parental strain, indicating that the specific ligand of PAK FliD is not one of the Lex derivatives that is recognized by the PAO1 FliD. Hence, the recognition of human respiratory mucins with varied glycotypes at their periphery by the adhesin-flagellar system appears to be a multifactorial phenomenon, involving different flagellar components and different carbohydrate receptors. 2.5.2. Type IV pili-mediated attachment Type IV pili (T4P) are important in establishing lung infections for the opportunistic pathogen P. aeruginosa. An individual pilus ranges in length from 0.5 to 7 microm and has a diameter from 4 to 6 nm, although often, pili bundles in which the individual filaments differed in both length and diameter are seen. The pilus filament is comprised of thousands of pilin subunits. The type IV pilins are further grouped into two subclasses, Type IVa and IVb. The TypeIVa pilins have a 6- to 8- residue leader peptide, a ~144-160-residue mature sequence and an N-terminal phenylalanine. These pilins are present in a broad range of Gram-negative bacteria with distinct host and tissue specificity. The type IVb pilins have an long 10-30 residue leader sequence, 170-208 residue long mature sequence and a variable N-terminal residue typically hydrophobic. The Type IVb pilins are found only in Gram-negative bacteria that infect the gut. Though the sequence similarity is limited to the first ~50 residues, the overall structure of all Type IV pilins solved till date is remarkably similar. Structural and functional studies suggest that the conserved structural core directs pilus assembly, while the flanking loop and D-region are exposed on the pilus surface defining the diverse pilus functions. The T4P perform a remarkable array of functions crucial to pathogenesis including twitching 17 motility (Bradley 1980; Skerker & Berg 2001), host cell adhesion, microcolony formation and DNA binding (van Schaik et al., 2005) in P. aeruginosa. The core assembly elements for Type IVa pilus formation include the prepilin peptidase PilD that cleave the N-terminal extension of pilins aiding polymerization and cytoplasmic soluble ATPase PilB. PilQ forms multimers on the outer membrane that are believed to form gated channels through which the pilus pass (Bayan et al., 2006; Carbonnelle et al., 2006). PilP is suggested to be required for surface translocation (Martin et al., 1995) and required for PilQ function. These two share similarity with respective components of T2SS. Other structural proteins such as PilM,N,O,P,F and FimV are hypothesized to form a cell wall conduit that allows for repeated rounds of extension and retraction through the complex multi-layered Gram-negative cell envelop without disruption of cellular integrity. The outer membrane lipoprotein PilF directs the pilus fibre to detect the PilQ multimer (Koo et al., 2008). PilT is the retraction ATPase (Wolfgang et al., 2000) and is very critical for adhering to human epithelial cells and DNA binding/uptake (Winther-Larsen et al., 2005). It acts to disassemble pilin subunits from the base of the pilus fibre on the cytoplasmic side upon retraction and the released subunits enter back into the cytoplasmic membrane to be reused for subsequent polymerization (Morand et al., 2004). P. aeruginosa pili tethered to mica surfaces give rupture forces of 95 pN (Touhami et al., 2006). Another factor affecting the dynamics is the relative levels of PilT itself (Clausen et al., 2009). Pili of laboratory strains of P. aeruginosa bind to the glycosphingolipids asialo-GM1 and asialo-GM2 on host epithelial surfaces. The receptor binding region was localized to the 18 C-terminal loop of the pilin D-region (Sheth et al., 1994). Surprisingly this region is not well conserved among P. aeruginosa strains, even though they bind the same receptor. Structural and antibody binding studies revealed that many of the side chains in this region are oriented away from the loop structure exposing mostly main chain atoms at the globular domain surface at the tip of the filament (Lee et al., 1994; Hazes et al., 2000). 2.6. P. aeruginosa internalization by non-phagocytic cells Many clinical and laboratory isolates of P. aeruginosa demonstrate measurable internalization. All strains are capable of entering into both phagocytic and nonphagocytic cells to some degree (Fleiszig et al., 1997). It is possible that under some environmental conditions, it is beneficial to P. aeruginosa to enter into eukaryotic cells (for transcytosis, for immune evasion, or during its life in water environments), whereas under other circumstances, the bacteria actively prevents its uptake, through the actions of the type III secreted effectors ExoS and/or ExoT. Uptake of P. aeruginosa may also be more beneficial to the host, as a defense mechanism. For example, ingestion by macrophages may lead to bacterial death and presentation of bacterial antigens to the immune system. Internalization is a complex process involving both bacterial and host factors as described below. 19 2.6.1. Host signaling pathways necessary for P. aeruginosa invasion Bacterial entry into non-phagocytic cells involves usurping host receptors, entry pathways, and signal transduction pathways. Some such host factors play a significant part in internalization of P. aeruginosa as described here. i) Lipid rafts are specialized dynamic regions of the plasma membrane enriched in cholesterol, glycosphingolipids, glycosylphosphatidylinositol-anchored proteins, and membrane proteins (de Bentzmann et al., 1996; Brown & London 2000). They are thicker and less fluid than the rest of the membrane. Rafts are thought to be involved in a diverse array of cellular processes with a common theme of providing sites of local enrichment of molecules that need to interact with each other or to be transported to the same place in a cell. Caveolin is associated with a subset of lipid rafts. Several studies suggest that lipid rafts play a role in the internalization of P. aeruginosa (Grassme et al., 2003). P. aeruginosa PAO1 infection trigger the activation of the acid sphingomyelinase and release of ceramide in sphingolipid-rich rafts. Ceramide reorganize these rafts into larger signaling platforms that were required to internalize P. aeruginosa, induce apoptosis, and regulate the cytokine response in infected cells. Failure to generate ceramide-enriched membrane platforms in infected cells results in massive release of interleukin (IL)-1 and septic death of mice. Furthermore, it is interesting that lipid raft localization of CFTR contributes to host cell signaling in response to infection (Kowalski & Pier 2004). TLR2 has also been found to be enriched in caveolin-1-associated lipid raft microdomains on the apical surface of airway epithelial cells after infection with P. aeruginosa (Soong et 20 al., 2004). The signaling capabilities of TLR2 were enhanced upon association with aGM1; ligand binding to either molecule stimulated IL-8 production. ii) Actin cytoskeleton plays a major role in internalization by both zipper and trigger mechanisms (Cossart & Sansonetti 2004). The transient signals occurring after formation of the first ligand-receptor complexes and propagating around the invading microbe induce actin polymerization to extend the membranes. Upon closure of the phagocytic cup, depolymerization of actin takes place leading to retraction into the host cell. Rho family GTPases, Rac and Cdc42 are known to be activated upon adhesion of several bacterial pathogens leading to cytoskeletal rearrangements (Darling et al., 2004; Kazmierczak et al., 2004). iii) P. aeruginosa uptake into non-phagocytic cells is accompanied by changes in host protein tyrosine phosphorylation (Evans et al., 1998). Evidence for a role for Src, a cytoplasmic tyrosine kinase,comes from the finding that (i) invasion was increased in cells lacking Csk, a negative regulator of Src kinase (Evans et al., 2002) and (ii) PP1, a specific inhibitor of Src kinase, diminished invasion of these strains (Esen et al., 2001). Interestingly, a peptide competitor of the fourth extracellular domain of CFTR prevented Src and Fyn tyrosine phosphorylation, suggesting that entry through a CFTR-associated pathway is linked to activation of these tyrosine kinases. iv) Phosphoinositide 3-kinases (PI3Ks) are a highly conserved subfamily of lipid kinases that catalyze the addition of a phosphate molecule specifically to the 3-position of the inositol ring of phosphoinositides to generate PtdIns3P, PtdIns(3,4)P2, and PtdIns(3,4,5)P3) (Vanhaesebroeck & Alessi 2000). These short-lived phospholipids modulate the actin cytoskeleton and function as scaffolds to which specific effectors 21 that regulate membranes are recruited. Modification of phosphoinositides by kinases and phosphatases permits their precise temporal and spatial control, allowing them to tightly regulate local and transient cellular processes. PAK entry correlates with an increase in phosphorylation of threonine 473 on a serine threonine kinase Akt (Jansson et al., 2006). Inhibition of Akt activity, using a chemical inhibitor or RNAimediated depletion, decreased PAK entry without affecting adhesion. This suggests that the activation of PI3K and subsequent activation of Akt are necessary for PAK entry. v) Modulation of host cell viability is another emerging theme in host pathogen interactions. P. aeruginosa induces cell death by multiple pathways: a rapid, necrotic cell death through the phospholipase A2 activity of the type III secreted effector ExoU (Sato et al., 2005), a caspase-dependent cell death through ExoS (Jia et al., 2006) and a type III secretion but effector-independent apoptotic-like cell death (Hauser & Engel 1999). For P. aeruginosa PA01, activation of CD95 (Fas receptor) by CD95 ligand on cultured cell lines or lung epithelium has been shown to induce apoptosis in a type III secretion-dependent manner and to protect animals from infection. It has been proposed that internalization of P. aeruginosa without apoptosis of the host cell might permit the bacterium to block maturation of the phagosome, promote intracellular survival and growth of the bacterium, and protect bacteria from the host immune system, leading to higher mortality (Grassme et al., 2000). 22 2.7. Role of secretion systems in bacterial invasion Penetration through tissue is also an important aspect to aid dissemination of bacteria and establish infection. This requires cleavage of the extracellular matrix proteins and tight junctions while internalization happens mostly through receptor mediated response by the host. Very significant among the virulence factors are P. aeruginosa secretion systems that 1) release diffusible proteins to the surrounding environment to aid invasion through the host tissue or 2) deliver proteins directly into the cytosol of target cells. Given the flexible lifestyles and adaptability of this bacterium, it is not surprising that it possess almost all of the many Gram-negative secretion machineries discovered to date (Figure 2.3). For inner membrane translocation, Sec and Tat (co-factor bound proteins) systems are employed. To transport beyond the periplasm, there are four versions of the singlestep ABC-type machinery (Type I secretion system), T3SS and the flagellar secretion system. T3SS is a Sec-independent translocation process that involves direct delivery of effector molecules from bacterial cytoplasm to the host cytosol through a specialized needle complex. Flagella itself is assembled by secretion of flagellin units and serves as critical surface appendage for motility and attachment. Additionally, there are four potential versions of type II secretion system (T2SS), three copies of chaperone-usher pathway, type V secretion system (T5SS consisting of three autotransporters and six twopartner secretion systems) and three type VI secretion systems (T6SS). Further there are the type IV pili (T4P), whose biogenesis occur by a mechanism closely related to T2SS and these two pathways are evolutionarily related (Peabody et al., 2003). 23 Figure 2.3. Bacterial secretion systems. HM: Host membrane; OM: outer membrane; IM: inner membrane; MM: mycomembrane; OMP: outer membrane protein; MFP: membrane fusion protein. ATPases and chaperones are shown in yellow. (Tseng et al., 2009) 24 2.7.1. Type II secretion system (T2SS) in P. aeruginosa The type II secretion system typically is composed of 12-16 proteins termed Gsp (general secretion pathway) proteins (Filloux 2004). These components associate in a large multiprotein structure (secreton) that spans the periplasm and is thought to connect inner and outer membranes. Exoproteins that use the T2SS are characterized by the presence of a signal peptide at their N-terminus and are secreted in the extracellular medium by a twostep process involving a transient periplasmic intermediate. It promotes secretion of even large multimeric proteins that are folded in the periplasm. The system’s species specificity is conferred by the gate keepers. In contrast to the operon structure of other species, gate keepers (xcpC and xcpD) of P. aeruginosa form a divergent operon from that containing the xcpE-M genes. Also, T2SS assembly and most related exoproteins are regulated via quorum sensing in this bacterium. The structure of typical T2SS is shown in Figure 2.4A. The secreton consists of an inner membrane platform composed of XcpP, S, Y and Z forming the core of the machinery with XcpR associated to the inner membrane through an interaction with the bitopic protein XcpY (Ball et al., 1999). The secreton also contains proteins homologous to pilin PilA and are designated as pseudopilins. These are involved in formation of a piston-like structure, the pseudopilus, mainly made of XcpT but also require the minor pseudopilins XcpUVWX (Durand et al., 2005; Bleves et al., 1998; Durand et al., 2003). T2SS and Type IV pili machineries share one component: the prepilin peptidase XcpA/PilD, an inner membrane protein required for maturation of the pseudopilins and PilA. XcpP is the protein that interacts with both the inner and outer membrane components. The region between the transmembrane and the periplasmic 25 A B Figure 2.4. Type II secretion system in P. aeruginosa. A. Structure of conventional Type II secretion system in P. aeruginosa. The secreton spans across the membrane bilayer and proteins from cytosol are transported first to the periplasmic space and then to the extracellular milieu. Alphabets represent names of Xcp family proteins. B. Genetic organization of the different T2SSs found in P. aeruginosa compared to the classical system described in E. coli. Xcp system has a typical organization while Hxc system is atypical and xphA-xqhA is incomplete. 26 domains is required for the stability of XcpYZ subcomplex and believed to be the determinant of species specificity of the T2SS system (Gérard-Vincent et al., 2002). Finally, XcpQ, the only outer membrane component of the system belongs to the secretin family (Bitter 2003) and constitutes the channel of this system. The energisation of this nanomachine is probably promoted by XcpR, which has traffic ATPase motifs and could drive the pseudopilus piston through the XcpQ channel, pushing out exoproteins to the external medium. The number of assembled secretion machineries is estimated at 50-100 complexes per cell in P. aeruginosa (Brok et al., 1999). T2SS secretes a variety of proteins which include elastases (LasA,B), Exotoxin A, Chitin binding protein, type IV protease, lipases (LipA,C), phospholipase Cs (PlcH,N), aminopeptidase and alkaline phosphatases (LapA,B). A lethal toxin, exotoxin A (ETA) mediates cell death through ADP-ribosylation of elongation factor 2 (Pavlovskis et al., 1978). The invasion of tissue and the spread of the organism are aided by secretion of proteases, hemolysins and phospholipases. The elastase LasB is a well-characterized 33kDa zinc metalloproteinase that cleaves proteins at multiple sites and can degrade many host proteins in addition to elastin. It ruptures the respiratory epithelium by damaging tight-junctions and facilitating neutrophil recruitment. It also inactivates respiratory tract surfactant proteins and proteinase-activated receptor 2, and increases IL-8 levels (Kipnis et al., 2006). LasA is also a 20-kDa Zinc metalloendopeptidase and possesses a low level of elastolytic activity, but is important as an enzyme that enhances the elastolytic activity of LasB. P. aeruginosa elastase and LasA protease are synthesized as preproenzymes with long amino-terminal propeptides that is cleaved autocatalytically in the periplasm to 27 form a transient, inactive elastase-propeptide complex. In contrast, the processing of proLasA does not involve autoproteolysis but is processed by LasB, alkaline protease or PrpL (protease IV) (Grande et al., 2007). Type IV protease has also been assigned the name of PrpL, and is shown to be regulated by PvdS (Wilderman et al., 2001). It is a serine protease and can digest casein, lactoferrin, transferrin, fibrinogen, plasminogen and decorin. It possess a N-terminal leader peptide though its secretion mechanism is unknown (Matsumoto 2004; Traidej et al., 2003). CbpD, a chitin-binding protein, is one of the major secreted proteins of P. aeruginosa but does not have staphylolytic activity. Elastase digests this into several fragments, including a 30-kDa and a 23-kDa form. All three are secreted via the Xcp secreton. One possibility is that CbpD acts as an adhesion-mediating colonizing factor of eukaryotic cells, although this remains to be proven (Folders et al., 2000). The aminopeptidase appears to be enriched in the outer membrane vesicles produced by P. aeruginosa from clinical isolates. As these vesicles activate a significant IL-8 proinflammatory response in lung epithelial cells, they have a potential role in the colonization of lungs (Bauman & Kuehn 2006). It is a zinc-dependent leucine aminopeptidase regulated in part by the las quorum sensing system. Other than this classical Xcp secreton, P. aeruginosa also possess an atypical T2SS described as hxc (for homologous to xcp). This is an independent T2SS however, it is functional only in phosphate-limited growth conditions and promotes secretion of the alkaline phosphatase LapA (Ball et al., 2002). The genetic organization of the genes of this system is dispersed unlike the xcp genes (Figure 2.4B). It is speculated that the significance of this system is to improve inorganic phosphate acquisition when phosphate 28 concentration becomes limiting. In addition to this, two genes named xphA and xqhA, homologous to the xcpP and xcpQ genes have been identified in P. aeruginosa (Martínez et al., 1998) and are located in a single operon at a distant locus from the classical T2SS (Figure 2.4B). These two proteins constitute a functional GspCD subunit since they can associate with the GspE-M components to restore secretion in gspCD mutant except for the secretion of aminopeptidase (Michel et al., 2007). Since this operon is constitutively expressed, it can be speculated that this pair helps in secretion at early growth stages helping in the establishment of P. aeruginosa in the host before the gspCD operon becomes activated or it could be involved in secretion of specific substrates under peculiar culture conditions/ signal from host. 2.8. Coordinated regulation of P. aeruginosa virulence mechanisms Of all the sequenced bacterial genomes, P. aeruginosa possesses the largest proportion of regulatory genes (10%). This striking feature likely is the reason for its ability to coordinate the expression of many genes in response to the wide range of environmental demands to which the organism is exposed to (Stover et al., 2000). The regulatory genes involved in this process range from global regulators such as sigma factors, the twocomponent regulators, specific transcriptional regulators (Palma et al., 2005; Heurlier et al., 2006) and more importantly the cell-cell communication system, quorum sensing (QS) (Venturi 2006). These regulators may act at transcriptional, translational or posttranslational level by manipulating cellular phenomena such as levels of nucleotide second messenger pools and post-translational modifications. The integration of the regulatory systems results in a fine-tuned response that strikes a balance in gene expression depending on the diminution of the current signal versus appearance of new 29 signals. In a dynamic environment, such a balance may be maintained by sensing and altering the metabolism, probably by varying the levels of cyclic nucleotides namely cyclic-AMP (cAMP) and cyclic digunalyate (c-di-GMP). The expression of regulator fleQ in P. aeruginosa has been shown to respond to Vfr regulon in the lungs of CF patients (Dasgupta et al., 2002) while its regulatory function on polysaccharide pel biosynthesis is affected by c-di-GMP (Hickman & Harwood 2008). Under high cell density conditions, a very important regulatory system known as Quorum Sensing (QS) gets triggered. Quorum sensing (QS) is defined as a mechanism by which bacteria regulate specific target genes in response to a critical concentration of signal molecules, which is a measurement of the cell density of a bacterial population. P. aeruginosa utilizes two classes of signaling molecules for this purpose- N-acyl homoserine lactones (AHL) and 4-Quinolones (4Q). There are two AHL dependent systems namely las and rhl, each comprising of an AHL synthase-cognate transcriptional activator pair; these systems are hierarchically organized with the las system exerting transcriptional control over rhlR/I. Several reports have shown that genes governing the expression of acute (eg., T3SS) and chronic (eg., biofilm formation) virulence factors are inversely regulated (Ventre et al., 2006; Laskowski et al., 2004; Kulasakara et al., 2006; Goodman et al., 2004). Virulence factors regulated by the Las-system include elastase (LasB), Las A protease, ETA, alkaline protease, type II secretion machinery and biofilm differentiation. On the contrary, the Rhl-system regulates rhamnolipids and pyocyanin in addition to the above except ETA (Smith & Iglewski 2003). Although QS contributes actively to the regulation of gene expression in the biofilms under in vitro conditions, a functional QS system is not 30 required for P. aeruginosa biofilm formation per se (Bjarnsholt et al., 2010). QS is important for the initial stage of infection providing the bacteria with an immune shield which is protective against the antimicrobial activity of polymorphonuclear leukocytess. P. aeruginosa isolates may lose LasR dependent QS but keep the capability of RhlR dependent QS regulation enabling production of a number of important host damaging virulence factors particularly rhamnolipids. This capability is maintained till late in the chronic infection, in particular in mucoid isolates (Bjarnsholt et al., 2010). Interestingly, a nonmotile strain (∆fliC) and a strain a slight defect in swimming (∆motCD) presented a hyperefficient T3SS (Soscia et al., 2007). Moreover GacA, response regulator which positively regulates motility (Goodier & Ahmer 2001) also shows inverse relationship with ExoS secretion. These results suggest that flagellar assembly and/or mobility antagonizes the T3SS and that a negative cross talk exists between these two systems. Moreover, two sensor systems have been described that reciprocally regulate the expression of the TTSS and the production of exopolysaccharides that lead to biofilm formation (Ventre et al., 2006; Goodman et al., 2004). In line with this, mutation of the TTSS has been shown to enhance biofilm formation, leading to the suggestion that TTSS may be detrimental to biofilm formation (Kuchma et al., 2005). However others have shown that biofilms grown in continuousflow system, TTSS is expressed i.e. they are not mutually exclusive (Mikkelsen et al., 2009). Other examples of coordinated regulation of virulence phenotypes are also established in P. aeruginosa as described for cyclic diguanylate in the following section. 31 2.9. C-di-GMP signaling Signal transduction via second messengers is a common mechanism not only to regulate basic cellular functions, but also complex behavior in both prokaryotes and eukaryotes. Known for more than 20 years as an activator of cellulose synthase in Gluconacetobacter xylinus, c-di-GMP is emerging as a novel global second messenger in bacteria (Ross et al., 1987; Jenal & Malone 2006). C-di-GMP is synthesized by a class of enzymes containing GGDEF domains (adenylate cyclase; DGC) and hydrolyzed by another protein family containing EAL domains (phosphodiesterase; PDE). C-di-GMP signaling system is highly abundant in many bacterial species, yet their functions do not appear to be redundant (Galperin 2005). Though multiple GGDEF/EAL proteins in a species may affect a particular phenotype, regulation by each protein seems to occur under different environmental conditions suggesting temporal and/or spatial compartmentalization of nucleotide pools. Low concentrations of c-di-GMP are associated with cells that move by virtue of flagellar motors or retracting pili. In contrast, increasing concentrations of c-diGMP promote the expression of adhesive matrix components and result in multicellular behavior and biofilm formation (Römling et al., 2005; Romling & Simm 2009) as shown in Figure 2.5A. The number of different input domains associated with GGDEF and EAL domains suggests that a wide variety of environmental signals can be perceived and transmitted by the c-di-GMP signaling network (Jenal 2004) (Römling et al., 2005). C-diGMP has been proposed to control cellular functions at the transcriptional, translational, and posttranslational levels (Weber et al., 2006; Levi & Jenal 2006; Kader et al., 2006). Combined with the variety of cellular functions affected by c-di-GMP, it is not surprising that multiple effector molecules and mechanisms involved in c-di-GMP-mediated control 32 (Figure 2.5B) (Sudarsan et al., 2008; Leduc & Roberts 2009; Tao et al., 2010; Pratt et al., 2007). A B Figure 2.5. Phenotypes regulated by c-di-GMP and binding sites/domains. A. Phenotypes regulated by low (left side) and high (right side) concentrations of c-di-GMP (Romling & Simm, 2009). B. known and predicted c-di-GMP-binding sites and protein domains. In the chemical structure of c-di-GMP, G stands for guanine. In protein domains, a gray background indicates the lack of enzymatic activities usually associated with these domains (Gomelsky 2009). 33 2.9.1. Role of c-di-GMP signaling in virulence regulation Cellular functions regulated by c-di-GMP include cell-cell signaling, biofilm formation, motility, differentiation, and virulence. C-di-GMP activates biofilm formation in a variety of bacteria, including P. aeruginosa, Salmonella typhimurium, Vibrio spp., and Y. pestis (Tischler & Camilli 2004; Simm et al., 2004; Hickman et al., 2005; Kirillina et al., 2004). C-di-GMP activates the production of different EPS components depending on the species. There is strong evidence that V. cholerae uses c-di-GMP to increase vps transcription and augment biofilm formation. P. aeruginosa also uses c-di-GMP to regulate biofilm formation through WspR as described below and the SadARS three component signal transduction system where SadR is a PDE (Kuchma et al., 2005). In addition, a comprehensive study that analyzed phenotypes associated with mutations in all putative DGC- and PDE-encoding genes of P. aeruginosa found a strong correlation between high intracellular c-di-GMP and hyperbiofilm formation (Kulasakara et al., 2006). C-di-GMP inhibits bacterial locomotion of various types, including swimming, swarming, and twitching motility. Since motility commonly contributes to pathogenesis, often necessary in early steps of colonization of the host, the c-di-GMP-mediated regulation of this process is significant. Bacterial swimming abilities are provided by flagella; swarming motility across surfaces is aided by flagella in some bacteria; and twitching motility across surfaces is provided by a cycle of extension, attachment, and retraction of Type IV pili (T4P). The first direct evidence of c-di-GMP regulation of twitching motility came from mutation of the P. aeruginosa fimX gene, which encodes a protein containing REC, PAS, GGDEF, and EAL domains (Huang et al., 2003). 34 Twitching motility of P. aeruginosa can be affected by the Wsp chemosensory system controlling the c-di-GMP level. It includes WspR (a DGC) and WspF, which are response regulator-like proteins. Mutation of wspF causes constitutive activation of WspR and, as a result, elevated the c-di-GMP level leading to increased biofilm formation, decreased twitching motility, and decreased swimming (D'Argenio et al., 2002; Borlee et al., 2010). The extracellular signals that activate the Wsp system are unknown, but activation of WspR DGC activity promotes sessility by inhibiting multiple types of motility and activating biofilm formation (Hickman et al., 2005). Downregulation of flagellar motility by c-di-GMP also has been demonstrated in Salmonella Typhimurium and V. cholerae (Tischler & Camilli, 2004; Simm et al., 2004). A summary showing c-di-GMP regulation at different levels of flagellum based motility is given in Figure 2.6 (Wolfe & Visick, 2008). These together render a classic example for the complex nature of c-di-GMP regulation mechanisms on a single phenotype. These putative or established mechanisms can be classified on the basis of the affected level: (i) transcription, (ii) post-transcription, (iii) function, and (iv) ejection. Other than those described above and mentioned in Figure 2.6, few other DGCs and PDEs are known to regulate motility at different levels. Some examples include- ScrC/G pathway in V. parahaemolyticus and MorA in P. putida at transcriptional level, MifA/B pathway in V. fischeri at post-transcriptional level, YcgR affecting swimming speed in E. coli, and SadC/BifA in P. aeruginosa affecting flagellar reversal rates. 35 Figure 2.6. Regulation of flagellum-based motility by c-di-GMP signaling. The level st which regulation occurs is mentioned. CdgF, a DGC decreases flagellar gene expression; TipF, a PDE influences FliK flagellin levels but not gene transcription; Flagella motor function – YhjH/YcgR in E. coli, DgcA/DgrA in C. crescentus; flagellum ejection occurs with the proteolysis of FliF and the GGDEF domain of PleD is required for FliF proteolysis (Adapted from Wolfe & Visick, 2008). 2.9.2 MorA signaling Our laboratory has previously described a novel membrane-localized regulator, MorA, which controls the timing of flagellar development and affects motility, chemotaxis, and biofilm formation in Pseudomonas putida (Choy et al., 2004). MorA is conserved among diverse Pseudomonas species, and homologues are present in all Pseudomonas genomes sequenced thus far. Members of the Pseudomonas MorA family (i) are present as single copies in the genome, (ii) are membrane localized due to the transmembrane domains (Choy et al., 2004; Fu Swee Jiun, Honors’ thesis, 2006) (iii) possess a central sensory 36 domain consisting of PAS-PAC motifs, and (iv) have C-terminal GGDEF (diguanylate cyclase) and EAL (phosphodiesterase) domains (Figure 2.7). Figure 2.7. Domain structure of MorA in P. putida and P. aeruginosa. MorA homologues in the model organisms used in this study differ in the number of transmembrane and redox-sensing domains. Catalytic domains are active in both species. In Pseudomonas aeruginosa, the absence of MorA led to a reduction in biofilm formation. However, unlike the motility of P. putida, the motility of the P. aeruginosa mutants was unaffected in soft-agar plates (Choy et al., 2004). However, video microscopy and TEM images show timing of flagellar development is affected i.e. early phase cultures have more flagellated cells when MorA is lost (Wong et al., in preparation; Ravichandran et al., in preparation). Another group has also shown that MorA affects colony morphology and twitching motility in a small colony variant of a clinical P. aeruginosa strain (Meissner et al., 2007). Functional characterization of MorA domains showed that they indeed control the levels of c-di-GMP in both P. putida and P. aeruginosa in vitro. In both species, a weak phosphodiesterase activity and dominant diguanylate cyclase activity are observed (Wong et al., in preparation). Investigation of the genes regulated by P. aeruginosa 37 MorA (transcriptional profiling) has revealed the possibility that many pathways including type III secretion and phospho-acetyltransferase might be under the control of this global regulator (Choy et al., 2008). RNA levels of some of these genes have been verified quantitatively (Figure 2.8; Appendix VIIb). These results have formed the basis Fold change of transcripts (morA KO/ WT) for the objectives of this study. Figure 2.8. Verification of transcriptional level effect of MorA on T3SS genes. Quantitative real-time PCR verification of type III secretion system genestranscriptional regulator exsA and secreted effector exoS. 2.10. Bacterial Ser/Thr/Tyr phosphorylation system Protein phosphorylation occurs widely in microbial systems. It is used not only to regulate enzyme activities (Postma et al., 1993) but also to control protein–protein interactions through characteristic domains such as forkhead-associated (FHA) domains, which recognise phosphothreonine-containing proteins (Durocher et al., 2000). Bacterial phosphoproteins and their interactions have been implicated in important cellular activities such as catabolite repression, morphological differentiation, sugar transport, cell growth, and viability (Deutscher & Saier 2005). Currently, three types of phosphorylation are known in bacteria namely the histidine/aspartate phosphorylation seen in twocomponent signal transduction systems, phosphoenolpyruvate-dependent 38 phosphotransferase system of sugars and kinase-dependent Ser/Thr/Tyr phosphorylations. While two-component response regulators and phosphotransferase system have been extensively studied in bacteria, comparatively much less is known about the global effect of stable phosphorylation events on serine, threonine and tyrosine residues. With homologues of Ser/Thr kinases and two-component proteins having been found in both prokaryotes and eukaryotes (Ponting et al., 1999; Kennelly 2002), and evidence for Ser/Thr/Tyr phosphorylation (Bakal & Davies 2000; Novakova et al., 2005) in several bacterial pathways, the trend has now changed. These have recently been implicated in exopolysaccharide production and other virulence/ host-evading phenomena (Cozzone 2005), secretion (Mougous et al., 2007; Kulasekara & Miller 2007), and heat shock response (Klein et al., 2003). Some of the characterized bacterial Ser/ Thr kinases are homologous to the eukaryotic kinases while some are not (Bakal & Davies 2000; Pereira et al., 2011). Recently, phosphorylation has also been shown to regulate the assembly and function of type VI secretion system (T6SS) in P. aeruginosa (Mougous et al., 2007) most likely at the cytoplasmic membrane. This is the first known example of posttranslational control of a bacterial secretory system. One may expect that in the near future, Ser/Thr/ Tyr phosphorylation may turn out to be one of the key processes in the bacterial cell and will yield new insights into the understanding of its physiology. Many phosphorylated proteins have been identified in bacteria since decades, yet a clear mechanism through which they affect a particular phenotype remained unknown. In eukaryotes the kinases are generally associated with cellular organelles while in bacteria one can assume they are membrane-associated. But no confirmed report on their localization is available till date. Lately, a new class of bacterial tyrosine kinase (BY 39 kinases) has also been described in a variety of bacteria (Grangeasse et al., 2007). The tyrosine kinases are emerging as potential antibacterial therapy (Bechet et al., 2009; Cozzone, 2009). Other peculiar bacterial kinases are being characterized worldwide (unpublished data). Owing to the growing awareness of the importance of protein phosphorylation in controlling various bacterial pathways, there have been attempts in the recent past to describe the phosphoproteome of bacteria (Levine et al., 2006; Bendt et al., 2003). Ser/Thr/Tyr type is a stable under in vitro conditions and hence amenable to proteomewide screening methods. In contrast, others such as two-component systems and phosphotranfer systems are transient. Since the first report in 2007, phosphoproteome reports have been from the Gram-positive model organisms – pathogenic Bacillus subtilis (Macek et al., 2007), Streptococcus pneumonia (Sun et al., 2010) and non-pathogenic Lactococcus lactis (Soufi et al., 2008), and Gram-negative organism Escherichia coli (Macek et al., 2008). These phosphoproteomes seem to be evolutionarily conserved in the number of phosphoproteins, classes to which they belong, and distribution of phosphorylated sites. The phosphopeptides identified in these bacteria suggest that the target sequences for bacterial kinases are quite dissimilar to the eukaryotic counterparts. 40 CHAPTER 3 MATERIALS AND METHODS 3.1. Bacterial strains, plasmids and growth conditions The bacterial strains and plasmids used in this study are described in Table 3.1. The P. putida cultures were grown at 30oC and P. aeruginosa at 37oC routinely in Luria-Bertani (LB) medium unless mentioned otherwise. For experiments on type III secretion system (T3SS), 5mM EGTA was added to LB to induce the secretion of effectors. For pyoverdine assays, King’s B medium (King et al., 1954) was used; this medium promotes the production of pyoverdin, a yellow-green fluorescent pigment that can be oxidized to yellow. E. coli strains were grown routinely in LB medium at 37°C with suitable antibiotics (Table 3.1). Bacterial growth was measured spectrophotometrically at OD600. Table 3.1. Bacterial strains and plasmids used in this study Strain or plasmid Relevant characteristicsa Source or reference P. putida PNL-MK25 WT morA KO morA OE Wild-type P. putida strain; Cmr Rfr PNL-MK25 mutant (morAPp::aacC1); Cmr Rfr Gmr PNL-MK25 overexpressing MorA (pGB1 morA); Cmr Rfr Gmr Ampr Tetr Adaikkalam and Swarup Choy et al., 2004 Choy et al., 2004 P. aeruginosa PAO1 WT Wild-type P. aeruginosa strain morA KO PAO1 mutant (morAPa::aacC1); Gmr morA OE PAO1 WT overexpressing MorA (pUPMR); Ampr ∆morA PAO1 markerless deletion mutant Dasgupta et al., 2003 Choy et al., 2004 Choy et al., 2004 Lab collection (unpublished) 41 E. coli DH5α General plasmid propagation strain Lab collection BL21 Protein expression strain Novagen Broad-host-range vector; Ampr Tetr Bloemberg et al., 1997 Bloemberg et al., 1997 Lab collection Plasmids pGB1 pGB3 pGB1 vector carrying GFP; Ampr Tetr pETM Modified pET32 (Novagen) expression vector lacking Trx and S tags pGB1 morA Full-length morAPp gene with its native promoter cloned into pGB1; Ampr Tetr Full-length morAPa gene cloned into pUCP19; Ampr Full-length lasB gene with hemagglutinin (HA) peptide tag at C-terminal cloned into pGB1; Ampr Tetr Full-length lasB gene with FLAG peptide tag at C-terminal cloned into pGB1; Ampr Tetr Fluorescent marker cloned from Clontech vector into pGB1 Fluorescent marker cloned into pGB1 pUPMR pGB1-LasB-HA pGB1-LasBFLAG pGB1-DsRed express pGB1- BFP Choy et al., 2004 Choy et al. This study This study Lab collection Lab collection pGB1-ZsGreen Fluorescent marker cloned from Clontech vector into pGB1 Lab collection pETM-LasB pETM carrying partial LasB (A198-L498) This study pETM-PrpL pETM carrying partial PrpL (A212-P462) This study pETM-CbpD pETM carrying partial CbpD (H26-N299) This study a Cm, chloramphenicol 15 µg/ml; Rf, rifampicin 20 µg/ml; Km, kanamycin 15 µg/ml; Gm, gentamycin 20 µg/ml (PNL-MK25) or 100 µg/ml (PAO1); Amp, ampicillin 100 µg/ml; Tet, tetracycline 25 µg/ml; morAPp, morA gene in P. putida; morAPa, morA gene in P. aeruginosa. 3.2. Gene expression studies Total RNA were extracted from bacterial pellets at using TRIzol® Reagent (Invitrogen Corp., USA) according manufacturer’s instructions with the following modification: bacterial cell pellets were mixed by vortexing in TRIzol and heated at 50oC for 10 min 42 prior to RNA extraction to lyze the cells. For reverse transcriptase (RT)-PCR analysis of the proteases, RNA samples from early-, mid- and late-logarithmic phases were compared while for quantitative real-time (qRT)-PCR of T3SS genes, only RNA from mid-log phase was used. Five µg of total RNA was converted to cDNA using the Superscript IITM First-Strand Synthesis System (Invitrogen) as per manufacturer’s instructions. Primers for qRT-PCR were designed with Primer Express (Applied Biosystems) and amplification performed using the SYBR Green PCR Master Mix (Applied Biosystems) as per manufacturer’s instructions. RpsL, coding a ribosomal protein was used as loading control. Primers used are listed in Table 3.2. 3.3. Cloning and genetic manipulation studies For recombinant protein expression, fragments of lasB, prpL and cbpD were cloned into expression vector. Only partial genes (for sequence of regions, refer Appendix Ia; primers in Table 3.2) excluding the signal peptide region were cloned to avoid antibody cross reactivity between the proteases. After PCR amplification from genomic DNA at optimal conditions using ImmomixTM (Bioline) and restriction digestion, the partial genes were cloned into pETM (Table 3.1, Novagen) and transformed into E. coli DH5α. Upon selection on Ampicillin and verification of insert presence by DNA sequencing and restriction digestion, the recombinant plasmids was transformed into E. coli BL21. 43 Table 3.2. List of primers used for gene expression studies and cloning experiments Gene ExoS ExsA RpsL LasB PrpL CbpD LasB PrpL CbpD Primer Primer sequence* Transcriptional analysis 5' GGGCAGGGCA CGATATCC 3' ExoS-qRT_F 5' GTTCGATATC CCGCTGACAT C 3' ExoS-qRT_R 5' CATGGAGGCG GGCTTTT 3' ExsA-qRT_F 5' GCGTGCAGCC GAAACG 3' ExsA-qRT_R 5’ GCAACTATCA ACCAGCTG 3’ rpsL-1 5’ GCTGTGCTCT TGCAGGTTGT G 3’ rpsL-2 5' ACGTTGCGGG CAGTTCTG 3' qRT_RpsL_F 5' AGCCGCGTAA GCGTATCGT 3' qRT_RpsL_R 5’ TCGCCAACAT CGCTGCCG 3' LasB_F 5' CGGAACGGCG TGGTCTTGC 3’ LasB_R 5’ CCAGGCCAAG AGCCTGAAG 3’ LasB_qRT_Fwd 5’ CGGATCACCA GTTCCACTTT G 3’ LasB_qRT_Rev 5’ GTACGCCGCT GCAAGTGGG 3’ PrpL_F 5’ TGGATGTCAT GGCCGAGCG 3’ PrpL_R 5’ GGATGAACTG CCCGCTGCC 3’ CbpD_F 5’ ACAGCAGGGT CCAGGCGTCC 3’ CbpD_R 5’ CCGGCAAGCA TGTGATCTAT AA 3’ CbpD_qRT_Fwd 5’ CGTCGATGCA GGCGTAGAA 3’ CbpD_qRT_Rev For recombinant protein expression LasB_FwBamHI2 LasB_RvHindIII2 PrpL_FwBamHI2 PrpL_RvHindIII CbpD_FwBamHI2 CbpD_RvHindIII2 5’ CGCGGATCCA AGATCGGCAA GTACACCTAC GG 3' 5' TCAGAAGCTT TTACAACGCG CTCGGGCAGG 3’ 5’ CGCGGATCCA GCGGCAGCTG CGAGGTGGATG 3’ 5’ TCAGAAGCTT TCAGGGCGCG AAGTAGC 3’ 5’ CGCGGATCCC ACGGCTCGAT GGAAACGC 3’ 5’ TCAGAAGCTT TGGTTGTCCT GCGAGCTGGC C 3’ Construction of LasB-tag LasBF-BamHI FLAG HA LasBR-FLAG LasB-DwnF-FLAG LasBR-HA 5' TACTGGATCC ATGAAGAAGG 5' TTAGCCCTTA TCATCGTCGT CATCAACGCG CTCGGGCAG 3' 5' GATGATAAGG GCTAAGCTCG 5' TTATGCGTAG TCTGGGTCGT CAACGCGCTC GGGCAG 3' 5' CCAGACTACG CATAAGCTCG TTTCTACGCT 3' CCTTGTAGTC GTGGTCCCGG C 3' ATGGGTACAT GTGGTCCCGG C 3' LasB-DwnF-HA LasB-DwnR-HindIII 5' CGATAAGCTT GGGATTCGAT GAAACGGGTG 3' *Bases in bold fonts represent the restriction enzyme sites added to enable cloning into vectors while underlined bases represent portion of the tag sequence introduced. 44 In order to track the cytoplasmic and secreted LasB levels, two small peptides namely FLAG (Hopp et al., 1988) and hemagglutinin (HA) (Field et al., 1988) were used to tag LasB. Since there was no LasB antibody available, this indirect method was used. The tags were cloned to the C-terminal of the gene to avoid interfering with the signal peptide for transport at the N-terminal. The peptide sequences of the tags are MDYKDDDDKG and MYPYDVPDY respectively. Figure 3.1. Strategy for insertion of peptide tag to LasB. The open arrows represent the primers and closed arrow indicates start of gene. The two sets of primers used to perform fusion PCR are mentioned with prefix “LasBF/R” and “LasB-DwnF/R”. The tag (FLAG or HA) is shown as double lines in the primer and as open box after cloning. Fusion PCR strategy was employed to incorporate the peptide sequence as shown in Figure 3.1 and primers used are given in Table 3.2. The fusion PCR product was cloned into pGB1 (Bloemberg et al., 1997) and upon verification by DNA sequencing (Appendix Ib), transformed into P. aeruginosa PAO1 strains by electroporation. 3.4. Expression of recombinant proteins Overnight cultures of BL21 carrying the expression clones for the proteins were diluted 1:100 v/v in LB and grown at 37oC. Once the cells entered log-phase (OD600 0.6-0.8), Isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 45 0.1mM in the culture to induce protein expression and grown at 18oC overnight. Cells were then harvested, washed, lysed by sonication and centrifuged. Both the supernatant and the pellet were run on SDS-PAGE. Successful expression was achieved at a smallscale for LasB and CbpD in the insoluble fraction. But upon large-scale expression and solubilization, both did not give the required yield. Also, concentration of urea (8M) recommended for solubilization was too high and may prove to be toxic for the injected animal. Hence, only the abundant T2SS protease, LasB was chosen. A mixture of insoluble partial LasB and secreted extracellular LasB were sent to LAMPIRE® Biological Labs. Inc., USA for polyclonal antibody production. 3.5. Secretome analysis P. aeruginosa strains were diluted 1:100 in 100ml LB from an 8-hr initial culture and grown overnight. Cell density (OD600) was ensured to be equal across the different strains and cultures centrifuged. The supernatants were filtered through 0.20 µ m PES filter (Sartorius) to remove cells if any. For analysis of secreted protein levels, trichloroacetic acid (TCA) precipitation method was used to extract extra-cellular proteins (ECP) from culture supernatants as described previously (Ha et al., 2004). Briefly, TCA (60% w/v at 4oC) was added to the cell-free supernatants to a final concentration of 10% w/v and incubated at 4oC for 2- 16 hours. The precipitated protein was recovered by centrifuging at 20,000 x g for 5 minutes at 4oC and the pellet washed thrice with approximately 10ml ice-cold acetone each time to remove salts. Following the third wash, the pellets were transferred to 1.5 ml tubes and air dried. 46 Optimization for solubilization buffers was necessary to obtain clear bands on SDSPAGE. Initially the dry pellet was dissolved in ReadyPrep sequential extraction kit reagent 3 (Bio-Rad) which mainly contained Tris, Urea, thiourea and CHAPS. Though bands could be seen, they weren’t clear enough to be used for comparison between lanes (Figure 3.2). Figure 3.2. Optimization of P. aeruginosa secreted protein extraction. SDS-PAGE gel showing profile of P. aeruginosa PAO1 secreted proteins before and after optimization of solubilization buffer. Left panel shows sample dissolved in ReadyPrep sequential extraction kit reagent 3. Right panel shows sample in Tris-DTT-SDS denaturing buffer. Hence, dialysis was performed to reduce the concentration of the detergents and improve sample quality. But the drawbacks with this method were inconsistency of sample quality between batches, protein loss and dilution. Furthermore, the proteins aggregated when the dialyzed samples were concentrated in a membrane column (Vivaspin6). Hence a denaturing buffer containing 40 mM Tris, 40 mM Dithiothreitol (DTT) and 2% SDS was used to dissolve ECP pellets dried from TCA precipitation. The loading buffer used with these samples was devoid of SDS. This modification yielded higher quality results with 47 distinct protein bands and very low background on SDS-PAGE analysis (Figure 3.2). Densitometry of relative levels of each protein band from the two lanes was performed using the image analysis tool ImageJ 1.43 (http://rsbweb.nih.gov/ij/) developed by Wayne Rasband, National Institutes of Health, Bethesda, MD. The values obtained as area under curve were compared and expressed as relative proportions. The experiment was repeated at least 5 times and was found to be consistent. The protein bands were then identified by MALDI-ToF-ToF at the Protein and Proteomics Centre, Department of Biological Sciences, National University of Singapore. 3.5.1. Elastolytic activity assay Cell-free supernatants were concentrated 200 times using Amicon Ultra centrifugal filters (Ultracel-10k, Millipore). Protein estimation by Bradford method (Bio-Rad) of the concentrated extra-cellular protein samples was carried out. The assay method used was a modification of the method described by (Morihara et al., 1965). For each sample, 5 µg protein was added into 2 ml centrifuge tubes containing 20 mg elastin-congo red (Sigma) suspended in 1ml of reaction buffer (25 mM Tris pH 7.8, 0.15 mM NaCl, 10 mM CaCl2) and incubated with rotation at 37oC for 6 hrs. The assay tubes were then centrifuged for removing the insoluble material (1,200 x g for 15 min), and absorbance of the supernatant was measured at 495 nm. The development of color on elastin cleavage from congo red was used as the measure of elastase activity. Elastin-congo red was used in reaction buffer without proteases as a control for determining background levels in quantification of cleavage of elastin. Pseudomonas aeruginosa elastase (Elastin Products Company, Inc., USA; Cat. No. PE961) was used as standard to calculate the units of active elastase 48 per µg of total secreted protein. The experiment was done in triplicate and repeated atleast five times. 3.6. Intracellular protein extraction Bacterial pellets from cultures used for extra-cellular protein extraction were washed once and resuspended in a maximum volume of 3 ml extraction buffer (50 mM Tris, 1 mM EDTA, 20 mM DTT) with cOmplete Mini Protease Inhibitor Cocktail (Roche). For protein extraction for 2-dimensional gel electrophoresis, the extraction buffer contained only Tris and EDTA with both Complete Mini protease inhibitor cocktail (Roche) and PhosSTOP phosphatase inhibitor cocktail (Roche). Homogenization was carried out in a cell disrupter Micro Smash MS-100 (Tomy Seiko Co., Ltd., Japan) with 0.1 mm glass beads in 2 ml screw cap tubes at a pulse of 4,000 rpm for 20seconds repeated 8-10 times until the pellet was completely disrupted. Disruption was verified visually by color change of the pellet. The tubes were then centrifuged at 14,000 rpm for 10 minutes in a table-top centrifuge to remove cell debris and beads. The clear supernatant was saved and protein concentration estimated using Bradford reagent (Bio-Rad Laboratories) method. 3.7. Membrane protein preparation Overnight P. aeruginosa culture in LB was pelleted down at 5000 x g at 4oC for 10 minutes. The cell pellet was washed once with 50 mM sodium phosphate buffer (pH 8) and resuspended in the same buffer (8 ml per 50 ml culture) containing cOmplete Mini Protease Inhibitor Cocktail (Roche). The homogenization parameters were optimized under the guidance of Dr. Gerard Michel (Systèmes membranaires et Pathogénicité de Pseudomonas aeruginosa, France) to obtain maximum yield of membrane proteins as 49 described previously (Robert et al., 2005). The homogenized suspension was centrifuged at 1,500 x g at 4oC for 10 minutes to remove cell debris. The supernatant was centrifuged again at 125,000 x g at 4oC for 30-45 minutes to separate the membrane protein fraction (pellet) and cytoplasmic and periplasmic fractions (supernatant). The pellet was dissolved in the extraction buffer with protease inhibitor and stored in - 80oC until further use. 3.8. Immunoblotting After SDS-PAGE, proteins from the 13% or 15% gels were transferred onto ECL nitrocellulose membrane (Pall Corporation) at 100V for 90 minutes in a buffer containing 20% methanol, Tris and glycine at 4oC. The membranes were then washed twice with water and stained with PonceauS (Sigma) to ensure even transfer throughout the membrane surface. After washing, blocking was done in 5% BSA with 0.05% Tween-20. All incubations were at room temperature for 1-2 hr or overnight at 4oC. Anti-exoS antibody was a gift from Dr. Shouguang Jin, University of Florida, USA (Wu & Jin 2005). The XcpP, XcpY and XcpZ rabbit antibodies were kind gifts from Dr. Gerard Michel (Robert et al., 2005; Robert et al., 2005). Mouse monoclonal antibody against alpha subunit of E. coli RNA polymerase was purchased from Neoclone Biotechnology, WI, USA. All secondary antibodies were anti-rabbit/mouse IgG conjugated with alkaline phosphatase (AP) (Sigma). The substrate for detection was chromogenic NBT/BCIP for ExoS blots and ImmobilonTM Western chemiluminescent AP substrate (Millipore) for the others. 50 The antibody dilutions and incubation times were optimized and best results obtained in the following conditions: Table 3.3. Immunoblot conditions for antibodies used in this study Primary antibody Secondary antibody Dilution Recomm Incubatio ended Optimal n time Blocking time Diluti on Incubatio n time ExoS RNA polymerase Overnight 1,000 2 hr 7,000 2,000 2 hr Overnight 10,000 45 min 20,000 15,000 45 min LasB Xcp P XcpY XcpZ Overnight 1hr 1hr 1hr 2,500 750 1,500 750 100 min Overnight Overnight Overnight 7,000 7,000 7,000 7,000 4,000 4,000 4,000 4,000 100 min 2 hr 2 hr 2 hr Protein 3.9. Bacterial infection studies 3.9.1. Cell culture conditions Lung fibroblast line MRC-5 (American Type Culture Collection CCL-171), grown in Eagle's Minimum Essential Medium containing 10% fetal bovine serum (Hyclone) and 1X penicillin/streptomycin at 37oC, was used for all infection assays with P. aeruginosa PAO1 strains. Subculturing was done after atleast 2x PBS washes, with 1X TrypsinEDTA (Gibco) at room temperature for 2 min or 37oC for 1 min. The freezing medium used for cryopreservation in liquid nitrogen consisted of 90% complete medium and 10% dimethyl sulfoxide (DMSO). For imaging purposes, cells were grown on 12 mm glass coverslips in 24-well plates (Iwaki/Nunc) with ~5 x 104 cells per well and for live imaging in special 8-well glass bottomed plates with ~25 x 103 cells per well. For infection experiments, either ~5 x 104 or 105 cells per well were grown in 24-well plates. 51 3.9.2. Infection assays Monolayers of lung fibroblasts (MRC-5) were grown in 24-well plates or 8-well glass bottom dishes (for live video microscopy) and infected with P. aeruginosa PAO1 strains from mid-log phase. The infection time and multiplicity of infection (MOI) were optimized to determine the optimal conditions for significant difference in invasion and microscopy. An overview of the infection assays is shown in Figure 3.3. Figure 3.3. Layout of bacterial infection assays. Association and invasion assays of lung fibroblasts (MRC-5); elongated cells infected with P. aeruginosa PAO1 strains (shown in green). The red lines connecting the host cells represent the extra-cellular matrix, which degrades upon infection leading to detachment and cell rounding. Antibiotic treatment is an additional step in invasion assay to kill host surface-associated bacteria. 52 The antibiotic concentration and incubation time were optimized to achieve efficient killing of host surface-attached P. aeruginosa PAO1 in the infection setup (Figure 3.4). Desirable killing was obtained at 2.5X concentration of Penicillin/ Streptomycin incubated for 2hrs. Hence this was used for invasion assay with the different P. aeruginosa PAO1 variants used for comparison in this study. Figure 3.4. Optimization of antibiotic concentration and incubation time for efficient clearance of external host-attached bacteria in invasion assay. Lung fibroblast cells (MRC-5) infected with P. aeruginosa PAO1 wildtype (250 MOI for 3 hrs) treated with varying concentrations of Penicillin/ Streptomycin. Bacteria attached to the exterior host surface removed by PBS wash and plated at different time points postantibiotic treatment aiming at absence of growth. Images are representative of three replicates. Bottom right panel represents the optimal conditions. 53 In association assay, surface- bound bacteria were not killed. This technique does not distinguish internalized from surface-bound bacteria, binding refers to bacteria associated with host cells. Cells were then lysed with 100 µl of 1% TritonX-100 and the contents homogenized by pipetting. This suspension was serially diluted and plated on LB agar plates. After ~24 hr incubation in 37oC, viable colony count was performed. Bacterial survival assay was performed to monitor the growth rate of bacteria associated with host in the infection setup i.e. survival efficiency of bacteria over a period. The cells were washed post-infection with nutrient media to remove bacteria that are not associated with host cells. For invasion assay, 100 µ l of 2.5X penicillin/streptomycin was added to kill the bacteria attached to the surface of the host cells after washing off unattached bacteria. After incubation at 37oC for 1 hr, the cells were washed twice with PBS to remove antibiotics. Efficiency of infection was calculated as the difference between the number of bacteria used for infection and the number survived divided by number of bacteria used for infection. Hence association and invasion assays help differentiate between attached+ internalized and only internalized bacteria respectively. 3.10. Extracellular matrix extraction Extract of extracellular matrix (ECM) was done in two steps- decellularization of cultured mammalian cells and extraction of deposited ECM into solution. For decellularization, two methods were tried and efficiency of extraction was verified by immunostaining using mouse anti-collagen I and anti-fibronectin (gifts from Dr. Evelyn Yim, NUS) at 1:100 dilution for 1hr. Secondary antibody used is anti-mouse labeled with AlexaFluor 488 (Invitrogen). All trials were performed in 6-well plates and volumes mentioned below are inclusive of all 6 wells. 54 i) Lung fibroblasts MRC-5 cells were washed twice with PBS after culturing under conditions described in Section 3.9.1. Sodium deoxycholate (0.5% w/v) was added and incubated on ice for 10 minutes to lyse the cell membranes. Washing was repeated for a total of three periods of 10 minutes. After removing the cellular debris with the solution, residual DNA was removed by incubating with DNase (Fermentas) for 1 hour at 37oC. ii) Lung fibroblasts MRC-5 cells were washed twice with PBS. Sodium deoxycholate in PBS (0.5% w/v) containing 0.5x cOmplete Mini Protease Inhibitor Cocktail (Roche) was added and incubated on ice for 10 minutes. Washing was repeated three times, followed by incubation with 0.5% sodium deoxycholate in PBS on ice for 10 minutes. Finally, the deposited ECM was washed thrice with PBS. For extraction into solution, the deposited ECM digested with 2.4ml pepsin at different conditions- pH 2.2 and 3.2 at room temperature for 2 hrs with shaking and neutralized with NaOH (0.2N) solution. Before loading on SDS-PAGE, ECM was concentrated to 25-50µl using Vivaspin 2 (Sartorius) concentrator. 3.11. Sample preparation for Helium-ion microscopy Coverslips with the lung fibroblasts MRC-5 cells grown and infected with P. aeruginosa strains (MOI 100) were washed with PBS and fixed with 2% gluteraldehyde in PBS for 45min at room temperature in a fresh 12-well plate. Then the samples were dehydrated in ascending ethanol gradient (25%, 40%, 50%, 70%, 90%, 95%, 100%) with 5 min incubation at each concentration and stored in absolute alcohol. The samples were taken 55 for critical point drying at the Electron Microscopy facility at Dept. of Biological Sciences or Faculty of Medicine, NUS immediately. This was done by flushing the samples 5-6 times with liquid CO2 to replace ethanol. Imaging was done at the Dept. of Electrical Engineering, NUS in Dr. Daniel Pickard’s laboratory. The major advantage of using the Helium-ion microscope (HIM) (Zeiss SMT) is that sample preparation does not require heavy metal coating as for conventional electron microscopy. This helps preservation of surface structures for analysis. 3.12. Phosphoproteome analysis Both gel-based and gel-free methods have been employed in order to map as many phosphorylation events as possible from the combined results. Details of each method have been provided in sub-sections below. The workflow of the methods used for phosphoproteome analysis is given in Figure 6.1. 3.12.1. 2-Dimensional Electrophoresis (2-DE) of P. putida protein samples The cell pellets from 100ml P. putida WT and morA KO cultures grown overnight with 1:100 inoculums were used for protein extraction as described above in Section 3.6. Optimization at each step was required to arrive at conditions that yielded clear spots and tidy background in the maxi-gel format SDS-PAGE. Parameters and conditions tried for optimization are provided in Table 3.4. Two-dimensional gel electrophoresis was performed with help from Proteins and Proteomics Centre, Department of Biological Sciences, NUS for isoelectric focusing (IEF) and Dr. Leung Ka Yin (ex-NUS) laboratory for maxi format PAGE and visualization. 56 Figure 3.5. Workflow of phosphoproteome analysis. Steps common to both methods are shown in green and those unique to the two methods in brown. Steps involved in gelbased method are given on the left (continued at the bottom) and those of gel-free mass spectrometry-based method are given on the right. 57 Table 3.4. Optimization of parameters for 2-dimentional gel electrophoresis of P. putida proteins. Most optimization was done in the mini gel format with 7cm IPG strips. At a time only one parameter was changed. Fine adjustments shown in bottom rows of right column were made to obtain best spot separation. Finalized optimal parameters are shown in grey cells. Parameter Extraction method Chemical Mechanical Mechanical Solubilization buffer ReadyPrep sequential extraction reagent 3 (Bio-Rad) 50 mM Tris, 1 mM EDTA, 20 mM DTT 50 mM Tris, 1 mM EDTA, 20 mM DTT cOmplete Mini Protease Inhibitor cocktail, EDTAfree (Roche) PhosSTOP Phosphatase Inhibitoe cocktail (Roche) PD-10 column (Amersham) cOmplete Mini Protease Inhibitor cocktail, EDTA-free (Roche) Mini gel format Protease Inhibitor No Phosphatase Inhibitor No Desalting Concentration method Solubilization buffer Quantification method Clean up Strip rehydration solution Extra ampholytes Amount loaded IPG strips IEF voltage Electrophoresis conditions Dialysis Vivaspin6 column (Sartorius) 50 mM Tris, 1 mM EDTA, 20 mM DTT Bradford assay (Bio-Rad) No Rehydration solution (BioRad) No Maxi gel format PhosSTOP Phosphatase Inhibitoe cocktail (Roche) PD-10 column (Amersham) Lyophilization Lyophilization Denaturing buffer (40 mM Tris, 60 mM DTT, 2% SDS) RC-DC protein assay (Bio-Rad) 2-D clean up kit (Amersham) DeStreak Rehydration solution (Amersham) Denaturing buffer (40 mM Tris, 60 mM DTT, 2% SDS) RC-DC protein assay (Bio-Rad) 2-D clean up kit (Amersham) 4% 2% 100 µg 80 µg Biorad pI 3-10 Amersham pI 3-10 37 kV 20 kV 90V/gel 1.5 hr 90V/gel 1.5 hr DeStreak Rehydration solution (Amersham) 2% 120 µg 150 µg Amersham Amersham pI 3-10 pI 5-8 30 kV 36 kV 20 mA/gel 25 mA/gel 4.5 hr 5.5 hr 58 The samples were desalted using the PD-10 columns (GE Healthcare) according to manufacturer’s instructions. After equilibration of the column with the elution buffer (Tris-EDTA with protease- and phosphatase inhibitors), the protein samples were added in a total volume of 2.5 ml each and flow-through discarded. Again, 3.5 ml of elution buffer was added to elute the protein and the flow-through was collect. The desalted protein was concentrated by lyophilization and dissolved in a denaturing buffer (40 mM Tris, 60 mM DTT, 2% SDS). Protein concentration was measured using a Lowry assay based RC DC (reducing agent- and detergent- compatible) protein assay (Bio-Rad Laboratories) according to manufacturer’s instructions. About 150 µg protein was cleaned up using 2-D clean up kit to remove salts, detergent and reducing agent as these may interfere with protein separation. The pellet was dissolved in 100 µl DeStreak rehydration solution (GE Healthcare) with 2% extra BioLyte 5/8 ampholyte (Bio-Rad Laboratories). This sample was then loaded on 17cm pI range 5-8 IPG strips (Amersham Biosciences) by soaking overnight overlaid with mineral oil. Care was taken to ensure no air bubbles under the strip to avoid uneven distribution of sample. IEF was carried out with a final voltage of 36kV and the strips were equilibrated in buffers containing freshly added DTT and iodoacetamide sequentially for 15 min each. This step is for reduction and alkylation of the proteins before second dimension sizedependent separation. Equilibrated strips were loaded on 15% acrylamide gels and overlaid with 1% agarose for separation (SDS-PAGE) on Bio-Rad PROTEAN II XL system. The gels were either directly stained with Silver nitrate to visualize total protein 59 spots using GS800 densitometer (Bio-Rad) or stained for phosphoproteins followed by silver stain. Figure 3.6 shows gels before and after optimization of 2-DE parameters. Figure 3.6. Optimization of 2-dimentional gel electrophoresis. Top panels show mini format gels with 7cm IPG strips before (left) and after (right) optimization of parameters as in Table 3.4. Bottom panels show maxi format gels before (left) and after (right) final alterations of conditions. All gels are stained with silver nitrate. L-protein ladder (BioRad). 60 3.12.2. Staining for phosphoproteins For staining of phosphoproteins, the large format gels after 2-Dimension electrophoresis were fixed (50% methanol, 10% acetic acid) overnight. After thorough washing in ultrapure water for 3 x 15 minutes, the gels were incubated in the Pro-Q® Diamond stain (Invitrogen) in dark with gentle agitation for two hours. The gels were then destained in dark (20% acetonitrile, 50 mM sodium acetate, pH 4.0) for three periods of 30 minutes. Gels were visualized using Typhoon 9200 scanner (Amersham Biosciences) under excitation at 532–560 nm and 600 nm emission filter. Few photomultiplier tube (PMT) settings were tried for best imaging of the fluorescent stain. Trial phosphostain of a onedimensional gel and scanner settings are shown in Figure 3.7. 500 PMT in Typhoon 9200 scanner had less background but did not show fine bands. Hence, for or maxi format 2-DE gels 520-540PMT was used for visualization. After documentation, the gels were stained with silver nitrate for visualization of total protein, visualized and selected spots were cut for identification by MALDI-ToF-ToF. 61 Figure 3.7. Optimization of visualization of phosphoproteins. Bands seen are fluorescent stained with Pro-Q Diamond phosphoproteins stain (Invitrogen) visualized by Typhoon 9200 scanner (Amersham Biosciences) under 540nm excitation and 600nm emission. PL- Peppermint phosphoprotein ladder (Invitrogen). 3.12.3. Sample preparation for phosphoproteome analysis by Nano-LC-MS-MS Briefly, two batches each of wild type (WT), morA knockout (KO) and morA overexpression (OE) strains of both P. aeruginosa PAO1 and P. putida PNLMK25 (described in Table 3.1) were grown in Luria–Bertani medium until late-log phase and cells were collected by centrifugation at 5000 x g at 4oC. The pellets were then dried under vacuum and frozen till further analysis in Dr. Yasushi Ishihama’s laboratory, Keio University, Japan. Triplicate analyses from the phosphopeptide enrichment step to the LC-MS run for duplicate batches of the sample preparation were performed for each method (12 LC-MS runs in total for each Pseudomonas strain) (Figure 3.8). For detailed methods and protocols, refer to Appendix II. 62 Figure 3.8. Workflow of sample preparation for phosphoproteome analysis. Bacterial proteins are processed and phosphopeptides are enriched using zirconia and titania Aliphatic hydroxy acid-modified metal oxide chromatography (HAMMOC) stage tips (Sugiyama et al., 2007; Sugiyama et al., 2008) in triplicates. The culture flasks represent biological duplicates; for each sample phosphopeptide-enrichment with the two metal oxides (Zr-HPA and Ti-LA) was done in triplicates resulting in twelve replicates per sample injected into the NanoLC-MS/MS. 63 3.12.4. Analysis of LC-MS-MS data For all database searching for data from P. putida PNL-MK25, P. fluorescens PfO-1 genome (http://genome.jgi-psf.org/psefl/psefl.home.html) was used as reference, since the genome of this strain is not yet sequenced. This database (http://cmr.jcvi.org/tigrscripts/CMR/GenomePage.cgi?database=ntpf02) is under the Comprehensive Microbial Resource (CMR) of The Institute for Genome Research (TIGR) (now J. Craig Venter Institute (JCVI)). Subcellular localization of phosphoproteins corresponding to the phosphopeptides identified from both species was assigned based on information from the bacterial subcellular localization database PSORTdb (Rey et al., 2005). Not all localizations are experimentally verified; some are predicted based on experimentally proven function of similar proteins from other organisms and some computationally predicted by pSORTb V2.0 (Gardy et al., 2005). Functions and sub-roles for P. putida PNL-MK25 were assigned based on pathway of P. fluorescens PfO-1 homologues from CMR primary annotation denoted as “TIGR cellular role category” (now “JCVI cellular role category”). This database did not accept gene numbers for search then; hence corresponding GI numbers were used for searching. For P. aeruginosa PAO1, functional annotation by Pseudomonas Community Annotation Project (PseduoCAP) from Pseudomonas Genome Database (Winsor et al., 2009) was used. After functions were assigned, the phosphopeptides were grouped under broad categories with related function or common theme. For comparison of the protein localization of all proteins in the two genomes with that of the phosphoproteins obtained, respective precomputed genomes from PSORTdb were used. 64 CHAPTER 4 CYCLIC DIGUANYLATE SIGNALING AFFECTS P. AERUGINOSA ATTACHMENT AND ENTRY INTO LUNG FIBROBLASTS In this Chapter, the effect of cyclic diguanylate (c-di-GMP) signaling on host attachment of P. aeruginosa has been studied. Results presented in this chapter are discussed in the following parts: i) effect of c-di-GMP signaling on host surface association of P. aeruginosa, ii) bacterial surface structures that affect bacterial attachment to host cells, and iii) mechanisms through which, MorA regulates surface attachment and subsequent internalization. 65 4.1. BACKGROUND Attachment of bacteria to surfaces is a crucial step in the initiation of colonization and subsequent biofilm formation. Surface attachment peaks during a short window of development suggesting that the precise timing of assembly and loss of surface organelles is critical for optimal colonization (Lestrate et al., 2003). Since P. aeruginosa is an opportunistic as well as nosocomial pathogen, attachment to both abiotic and biotic surfaces is critical for its survival on a range of materials it comes in contact with. Notably, adhesion to host cell surface is of prime importance in the infection process; this leads to entry into the cells. Both flagella and pili play significant roles in attachment of P. aeruginosa to host cells. Mutants defective in certain flagellar genes such as the flagellar cap fliD are non-motile and non-adhesive (Arora et al., 1998). A fliC mutant, which is nonmotile and does not synthesize flagellin, retains adhesion to mucin (Simpson et al., 1992). Pili on the surface of P. aeruginosa also contribute significantly to attachment to the epithelial cells (Woods et al., 1980) via mucin and other glycolipid moieties. Type IV pili in P. aeruginosa can be extended or retracted and also flexed by Brownian motion, exhibiting a persistence length of about 5 µm (Skerker & Berg 2001). Force spectra of pili tethered to mica surface gave rupture forces of 95 pico Newtons (Touhami et al., 2006). Hence, they are capable of establishing strong interactions with surfaces and retract when movement is required. C-di-GMP signaling is commonly known to affect attachment of bacteria to abiotic surfaces (Borlee et al., 2010; Karatan & Watnick 2009; Cotter & Stibitz 2007) as well as host surfaces (Ferreira et al., 2008) leading to biofilm formation. As accepted widely, pili is a primary adhesin mediating attachment of P. aeruginosa to surfaces. This second 66 messenger signaling is also renowned for regulation of virulence by controlling adhesion through Type IV pili and related phenomena (Bodenmiller et al., 2004; Kazmierczak et al., 2006; Haussler et al., 2003). Our group has shown earlier that a sensor regulator MorA involved in c-di-GMP signaling controls biofilm formation by both P. aeruginosa and P. putida strains on abiotic surfaces (Choy et al., 2004). Subsequently, we have also observed that it affects flagellar number and timing of its biogenesis in a posttranscriptional manner (Wong Chuiching, unpublished). Others have recently reported that a P. aeruginosa strain isolated from the late-stage cystic fibrosis lung small colony variant SCV 20265 morA mutant exhibis a non-autoaggregative phenotype and an increased twitching motility (Meissner et al., 2007) due to differential appendage (fimbriae) expression. Later in this thesis, changes in other surface-associated phenotypes including secretion of FliD have been reported (Chapter 5, Section 5.2.1). Based on these observations, we hypothesize that c-di-GMP signaling by MorA might affect P. aeruginosa attachment to host surfaces. To test this hypothesis, we investigated the effect of P. aeruginosa strain defective in MorA on the events at the host-pathogen interface. 4.2. RESULTS AND DISCUSSION 4.2.1. MorA affects bacterial attachment to host in P. aeruginosa In order to study the regulation of P. aeruginosa-host surface adhesion via MorA-c-diGMP signaling, efficiency of attachment was studied on lung fibroblast cells (MRC-5) infected with WT and morA KO strains. A fliC mutant strain was used as negative control since it has been established that this mutant retains very low level attachment compared to WT (Simpson et al., 1992). The results presented in Figure 4.1 clearly show that there 67 is a significant effect on the bacterial adhesion to host membranes. The mutant strain exhibits almost double the association efficiency as the wildtype. Note: Association efficiency was calculated based on the sum of bacterial cells that adhered to the host surface and those internalized at 2 hours post-infection. Figure 4.1. P. aeruginosa attachment to host cells is affected by MorA. Graph shows difference in association efficiency (attached+internalized) of P. aeruginosa strains on lung fibroblasts (MRC-5) 2 hours post-infection. Error bars represent mean +SE (n=3). Infected host cells have also been visualized under differential interference contrast (DIC) microscope to observe host cell morphology changes caused due to MorA deficiency (Figure 4.2). Over a post-infection period, it can be seen that lung fibroblasts infected with morA KO show changes in morphology much earlier than that of WT under same experimental conditions. These host cells lose hold to the surface, start rounding and eventually become non-adherent. Similar cell rounding phenotype has been noticed at another instant under confocal laser microscopy as well (Appendix IIIa). 68 Figure 4.2. Host morphological changes correspond to effect of MorA on bacterial attachment. Lung fibroblasts (MRC-5) infected with P. aeruginosa WT and mutant strains viewed under differential interference contrast microscope. All images captured 2 hours post-infection. MOI- Multiplicity of infection; 0 hr- No infection. Another observation from these images is the clearance of extracellular matrix on which the cells are initially embedded. This is more evident in morA KO infection since host morphological changes at happen a rapid rate than WT. These data strongly suggest that in the absence of functional MorA, more bacteria attach per host cell and probably get internalized at a faster rate than WT leading to surface detachment evidenced by cell rounding. In order to verify whether the observed effects are genuinely MorA-dependent or artifacts due to exponential multiplication of bacteria in the infection setup, high resolution imaging was performed using Helium ion microscopy (HIM). Due to the very high 69 source brightness, this technology can produce qualitative data not achievable with conventional microscopes which use photons or electrons as the emitting source. As the helium ion beam interacts with the sample, it does not suffer from a large excitation volume, and hence provides sharp images with very high resolutions of the order of 2.5nm. More importantly, due to relatively light mass of the helium ion, it doesn’t require the samples to be coated with heavy metal. Hence there is no discernible sample damage in contrast to traditional scanning electron microscope (SEM), which is very advantageous to retain bacterial surface structures. The images show that bacteria continue to actively divide in the host medium during infection (Figure 4.3A). Dividing cells are also found to attach to host cells. Survival assay was conducted to examine the influence of bacterial division on bacterial association assay data. Over 12 hours post-infection, bacterial growth follows the same pattern as planktonic bacterial cells grown in rich medium (Figure 4.3B). However, at 2 hours post-infection the cells still remain in the non-exponential phase. Hence, the number of bacterial cells infected on the host does not change significantly under the conditions used in Figure 4.1. 70 A B Figure 4.3. P. aeruginosa cells actively divide during infection. A. HIM images showing P. aeruginosa PAO1 cells dividing during infection on lung fibroblast line MRC-5. The white arrows in the top left panel point to multiple dividing bacteria unattached to the host cells. The inset in the top right panel is the magnified view of the area above, showing two daughter cells just after bacterial fission. The bottom panels show actively dividing bacteria associated with host cells through surface structures. B. Graph representing number of bacteria that survive in association (attached+internalized) with host cells during the course of infection. Error bars represent mean ±SE (n=3). 71 4.2.2. Which appendage plays a major role in attachment changes due to MorAflagellum or pili? As a preliminary study to confirm if high resolution imaging by HIM can capture bacterial appendages, lung fibroblasts infected with P. aeruginosa WT were imaged. As evidenced in Figure 4.4, most structures shown to attach to both abiotic (top left panel) and host surfaces are polar. Some lateral strcutres are also seen to attach to neighboring bacteri (panel C) and host (panel F). Figure 4.4. Polar and lateral appendages mediate P. aeruginosa attachment. HIM images showing bacterial attachment through polar pili to both abiotic surface (A) and host membrane structures (B,D,E). C shows lateral appendages binding to neighboring bacterial cells (circle). C and F show bacterial clustering on host surface. 72 Flagella are generally lost during harsh mechanical or chemical sample preparation method like that for electron microscopy. Pili are known to establish strong attachment (Touhami et al., 2006) to lipopolysaccharide moieties (Gupta et al., 1994; Sheth et al., 1994; Ramphal et al., 1991). Also, these structures bind predominantly to the flower-like structures on the host surface (Figure 4.4, Bottom panels). These structures are generally not captured in SEM images and hence could be natural for fibroblasts or could form on host membrane in response to bacterial infection. . However, one report has previously shown fibroblasts with these structures under non-infected condition (Appendix IIIb). Hence, we speculate the long polar structures seen are probably pili and the flower like membrane extensions on the host surface could be glycosphingolipids. Additionally, the top right panel also shows lateral structures adhering to neighboring bacterial cells while top and bottom right panels show clustering of bacteria on the host surface (Figure 4.4). This might lead to colonization and biofilm-like structures on the host surface. In order to ascertain the role of MorA on pili-mediated attachment, imaging of infection setup with morA KO is underway. As seen from DIC and confocal microscopy, upon infection with morA KO, the number of host cells that remain on the coverslip are too less. Since they detach faster than WT, they get washed off during sample processing. Especially in narrow fields of view used HIM, this strain poses difficulty in capturing host-bacteria interactions. We are optimizing conditions to capture P. aeruginosa morA KO attachment. 73 4.2.3. Investigation of entry mechanism As described earlier, there are many bacterial as well as host factors essential for internalization of P. aeruginosa into non-phagocytic cells. To study the events at the host-pathogen interface such as changes in pili morphology/ retraction and host membrane morphology changes, high resolution imaging by HIM was used. At this stage, the issue with imaging of host infection by P. aeruginosa morA KO strain persists as described above. Hence, preliminary results from lung fibroblasts infected only with P. aeruginosa WT are shown in Figure 4.5. Figure 4.5. Entry mechanisms of P. aeruginosa WT. Panels A-C show bacterial entry along shrinking host membrane edges. Panel A shows formation of filopodia (long host membrane extensions attached to surface) upon infection. Host membrane extensions envelop (D) and enfold (E) bacteria (indicated by arrows) aiding entry. 74 Two modes of entry were observed at host-bacteria interface: a) Bacterial entry along the shrinking edges of host membrane b) Host membrane extensions envelop bacteria and may lead to internalization As the host cell detaches from the surface, membrane morphological changes such as filopodial structures are formed as seen in Figure 4.5A. Bacteria entering along the membrane edges might have been preceded by pili retraction bringing the bacterial cell closer to the host. However, we can see from Figure 4.5A that along these edges, the flower-like host membrane structures are absent. Hence this is not clear. The appearance of host membrane extensions to envelop the bacteria probably indicates membrane ruffling on host membrane leading to lipid raft formation as infection response (refer Section 2.6.1). The images show wrapping and engulfment (probably leading to entry) through both polar and lateral surfaces of bacteria; these events always occur in regions rich in the probable lipopolysaccharide moieties (flower-like structures). Further studies are required to ascertain the exact series of events and effect of MorA on these. 4.3. CONCLUSIONS AND FUTURE DIRECTIONS This chapter presents results that lead to the following conclusions: MorA affects surface attachment of P. aeruginosa PAO1 on lung fibroblast surface. Active multiplication of bacteria during infection doesn’t influence the effect of MorA signaling to a great extent. 75 Time series imaging of lung fibroblasts infected with both P. aeruginosa WT and morA KO are underway. Samples are fixed at different time points post-infection for imaging. Information such as average number of bacteria in close proximity to a single host cell, number invaded (if possible) and number of bacteria attached through pili per cell will be obtained from these images. This will enable us to understand the rate at which internalization occurs post-attachment through pili. We also expect to capture mechanisms of entry like those observed in the preliminary results with WT infection. Previously, Live-imaging of infection process was attempted under Olympus Fluoview 1000 with fluorescent bacteria infecting the host. With the host membrane stained (Cell MaskTM Plasma Membrane stain, Invitrogen), 3D reconstruction was to be done to measure the average number of internalized and attached bacteria per host cell. But this method has practical inconveniences -the early stages of infection (30-45 min) could not be captured due to focusing issues. This will be followed upon upgradation of equipment. Regulation of flagella and pili are complex and involve a number of signal transduction and chemosensory pathways. In P. aeruginosa, pili expression is controlled by PilS/R two component system (Hobbs et al., 1993) and FimS/AlgR system (Whitchurch et al., 1996). AlgR, a regulator of alginate production provides a link between expression of extracellular polysaccharides and T4P. The global regulator Vfr (Beatson et al., 2002; Whitchurch et al., 2004) and a chemosensory signal transduction system chp control pilus expression by acting directly on pilA gene as well as by modulating extension and retraction of T4P. Vfr is a cyclic-AMP (cAMP) regulatory protein established in P. aeruginosa and MorA- c-di-GMP signaling may be another level of regulation at the post-transcriptional level. Perhaps, a compensatory mechanism between the two 76 nucleotide second messenger pools acts at a post-transcriptional level. Such mechanisms have also been described for flagella (Jarrell 2009). A relevant work has shown that c-diGMP modulates flagellar motor output and thus swimming velocity in response to environmental cues (Boehm et al., 2010). This suggests that flagella rotation and reversal rates can be regulated by this second messenger. However, further experiments specific to each appendage are needed to establish the mechanism. Pili retraction assay and atomic force microscopy (both pili- and flagella- specific) may throw light in this regard. 77 CHAPTER 5 SECRETION OF EXTRACELLULAR PROTEASES IS AFFECTED BY CYCLIC DIGUANYLATE SENSOR REGULATOR MorA IN P. AERUGINOSA This is the first study reporting the effect of cyclic diguanylate signaling on protein secretion via the type II secretion system (T2SS). The results of this chapter are discussed in three parts. The first part describes alteration in the levels of bacterial secretion due to perturbation in the function of MorA sensor regulator, the second part provides evidence for the biological significance of altered secretion and the final part presents results from investigation of plausible mechanisms governing this phenotype. 78 5.1. BACKGROUND Previous studies in our laboratory showed that secretion- and transport-related proteins were regulated by the global regulator MorA via altered c-di-GMP levels. Gene expression analysis on the wildtype (WT) and morA KO of P. aeruginosa (Choy WK, PhD thesis) was performed and several genes showed significant difference between these strains. For further analysis, genes were selected based on the following criteria: (i) more than 2-fold changes; (ii) assignment of “P” call value from analysis using the Affymetrix data mining software and (iii) statistical differences using the Student’s t-tests (P≤ 0.05). Conserved motifs of promoters of these selected genes were extracted and promoter relationship networks based on similarities in their promoter or regulatory regions were developed (Choy et al., 2008) (Appendix IV). Nodal genes connected to other genes indicate that its up- or down-regulation can affect the other genes connected to it. These networks provided strong evidence that many genes involved in transport of small molecules, protein export/ secretion, membrane proteins and those involved in cell wall modifications were transcriptionally affected by MorA mutation. An interesting relationship of pcrR, transcriptional regulator of Type III secretion (Barve and Straley, 1990; Yahr et al., 1997) sharing promoter structure with 11 other genes including morA was observed. Furthermore, RNA levels of pcrR gene were down-regulated in the absence of morA based on microarray data and pscP, another TTSS gene was significantly upregulated. Many other reports have also shown that proteins involved in c-di-GMP turnover or binding, control phenotypes such as motility, biofilm formation and secretion (Kulasakara et al., 2006; Cotter & Stibitz 2007; Tamayo et al., 2007). 79 Subsequently, on investigating effects on secreted protein levels of T3SS effector (ExoS) in morA KO compared to WT (Figure 5.1), no difference was seen in immunblot analysis. There may be a compensatory mechanism operating at post-transcriptional level preventing T3SS transcriptional level changes to be reflected at protein or secretion level. Figure 5.1. Type III effector secretion levels are not affected by MorA. Left panel shows total extracellular proteins blotted on nitrocellulose membrane and stained with PonceauS. Right panel shows immunoblot with polyclonal anti-exoS antibody. Black arrow indicates desirable band size of secreted ExoS. * band of undesirable size. Bands marked by arrows were found not to be exoS on identification by MALDI-ToF-ToF. However, overall amount of secreted proteins from equal number of cells were found to be affected in morA perturbed cells (left panel of Figure 5.1). This provided evidence that other secretion systems may be affected. Hence, further investigation was carried out to identify the protein bands showing differential secretion levels under non-T3SS-induced conditions. 80 5.2. RESULTS AND DISCUSSION 5.2.1. C-di-GMP signaling affects T2SS secretome in P. aeruginosa Profiles of extracellular proteins from P. aeruginosa PAO1 WT and morA KO were analyzed to investigate effect of c-di-GMP signaling by MorA on secretion other than TTSS. Preliminary results suggested that MorA perturbation causes an alteration in overall protein secretion. A careful choice of control is essential for validation of this significant difference. Hence extracellular proteins (ECP) were loaded for SDS-PAGE based on equal number of cells in order to facilitate easy comparison of individual secreted proteins between the strains. This was achieved by loading ECP amounts corresponding to volume of respective intracellular fraction resulting in equal band intensity for RNA polymerase on immunoblot (Figure 5.2A). Immunoblotting was performed with monoclonal antibody against RNA polymerase α-subunit (loading control) as described in Section 3.8. Densitometry of bands from the secreted protein profiles showed at least 50% increase due to MorA mutation in most secreted proteins seen under normal conditions (Figure 5.2B). As there was significant increase in the secretome due to MorA, the protein bands were identified using MALDI-ToF-ToF (Table 5.1). Spectra obtained can be found in Appendix V. Figure 5.3C shows comparison with MorA- complemented strain (morA KO+ pUPMR). The results clearly show that the altered secreted levels are only due to the effect of MorA and not artifact. Note: By secretome, we mean extracellular proteins that have been previously reported to be secreted by P. aeruginosa into the culture supernatant. 81 C Figure 5.2. Levels of secreted proteases are affected by MorA in P. aeruginosa. A. Top panel, total extracellular protein (ECP) from P. aeruginosa PAO1 WT and morA KO culture supernatants loaded based on protein secreted from equal cells (SDS-PAGE). Proteins identified by MALDI-ToF-ToF. Bottom panel, immunoblot of RNA polymerase (loading control) from intracellular fractions of respective cultures. L-Ladder (Bio-Rad). B. Relative levels of selected extracellular proteins in morA KO with respect to WT bands. Quantification (area under intensity curve) was done using ImageJ 1.43. Peptide sequences corresponding to protein bands are provided in Table 5.1. C. Total ECP from P. aeruginosa PAO1 WT, morA KO and complementation strain (morA KO+pUPMR) culture supernatants loaded based on protein secreted from equal cells (SDS-PAGE). XcpQ mutant lacks functional secretion machinery- Negative control. 82 Table 5.1. MALDI-ToF-ToF identification of P. aeruginosa secreted proteins affected by MorA. Peptide mass tolerance and fragment mass tolerance were 100ppm and 0.2 Da respectively. At the maximum, 1 missed cleavage for trypsin was allowed. Band No. 1 No. of queries matches 35 Nominal Mass 100615 Peptide sequences 1. MSLSTTAFPSLQGENMSRSPIPR 2. GLAYGTNVLTQLSGTNAAHAP LLKR 3. LLVLGNGASAASLSATVR 4. SVELGGAYGQDPALVQQIVDG SWR 5. AQNLFALPGTTSLR 6. LWLLWADAVR 7. AADTARFQETFVADAIVGYVR 8. FQETFVADAIVGYVR 9. QQSMPVSGSEETLTLTLPSAQG FTAIGR 10. LSIRIEDAGQASLAVGLNTQR 11. IEDAGQASLAVGLNTQR 12. LQANQSVALVSPYGGLLQLVY SGATPGQTVTVK 13. VTGAASQPFLDIQPGEDSSQAI ADFIQALDADK 14. ADWLEIR 15. GWGESHELGHNLQVNR 16. SGEISNQIFPLHK 17. EFGQNLDDTR 18. NAYNLIVAGR 19. AEADPLAGVYK 20. LWEDPGTYALNGER 21. MAFYTQWVHYWADLK 22. NDPLQGWDIWTLLYLHQR 23. DQRPTFALWGIR Accession number Genbank Identifier Protein name/function Sequence coverage PA0572 GI:15595769 Hypothetical protein 43% 83 2 23 57824 3 13 50402 24. TSAAAQAQVAAYGFAEQPAFF YANNR 1. SPLLVSTPLGLPR 2. LEDIASLNDGNR 3. AAATPGYQASVDYVK 4. VSVQPFPFTAYYPK 5. GPGSLSATVPQPVTYEWEKDF TYLSQTEAGDVTAK 6. DFTYLSQTEAGDVTAK 7. AENAAAAGAAGVIIFNQGNTD DRK 8. KTETYNVVAETR 9. FAWWGAEEAGLVGSTHYVQN LAPEEK 10. LFEAYFR 11. GQQSEGTEIDFR 12. SDYAEFFNSGIAFGGLFTGAEG LK 13. YGGTAGKAYDECYHSK 1. SDAYTQVDNFLHAYAR 2. GGDELVNGHPSYTVDQAAEQI LR 3. APGDSVLTLSYSFLTKPNDFFN TPWK 4. AYSVMSYWEEQNTGQDFK 5. GAYSSAPLLDDIAAIQK 6. TGDTVYGFNSNTER 7. LVFSVWDAGGNDTLDFSGFSQ NQK 8. IDLSGLDAFVNGGLVLQYVDA FAGK PA2939 GI:15598135 Proabable aminopeptidase 39% PA1249 GI:15596446 AprA| Alkaline metalloproteinase precursor 34% 84 4 16 42398 5 20 33354 6 9 48589 1. AAVAAGGTQALYDWNGVNQ GNANGNHQAVVPDGQLCGAG K 2. SDWPSTAIAPDASGNFQFVYK 3. YFDFYITK 4. HVIYNVWQR 5. AQQDLPAGATVTLR 6. LFDAQGR 7. QWPLALAQK 8. VNQDSTLVNIGVLDAYGAVSP VASSQDNQVYVR 9. FQVDIELPVEGGGEQPGGDGK 10. VDFDYPQGLQQYDAGTVVR 11. GWDLYYAPGK 1. IGKYTYGSDYGPLIVNDR 2. YTYGSDYGPLIVNDR 3. FACPTNTYK 4. QVNGAYSPLNDAHFFGGVVFK 5. LYRDWFGTSPLTHK 6. DWFGTSPLTHK 7. GQSGGMNEAFSDMAGEAAEF YMR 8. GKNDFLIGYDIK 9. YMDQPSRDGR 10. YMDQPSR 11. SIDNASQYYNGIDVHHSSGVY NR 12. AFYLLANSPGWDTRK 13. AFYLLANSPGWDTR 14. AFEVFVDANR 15. YYWTATSNYNSGACGVIR 16. NYSAADVTR 1. MVFTSSADGGSYICTGTLLNNG PA0852 GI:116048775 CbpD|Chitin binding protein 49% PA3724 GI:15598919 LasB| Elastase 51% PA4175 GI:15599370 PrpL| PvdS 31% 85 7 19 49420 8 7 45721 NSPK 2. TPPAGVFYQGWSATPIANGSLG HDIHHPR 3. YSQGNVSAVGVTYDGHTALTR 4. VDWPSAVVEGGSSGSGLLTVA GDGSYQLR 5. NDYFSDFSGVYSQISR 1. ASATQSAVAGTYQIQVNSLATS SK 2. IALQAIADPANAK 3. FNSGTLNISVGDTK 4. LPAITVDSSNNTLAGMR 5. DAINQAGKEAGVSATIITDNSG SR 6. VEVSDDGSGGNTSLSQLAFDP ATAPK 7. AANGEITVDGLKR 8. SIASNSVSDVIDGVSFDVK 9. AVTEAGKPITLTVSR 10. LTTQFNLLSAMQDEMTK 1. AVGEDGLNAASAALLGLLREG AK 2. QGYSWQPNGAHSNTGSGYPYS SFDASYDWPR 3. WGSATYSVVAAHAGTVR 4. VTHPSGWATNYYHMDQIQVS NGQQVSADTK 5. YYFYNQSAGTTHCAFRPLYNP GLAL regulated endoprotease; lysyl class PA1094 GI:15596291 FliD| Flagellar capping protein 38% PA1871 GI:15597068 LasA| Elastase 30% 86 Five out of eight identified proteins are proteases. All these proteases and the chitin binding protein are known to be secreted by the Type II secretion system (Folders et al., 2000; Filloux et al., 1998; Braun et al., 1998; Wilderman et al., 2001). These proteases are involved in tissue penetration and cellular invasion by the pathogen by cleaving the extracellular matrix (ECM) proteins of host cells (Cowell et al., 2003; Engel et al., 1998). An important observation is that the major protease secreted via T2SS, LasB, also shows differential secretion. Levels of LasB are about 70% higher in morA KO than WT as shown by the densitometry analysis. Such increase in LasB might have highly significant biological effects since it is very critical for processing of several other secreted proteases to become functional (Grande et al., 2007). Details about each of these proteases can be found in the Section 2.7.1. 5.2.2. Biological effects of increased extracellular protease levels To biochemically validate the functional significance of increased levels of secreted proteases in morA KO strain, biological effects of key proteases were investigated. Initially, a qualitative method on milk agar plates was employed and zone of clearance (degradation of milk proteins) was taken as a measure of proteolytic activity. There was no significant difference in the zone of clearance of milk between P. aeruginosa WT and morA KO. Also, the inherent problem in using this method as a quantitative assay for protease activity was that there was no control on the number of cells inoculated. Hence, a quantifiable biochemical assay was sought as described in Section 3.5.1. 87 Figure 5.3. Elastase activity in extracellular fraction of P. aeruginosa PAO1 WT and morA KO strains. A. Standard curve for elastase activity. Activity measured with increasing units of Pseudomonas aeruginosa elastase on elastin congo-red. B. Elastolytic activity assay of secreted elastase from P. aeruginosa PAO1 wildtype and morA KO. Error bars represent mean +SE (n=4). *Student’s T-test P-value < 0.05. 88 Since elastase is the key activator protease, its elastolytic activity was chosen to be the representative of the cumulative effect of total protease activity. Standard curve of P. aeruginosa elastase activity is presented in Figure 5.3A. The results show that there is approximately 33% increase in the activity of elastase in KO vs WT (Figure 5.3B), which is in consensus with the secretion levels and it is statistically significant. This might mean that the other proteases are activated by LasB to a substantially greater extent as well. Hence, these results indicate that functioning of c-di-GMP sensor regulator MorA has a significant effect on protease levels and subsequent proteolytic activity. Since protease activity plays a critical role in tissue penetration and colonization of bacteria in the host, it is quite possible that MorA may affect the invasion efficiency of strain PAO1. 5.2.3. MorA affects invasion efficiency of P.aeruginosa To understand the effects of increased levels of secreted proteases in MorA mutant strain of P. aeruginosa on its virulence, bacterial infection assays were performed. Lung fibroblast cell line (MRC-5) was chosen as the model for these studies. The method and optimizations of assay conditions are provided in Section 3.9.2. Figure 5.4 shows the invasion efficiency of P. aeruginosa WT and morA KO strains under different infection conditions. Efficiency of invasion was calculated based on viable colony count obtained (internalized bacteria) after removing the externally associated bacteria on the host surface. A fliC mutant lacking the flagellar filament was used as negative control for invasion; loss of flagella results in poor attachment and hence almost no invasion capacity. 89 Figure 5.4. Invasion efficiency corresponds to altered elastolytic activity. A. Graph shows difference in invasion efficiency (only internalized) of P. aeruginosa strains on lung fibroblasts MRC-5 (105 cells per well) 2 hours post-infection. B. Effect of MorA on invasion efficiency is consistent over a range of infection time and multiplicities of infection with ~5 x 104 host cells per well. Error bars represent mean +SE (n=3). Since invasion is a key virulence characteristic of this pathogen, regulation by a single gene should be unfailing under different experimental conditions to be convincing. 90 Therefore, invasion efficiencies over a range of infection times at two different multiplicities of infection were calculated to verify the consistency of the effect of MorA signaling on the invasion phenotype (Figure 5.4B). The trend remained the same and there was at least a 100% increase in efficiency due to MorA loss in most conditions tested. However, invasion efficiency between the two sets (Figure 5.4A and B) varied most likely due to difference in the host and bacterial cell numbers used. As these cell numbers are based on OD values, there is inherent variability in the absolute cell counts. 5.2.4. Mechanism of c-di-GMP regulation of P. aeruginosa protease secretion After the confirmation of the regulation of protease aided bacterial invasion by c-di-GMP signaling, its mechanism was investigated. The second messenger c-di-GMP signaling system is well-known for its varied modes of control over different phenotypestranscriptional, post-transcriptional and translational. The different possible ways by which MorA might regulate the T2SS secreton function are by: a) increasing the RNA levels of protease genes; b) increasing the levels of the T2SS machinery proteins so that the number of T2SS assemblies per bacterial cell is high or c) increasing the secretion efficiency of the machinery by post-translational modification. Each possibility was tested in order to establish the mechanism. i) RNA levels of protease genes Transcriptional analysis of three key proteases (LasB, CbpD and PrpL), which were found to be differentially secreted between P. aeruginosa PAO1 WT and morA KO, was performed. The levels of RNA transcripts were assessed at three growth phases since 91 elastase secretion is usually not uniform throughout the growth curve in planktonic bacteria grown in cultures. Detectable elastase levels are generally attained in culture Figure 5.5. RNA levels of major secreted proteases show no change due to MorA. A. Semi-quantitative reverse transcriptase PCR of lasB, cbpD and prpL at early-, mid- and late-log phases. B. Bar graph shows RNA transcript fold changes of major proteases in morA KO with respect to WT by quantitative real-time PCR. The error bars represent mean +SE (n=3). Levels of rpsL, encoding 30S ribosomal protein were used as loading and endogenous controls in A and B respectively. 92 supernatants only after about 12h (late-log to stationary transition phase) for 1:100 inoculum in LB medium. It is important to examine the protease RNA levels at earlier growth phases as the proteins may be accumulated in the cytoplasm before effective secretion takes place. Hence, early-, mid- and late-log phases were chosen. Both semiquantitative reverse transcriptase-PCR (RT-PCR) and quantitative real time (qRT-PCR) methods (as described in Section 3.2) were employed to ensure the integrity of data. Results (Figure 5.5) show clearly that there is no significant increase in the RNA transcript levels of the major protease genes due to MorA loss. Two other proteases showed < 2-fold change of RNA levels. ii) Protein levels of protease genes To verify if the effect of MorA on proteases is translational or at the level of the machinery function, the cytoplasmic and secreted levels of the above-mentioned proteases should be compared. Visual comparison of intracellular protein profiles of P. aeruginosa PAO1 WT and morA KO did not show significant difference in any of the bands (data not shown). Hence, a quantitative method was used to make a conclusive evaluation. LasB gene tagged with a 10 amino acid long FLAG peptide was introduced in trans in pGB1, a Pseudomonas vector. The strategy was to follow the protease using antibody for FLAG (Sigma). Details of constructs and primers used are available in Section 3.3 and Table 3.2 respectively. Promoter region was not included since RNA levels of lasB did not show any significant changes over the growth phases (Figure 5.5B). In order to test if the elastolytic activity of LasB is retained and follows the trend as observed previously (Figure 5.3), activity assay was performed for LasB-FLAG expressed in both P. aeruginosa PAO1 WT and morA KO strains (Figure 5.6) as 93 described previously. The outcome was contradictory to the usual trend observed earliera) activity of KO lesser than WT, b) some values obtained were not consistent between repeat experiments, and c) values of vector controls do not correspond to those of parent strains. This clearly shows that this method is not suitable to test out our hypothesis. The possible reasons are that the FLAG tag interferes with the secretion/activity of elastase or LasB expression in trans is not the same as that from its native promoter i.e. there might be role of cis elements/ other regulating signals when expressed from the chromosome. Figure 5.6. Elastolytic activity assay for LasB-FLAG construct. The bars show mean elastase activity based on standard curve developed in Figure 5.3A. The error bars represent mean +SE (n=3). Descriptions of strains are provided in Table 3.1. Meanwhile, an alternate immunoblotting method with LasB antibody was sought for cross verification. Secreted levels of extracellular proteases were compared with cytoplasmic LasB levels at different time points. At 6 hr after inoculation, no visible extracellular protein pellet was obtained for any of the strains studied (data not shown). 94 Hence time points were chosen after the cells start actively secreting (> 7hr). Figure 5.7 clearly reveals accumulation of LasB in the cytoplasm of xcpQ mutant since it can not be transported across the outer membrane. With the inner membrane-periplasm transport (sec ant tat systems) still active in xcpQ mutant, cytoplasmic accumulation suggests that there could be accumulation in the periplasmic space as well. However, no significant change in the intracellular levels of LasB is seen over time due to MorA loss. This suggests that the effect of MorA signaling is not at the translational level of proteases. Figure 5.7. MorA does not affect intracellular levels of LasB. Top panel, secreted LasB levels from culture supernatants at different time points (SDS-PAGE). Bottom panel, intacellular levels of LasB from same cultures detected with anti-LasB antibody raised in rabbit. Samples were loaded based on proteins from equal number of cells. XcpQ mutant lacks functional T2SS and does not secrete any proteases. iii) Levels of T2SS secreton assembly proteins If MorA mutation causes increased secretion by affecting levels of T2SS structural proteins, the number of T2SS assemblies per bacterial cell should be higher than WT. Hence, the protein levels of some of the key T2SS structural proteins were analyzed from the membrane fraction. Immunoblotting was performed as explained in Section 3.8. The targets were chosen based on protein localization. XcpY and XcpZ are located on the cytoplasmic membrane while XcpP spans across both the inner and outer membrane layers. The only outer membrane protein XcpQ was avoided since it is a 12-mer and hence band intensities may be very high causing difficulty in comparison between strains. 95 Figure 5.8. Levels of T2SS machinery proteins are unaltered by MorA. Immunoblots of the component proteins of T2SS machinery from membrane protein fraction. RNA pol- RNA polymerase from the cytoplasmic protein fraction used a loading control; proteins loaded from equal number of bacterial cells. None of the proteins tested showed significant change in their levels on membranes of P. aeruginosa PAO1 WT and morA KO strains (Figure 5.8). The uneven nature of the protein bands from membrane preparation may be due to residual lipids or DNA present in the samples. Densitometry analysis with ImageJ (http://rsbweb.nih.gov/ij/) also gave almost equal values for the bands from the two strains (data not shown). 5.2.5. Does MorA affect invasion by degrading the extracellular matrix? Above results clearly show that the c-di-GMP signaling via MorA does affect protease secretion and bacterial invasion in P. aeruginosa PAO1. Also, on visualization of infected host cells, quicker clearance of extracellular matrix in morA KO than WT (Chapter 4, Figure 4.2) has been observed. This led us to doubt whether the effect on 96 invasion is because of MorA’s effect on secretion via T2SS or it acts through an independent mechanism. To examine this, the activity of secreted bacterial proteases on the host extracellular matrix (imitating the in vitro condition) needs to be tested. For this purpose, culture dishes were decellularized leaving only matrix proteins, and then infected with bacteria. There is no established protocol available with us for this experiment. Optimization of decellularization protocols and extraction of ECM into solution (to be loaded on SDS-PAGE for immunoblots) was carried out as described in Section 3.10. These extractions were carried out on 6-well plates. To assess the efficiency of the two decellularization methods tested, immunostaining for ECM matrix proteins collagen I and fibronectin was performed (Figure 5.9A). The culture plates were directly visualized under fluorescent microscope. Since the DNase protocol resulted in better decellularization, it was used for subsequent experiments. To optimize extraction of the deposited ECM into solution, pepsin activity was tested at pH2.2 and pH3.2 (Figure 5.9B) and proteins loaded on gel for visualization. In the gel image, proteins loaded on every 2 lanes represent concentrated digests from 3 wells from a 6-well plate. Results show that the amount of protein is not sufficient to be used for comparison on gel. Also there is a possibility that the ECM proteins may not be intact after pepsin digestion. As seen in Figure 5.9B, no bands could be seen at lower molecular weight range. Hence this poses a hurdle for comparison by immunoblotting. This experiment has to be scaled up to few big culture dishes and pooled for each sample and the digests highly concentrated to obtain bright bands on gel for visual comparison. Alternately, a more sophisticated method could be sought to answer the question in hand. 97 Figure 5.9. Optimization of extracellular matrix analysis. A. Immunostaining of deposited ECM proteins for verification of efficiency of decellularization protocols. Fluoresence at 488nm is visualized. B. Pepsin-digested ECM proteins from 3 of 6-well plates loaded in 2 lanes at each pH condition. Left most lane is the protein marker. 98 5.3. CONCLUSIONS AND FUTURE DIRECTION From the results obtained in this chapter, it can be concluded that MorA-c-di-GMP signaling affects levels of secreted proteases (known to be secreted via T2SS) in P. aeruginosa PAO1. Significance of this finding is that the c-di-GMP signaling affects a major virulence mechanism in this strain that confers the unique invasive characteristic to it. The protease secretion phenotype is functionally relevant as shown by the effect on subsequent invasion of host. The mechanism through which MorA exerts its effect in not clear but it is highly likely post-translational since RNA analysis experiments and intracellular protease levels show no significant changes. According to what is known till date, the mechanism of regulation of extracellular proteases in P. aeruginosa is shown in Figure 5.10. 99 Figure 5.10. Mechanism of regulation of proteases secreted via T2SS. The transcriptional regulation of proteases is under the control of quorum sensing system as shown by the LasIR and acyl homoserine lactone (AHL; amber circles) traffic across the bacterial wall. Both MorA (shown in P. putida, Fu Swee Jiun, unpublished) and P. aeruginosa T2SS being polar-localized, c-di-GMP (red dots) signaling via MorA is most likely to affect secreton function at a post-transcriptional level (curved up arrow). 100 Furthermore, this data leads to the following hypotheses: Given that the T2SS secreton is polar localized (Senf et al., 2008) in P. aeruginosa like that of MorA in P. putida (Jiun Fu, unpublished), it is very likely that the effect of c-di-GMP turnover by MorA is local and the signal is transmitted directly to the secreton rather than at the transcriptional or translational level. Some of the proteases secreted by T2SS act on proteins secreted by other secreted systems. For example, ExoS, secreted by T3SS is degraded by LasB (Cowell et al., 2003). This can possibly explain why we did not observe altered extracellular ExoS levels while its transcript levels were affected (Figure 2.8). Hence there is a likelyhood that levels of other secreted proteins may be affected by MorA. But these may have gone undetected due to increased proteolytic activity in morA KO. An alternate explanation could be that PAO1 being an invasive strain, inherently has very weak T3SS activity. This is evidenced by very low levels of ExoS secretion upon induction (Figure 5.1). The effect of MorA on secretion of proteases is most likely at the level of secretion efficiency i.e alteration in the rate of transport across the bacterial bimembrane. It is possible that changes in c-di-GMP levels may i) alter the activity of inner membrane transport machineries, sec and/or tat systems; ii) increase the efficiency of ATPase-mediated pseudopilin activity (pushing out the periplasmic proteins through outer membrane ring) of T2SS machinery. 101 MorA signaling might have an effect not only on protein secretion via T2SS but may also crosstalk with other related virulence mechanisms since proteases showing differential secretion are also controlled by other regulatory systems. Eg.: Transcriptional control of proteases by quorum sensing system; PrpL is regulated by PvdS, a pyoverdine synthesis gene. It is possible that altered c-di-GMP levels have an impact on the secretion efficiency through a c-di-GMP binding protein interacting with the T2SS structural proteins on the cytoplasmic side or by direct binding of c-di-GMP to one of the T2SS machinery proteins. Next step in delving into the mechanism will be to identify the intermediate players between MorA and T2SS machinery. Since only few of c-di-GMP receptors are known and are very eclectic in nature, it is very difficult to pin point to a particular protein for follow up. Cytoplasmic membrane-localized T2SS structural proteins may be the initial choice to test c-di-GMP binding efficiency and/or any post-translational modification. Alternatively, proteome-wide analysis of known c-di-GMP binding motifs may be performed in P. aeruginosa to identify targets. Studying the levels of LasB in the periplasmic protein fraction will throw light on the effect of MorA-c-di-GMP signaling on protein transport across the bacterial inner membrane. Further investigation on these lines will throw light on the underlying mechanism(s) of action of MorA signaling. 102 CHAPTER 6 Ser/Thr/Tyr PHOSPHOPROTEOMES OF P. PUTIDA AND P. AERUGINOSA AND THEIR CROSSTALK WITH CYCLIC DIGUANYLATE SIGNALING Parts of results presented in this chapter have been published in Ravichandran, A., Sugiyama, N., Tomita, M., Ishihama, Y., Swarup, S. Ser/Thr/Tyr Phosphoproteome Analysis of Pathogenic and Non-Pathogenic Pseudomonas Species. Proteomics 2009, 9, 1-12. This Chapter reveals the occurrence of proteome wide Ser/Thr/Tyr phosphorylation which may have a global effect on survival and/or virulence mechanisms in the Pseudomonas species studied. In addition it describes the crosstalk of two signaling systems in Pseudomonas namely c-di-GMP and protein phosphorylation. Results section has two parts: i) phosphoproteome analysis, inter-species comparison of phosphorylated proteins and the effect of c-di-GMP on phosphorylation of selected proteins ii) verification of role of phosphorylation in the function of key bacterial appendages. 103 6.1. BACKGROUND Data from earlier studies perfomed in our laboratory and by others have shown that MorA affects many cellular functions such as pili-based twitching motility (Meissner et al., 2007), biofilm formation (Choy et al., 2004), timing of flagellar biogenesis (Appendix VI) and frequency of flagellar rotation (Wong Chuiching, unpublished) in P. aeruginosa. We have observed that the effect on flagella is not transcriptional (Wong Chuiching, unpublished). Given that pili, flagella and T2SS secreton are polar (Senf et al., 2008) in P. aeruginosa like that of MorA in P. putida (Jiun Fu, unpublished), it is very likely that the effect of c-di-GMP turnover by MorA is local and the signal is transmitted directly to the appendage/secreton rather than at the transcriptional or translational level. Other reports have linked c-di-GMP signalling to aspects of communal behaviour and colony morphology, e.g. biofilm development and architecture, and aggregation as well as other phenotypes including motility, virulence factor synthesis, and cell differentiation (Ryan et al., 2006; Jenal & Malone, 2006) in a posttranscriptional fashion. Notably, Mougous et al. have shown that the type VI secretion system (T6SS) of P. aeruginosa is under stringent regulation of a threonine phosphorylation. Hence, we postulate that phosphorylation may be a key posttranscriptional modification (PTM) through which c-di-GMP exerts its downstream effects. Binding studies of P. putida recombinant MorA to GTP indicated that optimum concentrations of the phosphodonor, AcP is required for successful binding of full length protein to GTP while the GTP binding of GGDEF domain itself is not affected significantly (Melvin, 2006) (Appendix VIIa). The binding affinity of full length 104 recombinant MorA decreased with increasing concentration of AcP. Also, the genes responsible for the turnover of AcP have been shown to be affected transcriptionally by MorA (Choy et al., 2008; Heng Mok-Wei, unpublished; refer Figure 2.8 and appendix VIIb for qPCR data). It is known that several bacterial response regulator proteins (CheY, NRI, PhoB, and OmpR) become phosphorylated in vitro when incubated with acetyl phosphate and hence in vivo AcP might activate a response regulator (RR) in the absence of its cognate histidine kinase (HK) (Dailey & Berg, 1993). AcP correlates with decreased expression of genes involved in flagella biogenesis and increased expression of genes involved in type 1 pilus assembly, the biosynthesis of colanic acid (an extracellular polysaccharide or capsule), and the response to multiple stresses (Prüss & Wolfe, 1994; Wolfe et al., 2003). RRs regulate the expression of these AcP-responsive genes (Wolfe 2005). It has been shown that RRs need not necessarily be phosphorylated by classical HKs but novel kinases involving more stable phosphorylation (tyrosine) (Wu et al., 1999). Our substrate binding and transcriptional analysis results indicate that phosphorylation of sensory domains may be involved in MorA GGDEF regulation and/or c-di-GMP levels may control phosphate pools/ phosphorylation of proteins as shown in the case of Rrp1 from Borrelia burgdorferi (Ryjenkov et al., 2005). Till date, there are reports only on phosphorylation acting as a stimulus for cyclic diguanylate cyclase activity (Jenal & Malone 2006). However, there are no reports on phosphorylation of downstream proteins in pathways affected by c-di-GMP signalling. Owing to the growing awareness of the importance of protein phosphorylation in controlling various bacterial pathways, there have been attempts in the recent past to obtain the complete picture of the phosphoproteome of bacteria (Bendt et al., 2003; 105 Lévine et al., 2006). Most recent cases of large-scale in vivo phosphorylation site mapping are for the Gram positive model organisms – pathogenic Bacillus subtilis (Macek et al., 2007), and non-pathogenic Lactococcus lactis (Soufi et al., 2008), and Gram-negative organism Escherichia coli (Macek et al., 2008). These phosphoproteomes seem to be evolutionarily conserved in the number of phosphoproteins, classes to which they belong, and distribution of phosphorylated sites. Until now, no Ser/Thr/Tyr phosphorylation sites have been reported in P. putida while only four sites have been reported in P. aeruginosa (phosphorylation site database) (Wurgler-Murphy et al., 2004). In this report, we have used a comprehensive approach to analyze the phosphoproteomes of P. putida PNLMK25 and P. aeruginosa PAO1 and, the crosstalk of c-di-GMP signaling and protein phosphorylation. A gel-based method using two dimensional gel electrophoresis was employed first, followed by a gel-free LCMS/MS method was used in collaboration with Dr. Yasushi Ishihama’s laboratory, Keio University, Japan. The analysis of captured phosphoproteins, their function and possible relevance of phosphorylation have been discussed in this chapter. Those pathways where several proteins are phosphorylated in the wild-type (WT) strains of both species have been highlighted. Lastly, phosphoproteins that show differential phosphorylation states due to MorA activity are suggested to be strong targets for further validation. This study will, therefore, help us to understand the significance of phosphorylation in key cellular mechanisms, pathogenicity as well as in the versatility of these organisms. It also leads to better understanding of the complex MorA signal transduction networks, which is probably c-di-GMP-based. To our knowledge, this is the first report on phosphoproteome 106 of non-enteric Gram-negative bacteria and first on the effect of a GGDEF/EAL domain protein on Ser/Thr/Tyr phosphorylation of proteins. 6.2. RESULTS AND DISCUSSION 6.2.1. Gel-based approach for identification of phosphoproteins This conventional method was employed initially for identification of phosphoproteins since sophisticated gel-free methods for large scale phosphoproteome analysis were not well established. Details of methods used and parameters optimized with intracellular protein fraction from P. putida PNL-MK25 are provided in Section 3.12.1. Trial staining with Pro-Q Diamond phosphoproteins stain (Figure 3.7) confirmed the presence of considerable number of phosphoproteins in Pseudomonas proteome. Hence, 2-DE maxi format gels under optimized conditions (Table 3.4) stained for total proteins for both phosphoproteins and total proteins were compared as shown in Figure 6.1. On image capture, the phosphostaining does not reveal clear spots as that of silver stain. As seen from top panel of Figure 6.1, the upper part (above 23.6kDa) of WT has many spots that are absent in morA KO. Also, spots towards pH5 seen in WT are absent in morA KO. But these are quite faint to be considered as true difference. Furthermore, on repeating the experiment, subsequent biological replicates did not show the same differences. The intensity and position of the spots for phosphoproteins highly varied even between technical replicates. In order to verify the batch variation in total proteins, inconsistency in conducting the experiment and protein handling, three pairs (WT and morA KO) of 2-DE gels stained directly for total proteins have been analyzed. These were from the same three biological 107 Figure 6.1. Effect of MorA on protein phosphorylation in P. putida. The top panels show 2-DE gels stained with Pro-Q Diamond (Invitrogen) for phosphoproteins. The bottom panel shows the same gels stained with silver nitrate for total proteins. The images are representative of three replicates. L- protein ladder (Peppermint Phosphoprotein ladder (Invitrogen) for top panel). The numbers on the right represent the size of ladder bands in kilodaltons. 108 replicates as mentioned above. Not much dissimilarity is expected in the total protein profile between WT and morA KO since we do not speculate major alteration at the transcriptional or translational level. Representative images of regions showing these differences are shown in Figure 6.2. Figure 6.2. Total protein profiles of P. putida WT and morA KO are consistent. Top panel shows representative images of total protein profile from 3 biological replicates stained with silver nitrate. The regions showing consistent difference are highlighted in white boxes. Paired images on the bottom panel highlight the regions boxed in top panel with WT on left and morA KO on right for each pair. The above results suggest that the total protein profiles between the WT and morA KO strains of P. putida are quite consistent as seen from the spot differences being uniform among biological replicates. It is possible that the inconsistency observed in the phosphoproteins profile may arise from the staining reagents. This is highly likely since 109 not many spots were visible even at PMT value 600 and above in the fluorescent scanner (Typhoon 9200) used for visualization while in the trial runs high intensity bands are visible even at PMT 540 (Figure 3.7). On further increasing the PMT value the background becomes dark resulting in poor visualization of the spots. Hence this method of staining for phosphoproteins was not suitable for a proteome wide analysis on a large gel format in our set-up. Therefore, no data from this method was used for interpretation. 6.2.2. Phosphoproteome analysis of P. putida and P. aeruginosa by Nano-LC-MS/MS method Based on analysis with tweleve replicates as mentioned in Figure 3.8, a total of 56 phosphopeptides in P. putida (Table 6.1) and 57 in P. aeruginosa (Table 6.2) have been identified with an overlap of nine peptides. Of the total 104 unique phosphopeptides from the two species, 18 have ambiguous phosphosites, i.e. the exact phosphorylated residue on the peptide is unidentified (marked by asterisk in Tables 6.1 and 6.2). Analysis of biological role of identified phosphopeptides show that 10–30% matched uncharacterised proteins while the rest were either experimentally proven to have specific function or possessed predicted functional domains (Figures 6.3B and 6.3D). Details of the identified phosphoproteins and their specific pathways are provided in the Table 6.3. As expected, based on previous phosphoproteomes (Macek et al., 2007; Soufi et al., 2008; Macek et al., 2008), proteins from carbohydrate metabolism and electron transfer pathways are phosphorylated in both species. These include proteins from glycolysis and tricarboxylic acid cycle among others. Of these, two protein hits are common to both species, namely isocitrate dehydrogenase and phosphoenolpyruvate synthase. 110 Table 6.1. List of phosphopeptides identified from P. putida PNL-MK25. The tick mark shows the presence of the phosphoppetide in P. putida wildtype (W), morA mutant (K) and morA overexpression (O) strains. Acc. Numbera Protein Description Phosphopeptide W K O Nucleotide metabolism Pfl01_0999 phosphoribosylformylglycina midine synthase LILRGAPALSAFRHpSK Protein metabolism Pfl01_0464 Glutamate-ammonia-ligase adenylyltransferase LGAVELNLpSSDIDLIFAYPEGGE TVGVK LGAVELNLp(SS)DIDLIFAYPEGG ETVGVK* Pfl01_1420 ATP-dependent helicase HrpA DLQLSLNKEPADpYPKLHK Pfl01_2154 peptidyl-arginine deiminase LLDTpTPK Pfl01_3987 DEAD/DEAH box helicaselike HVKIQpSK Pfl01_4072 30S ribosomal protein S1 pSESFAELFEESLK Pfl01_4852 isoleucyl-tRNA synthetase pSLGNVIAPQK Pfl01_5066 30S ribosomal protein S14 QLpTVAKYAVK Pfl01_5087 50S ribosomal protein L7/L12 pSLTNEQIIEAIGQK Energy metabolism Pfl01_0887 Thioredoxin reductase VIILGSGPAGYSAAVpYAAR Pfl01_1770 phosphoenolpyruvate synthase GGRpTCHAAIIAR Pfl01_2924 pyridine nucleotidedisulphide oxidoreductase class-II MLDANLKAQLKSpYLER Pfl01_2957 cytochrome c-type biogenesis protein CcmE TVTITpYR Pfl01_3593 isocitrate dehydrogenase (NADP) pSLNVALR Pfl01_4511 Electron transport complex, RnfABCDGE type, G unit NQGEFDQIAGApTITSR 111 Pfl01_4905 4-hydroxyphenylpyruvate dioxygenase MQRSIATVSLpSGTLPEK Regulatory proteins Pfl01_1541 Anti-Sigma-factor antagonist (STAS) EATYLDpSSALGMLLLLR Pfl01_2369 LysR family transcriptional regulator RLGQYQKPNQLVLNp(TT)PAFAR * Pfl01_2592 sigma-54 dependent trancsriptional regulator GEpSGTGKELVARTLHR GESGpTGKELVARTLHR Pfl01_3133 Anti-Sigma-factor antagonist (STAS) LWDGVLALPMIGpTLDSQR* LWDGVLALPMIGTLDpSQR Pfl01_3691 LysR family transcriptional regulator MDSLGSISVFVQVAEpTR Pfl01_3848 Anti-Sigma-factor antagonist (STAS) SIDpSTTLGLLAK SIDSpTTLGLLAK SIDp(STT)LGLLAK* Pfl01_4437 H-NS family protein MvaT, transcriptional regulator pSLINEYR Pfl01_4758 chemotaxis sensory transducer TApSLLEAR Pfl01_5352 Predicted signal transduction protein LIpSQDPGLSGSLLK Cellular processes Pfl01_0177 Predicted outer membrane protein PgaA AGHp(YT)PALSVLR* Pfl01_0385 2-octaprenylphenol hydroxylase KIpSEVFSR Pfl01_0445 potassium efflux protein KefA GpSLLLSKILYK Pfl01_1174 CinA-like VPIPpSDPER Pfl01_1211 ATP-dependent DNA ligase EVDSIVRKpTpTVEK Pfl01_1507 flagellar hook-associated protein FlgL VVLTNGIVGp(T)Aap(TY)NAK* 112 Pfl01_1643 cob(II)yrinic acid a,c-diamide reductase VRpTAEALGER Pfl01_2213 Amino acid adenylation FLDDPFNSGRMpYR Pfl01_2252 zinc-containing alcohol dehydrogenase superfamily protein SIKLpTYPSVMHYVR Pfl01_2386 Alpha/beta hydrolase fold TEAApSVKADLPFGPLKHVK Pfl01_2572 putative lipoprotein QTLGLpSQTQTLDNLPYVLRGK* QTLGLSQpTQTLDNLPYVLRGK Pfl01_2980 ABC transporter, transmembrane region QRLIp(S)RLIDp(S)QHPEpSLLAAL R* Pfl01_3511 extracellular solute-binding protein KpTLLDAK Pfl01_3655 acyl-CoA synthetase AEFDLSTLRpTGIMAGApTCPIEV MR Pfl01_4032 Potassium-translocating Ptype ATPase, B subunit VEAGEMIPGDGEVIEGIAAVNEA AITGEpSAPVIR Pfl01_4184 acyl-CoA dehydrogenase YITLGPVApTLLGLAFK Pfl01_4414 Ferritin and Dps pSIVEGLSR Pfl01_4493 multidrug efflux protein LPQDAEDPVLSKEAADASALMpY ISFFSK Pfl01_4597 GTP-binding protein EngA DAIVGDLpSGLTR Pfl01_4601 4-hydroxy-3-methylbut-2-en1-yl diphosphate synthase KYGEPpTPAALVESALR Pfl01_4853 bifunctional riboflavin kinase/FMN adenylyltransferase FApSLEALK Pfl01_5117 Outer membrane autotransporter barrel LVDpSVRTLQGAGAR Pfl01_5121 Iron-containing alcohol dehydrogenase KLpSAADIEK Pfl01_5519 ATP-dependent DNA helicase Rep Np(T)LEKDEDGEMp(T)VEDAIGK * Pfl01_5542 Phosphomannomutase pSGVMLTGSHNPSNYNGFK SGVMLpTGSHNPSNYNGFK SGVMLTGpSHNPSNYNGFK 113 Pfl01_5576 Protein serine/threonine phosphatase LGQELpTVTAGR Pfl01_5581 FHA domain-containing protein LAQpTTVQGTNK Pfl01_5724 Tn7-like transposition protein B SVKpSGDVKLpTK Hypothetical proteins Pfl01_0125 hypothetical protein MpSNLQPDTLIK Pfl01_1288 hypothetical protein DQpSVMQLAVGAR Pfl01_1438 hypothetical protein LAEQpSPQLK Pfl01_1631 hypothetical protein VLGSEKVEpTK Pfl01_1736 hypothetical protein ERpSHLFRGASYGTIMR Pfl01_2215 hypothetical protein NIDLpTIHAGEMVAIIGASGSGK Pfl01_2348 hypothetical protein GYLRGLNpTpTR Pfl01_4238 hypothetical protein RRIDLPASSIDGAENGVIPLp(T)Vp (S)pSK* *Ambiguous phosphorylated site on the residues in parentheses. Some proteins involved in transcription, translation, and prosthetic group synthesis have also been captured. These include RNA helicase HrpA, tRNA aminoacylation, and ribosomal proteins similar to those reported in E. coli. Proteins involved in ubiquinone biosynthesis are phosphorylated in both species. In addition to metabolic pathway enzymes, proteins involved in other cellular processes such as transport and DNA replication/repair are phosphorylated. Novel finds include a probable lipoprotein, lipid metabolism protein acyl-coA dehydrogenase, alcohol dehydrogenase, DNA ligase, and DNA helicase Rep in P. putida and exodeoxyribonuclease and topoisomerase IV. 114 Table 6.2. List of phosphopeptides identified from P. aeruginosa PAO1. The tick mark shows the presence of the phosphoppetide in P. aeruginosa wildtype (W), morA mutant (K) and morA overexpression (O) strains. Acc. Numbera Protein Description Phosphopeptide W K O Nucleotide metabolism PA4938 adenylosuccinate synthetase RGHEFGATpTGR PA4973 thiamine biosynthesis protein ThiC GIITPEMEpYIAIRENMK 0 0 0 0 Protein metabolism PA1068 probable heat shock protein (hsp90 family) AGVDLNGVMpSVLpSK PA3162 30S ribosomal protein S1 pSESFAELFEESLK 0 0 SEpSFAELFEESLK* PA4252 50S ribosomal protein L24 EAPLHVSNVAIFNpTETSK PA5014 glutamate-ammonialigase adenylyltransferase LGAVELNLSpSDIDLIFGYPEGGETEGAK 0 0 0 0 Regulatory proteins PA0576 sigma factor RpoD EMGpTVELLTR PA3965 probable transcriptional regulator pYDLRILEELQR PA4520 probable chemotaxis transducer AIGAYSLGQGFLNSSSpSAR* 0 PA5253 alginate regulatory protein AlgP AREpTISDLEEALDTLK 0 0 Energy metabolism PA1585 PA1588 2-oxoglutarate dehydrogenase (E1 subunit) succinyl-CoA synthetase beta chain AQPVSAGSVSpSEHEK 0 0 AQPVSAGpSVSSEHEK 0 0 0 0 INIDpSNALYR NLVTpYQTDANGQPVSK* 115 PA1770 phosphoenolpyruvate synthase GGRpTCHAAIIAR PA2623 isocitrate dehydrogenase pSLNVALR PA2640 NADH dehydrogenase I chain E SQpSNLIQTDR 0 PA2828 probable aminotransferase NLPpTAQGYSDSK 0 PA2997 Na+-translocating NADH:ubiquinone oxidoreductase subunit Nrq3 ATHQVDGLAGATLTpSK* 0 0 ATHQVDGLAGApTLTSK PA3001 probable glyceraldehyde3-phosphate dehydrogenase NNNVVp(TS)IHGRGLINRpSVIAIMK* 0 0 DpSLSTALAHLTEPLPELPIEQGR 0 0 Cellular processes PA0074 serine/threonine protein kinase PpkA DSLpSTALAHLTEPLPELPIEQGR 0 DSLSTALAHLpTEPLPELPIEQGR* DSLSpTALAHLTEPLPELPIEQGR PA0605 probable permease of ABC transporter NQTIGDLpSKR PA1092 flagellin type B NLNASSNDLNTpSLQR* 0 0 NLNASSNDLNpTSLQR PA1382 probable type II secretion system protein pSGLSVMADGARSGLMLK 0 PA1634 potassium-transporting ATPase, B chain VQAGEMIPGDGEVIEGVAAVNEAAITGEpSAP VIR PA1670 serine/threonine phosphoprotein phosphatase Stp1 LGEELpTLSAER PA1807 probable ATP-binding component of ABC transporter GQTLGIVGESGpSGK 0 PA2252 probable AGCS sodium/alanine/glycine symporter LEMLNDFLpSGK 0 0 0 116 PA2424 PvdL MWFLWQLEPDpSPApYNVGGLARLSGPLDVA R 0 PA2500 probable major facilitator superfamily (MFS) transporter VPAAMGLYSApSLMAGGGTAAVLSPR PA2760 probable outer membrane protein precursor LDpSDFADQNFNGNR PA3115 Motility protein FimV DILDEVLAEGNDpSQQAEAR PA3429 probable epoxide hydrolase RGRpTLDFK PA3448 probable permease of ABC transporter LpSDGLLR PA3901 Fe(III) dicitrate transport protein FecA ARpTWELGSRpYDDGILR PA4067 Outer membrane protein OprG precursor AQGFpSSMK 0 0 GGFATVDPDDpSSSDIK 0 0 0 0 0 0 0 0 0 GGFATVDPDDSpSSDIK* GGFATVDPDDSSpSDIK PA4156 probable TonBdependent receptor TFpSAFLPK* 0 PA4217 flavin-containing monooxygenase SAALEAIpTGSYR 0 PA4316 exodeoxyribonuclease I pYRARNFPEpTLNVAER 0 0 PA4964 topoisomerase IV subunit A pSARTVGDVLGK 0 0 PA4994 probable acyl-CoA dehydrogenase LGIKASDTASIpSFNDCR* PA5322 phosphomannomutase AlgC pSGVMLTGSHNPPDYNGFK 0 0 0 0 0 SGVMLpTGSHNPPDYNGFK SGVMLTGpSHNPPDYNGFK Hypothetical proteins PA0170 hypothetical protein LLYLNTSpSIK 0 LLYLNpTSSIK PA0588 conserved hypothetical pSIFSHFQER 0 0 117 protein PA0920 hypothetical protein LIDRITApYR PA1053 conserved hypothetical protein VRILTVNGpTpSR PA1665 hypothetical protein LSLpSTLR PA1765 hypothetical protein LVSDAVpYKLNPEp(TWY)R* PA2613 conserved hypothetical protein pSLGYGEEYR PA3238 hypothetical protein pTFpYEVVLSK PA3310 conserved hypothetical protein SCGTSpTAVSVPCMFSQYPR* PA3347 hypothetical protein NATYLDpSSALGMLLLLR 0 0 0 0 0 0 0 0 NATYLDSpSALGMLLLLR* NATpYLDSSALGMLLLLR NApTYLDSSALGMLLLLR* 0 PA3493 conserved hypothetical protein DGGTFDQFAGApTVTPR PA4308 conserved hypothetical protein IGPLSDSERAELVQRpSPLK PA5006 hypothetical protein HHpSQASFAR PA5062 conserved hypothetical protein LGLMLSAMpSGLLKGEIEKALDK* PA5184 hypothetical protein LDELHAIALpSR 0 PA5205 conserved hypothetical protein ApSLpYVALIMLVSFpYGGSLVMQVFGISIPGL R 0 PA5265 hypothetical protein LLFGPSTAKYLEpTPR 0 0 0 0 0 0 0 118 Figure 6.3. Cellular localization and biological function of identified phosphoproteins. (A) Fractions of P. putida phosphoproteins localized in different cellular compartments. (B) Percentage of P. putida phosphoproteins implicated in different biological processes. (C) Fractions of P. aeruginosa phosphoproteins localized in different cellular compartments. (D) Percentage of P. aeruginosa phosphoproteins implicated in different biological processes. Note: The category ‘‘cellular processes’’ include DNA replication/recombination/repair, prosthetic group/carrier biosynthesis, toxin production/secretion, transport, PTMs, lipopolysaccharide biosynthesis/degradation, membrane proteins, and putative enzymes. 119 Table 6.3. Specific roles of identified phosphoproteins. Specific pathway P. putidaa P. aeruginosab Nucleotide metabolism Ribonucleotide biosynthesis 2 Nucleotide interconversions 1 Protein metabolism transcription 1 tRNA aminoacylation 2 Ribosomal proteins: synthesis and modification 1 AA biosynth 1 Energy metabolism Glycolysis/gluconeogenesis 1 1 TCA cycle 1 2 electron transport 3 Cations and iron carrying compounds 1 Lipid metabolism fatty acid and phospholipid biosynthesis 1 Regulatory proteins transcriptional regulators 3 signal transduction 4 DNA interactions (putative) 1 2 Cellular processes Ubiquinone biosynth 1 cobalamin biosynth 1 Toxin production/ resistance/secretion 3 Transport of small molecules 3 5 DNA replication, recomb, repair 5 2 PTM/ protein turnover 1 2 surface factors biosyth n modification 2 3 120 Putative enzymes 2 Haemin storage 1 fermentation 2 membrane proteins 1 biotin synthesis 1 a, b No. of phosphoproteins that belong to the specific metabolic pathway/ cellular process is shown for P. putida and P. aeruginosa respectively. Other than the house-keeping proteins mentioned above, many proteins involved in bacterial survival mechanisms, virulence and adaptability are found to be phosphorylated as well. Noteworthy hits are motility/attachment proteins FimV and flagellin type-B (FliC) of P. aeruginosa. These are very important structural proteins of surface appendages namely pili and flagella respectively. Pili are crucial in mediating attachment to surfaces while flagella drive swimming motility. Only tyrosine phosphorylation (Kelly-Wintenberg et al., 1993) has been reported for P. aeruginosa b-type flagellin previously. Phosphorylation on such key proteins suggests that probably these are very relevant to their function. Interestingly, the phosphopeptide SGVMLTGpSHNPPDYNGFK found in both the Pseudomonas species corresponds to phosphomannomutase AlgC (PA5322) involved in modification of surface polysaccharide moieties. A predicted nonribosomal peptide synthetase PvdL involved in iron acquisition (Mossialos et al., 2002) in P. aeruginosa has been captured as well. A particular phosphoprotein phosphatase Stp1 found in both the Pseudomonas species (PA1670 and Pfl01_5576) analyzed has been phosphorylated at a conserved Tyr residue (Figure 6.4A). Stp1 is located in the type VI secretion system (T6SS) cluster of P. 121 aeruginosa (Filloux et al., 2008) and has implication in regulation of alginate synthesis. Also, a Ser/Thr protein kinase PpkA of T6SS cluster in P. aeruginosa (Mougous et al., 2007) is captured. Furthermore, in P. putida, an FHA domain protein has been identified, whose P. aeruginosa homologue Fha1 sharing a conserved phosphorylated site (Figure 6.4B) is the key regulator for T6SS secretion. T6SS is implicated in virulence of various human pathogens and is widely found in proteobacteria (Filloux et al., 2008). Its probable function in non-pathogens like P. putida is to mediate as yet uncharacterized interactions with nematodes, and amoebae and other microscopic eukaryotes (Pallen & Wren, 2007). The striking feature observed is that, in P. putida, many transport proteins (Pfl01_0445, Pfl01_2980, Pfl01_4032, Pfl01_4493), from ion channels to drug pumps, involved in resistance and iron metabolism/iron-mediated oxidative damage response proteins (Pfl01_0177, Pfl01_1174, Pfl01_2213, Pfl01_4414, Pfl01_5121) are found to be phosphorylated. Since iron sequestration is an important phenomenon in soil bacteria (Meyer, 2000), the PTM of a protein involved in this process might have significant roles in the mechanism. Transporters are highly relevant to this P. putida strain PNL-MK25, since it is known to be involved in aromatic hydrocarbon degradation. These phosphorylation events reveal the possible importance of Ser/Thr/Tyr phosphorylation in mechanisms such as adhesion, survival, stress resistance, and pathogenicity. 122 Figure 6.4. Phosphorylation sites on T6SS-related proteins. A. Conservation of phosphorylation site of the Serine/Threonine phosphoprotein phosphatase Stp1 identified from P. aeruginosa (PA1670) and P. putida (Pfl_5576). The arrow pointer shows the site of phosphorylation while the asterisks below show the conserved residues. B. P. putida FHA domain containing protein (Pfl_5581) may contribute to functional type VI secretion. Left panel- Pfl_5581 possesses the conserved residues (boxed) of FHA domain. Right panel- The identified phosphosite (*) in comparison with the proven phosphosite required for functional type VI secretion system in P. aeruginosa. Based on cellular localization, several membrane-localized proteins are identified in this study to be phosphorylated. Periplasmic- and outer membrane-localized proteins seem to be overrepresented especially in the phosphoprotein population of the P. aeruginosa PAO1 (Figure 6.3A) and in P. putida (Figure 6.3C) compared with those of this class in the genome. Phosphoproteins localized in the cytoplasm of P. putida are underrepresented with respect to the whole genome. The predicted outer membrane protein PgaA of P. putida possibly involved in haemin storage (HmsH) (Pendrak & Perry 1993) and OprG precursor of P. aeruginosa are worth mentioning. 123 6.2.3. Crosstalk of Mor-c-di-GMP signaling and protein phosphorylation Phosphoproteome analysis of P. putida strains that either lack or overexpress MorA, the GGDEF/EAL domain containing protein, resulted in changes in the Ser/Thr/Tyr phosphorylation patterns of 41 phosphopeptides from 24 phosphoproteins (Table 6.1 and Figure 6.5A) while only 14 show absolute dependency on either presence or absence of MorA (Table 6.4). Similar analysis of P. aeruginosa strains has revealed changes in 45 phosphopeptides from 42 phosphoproteins (Table 6.2 and Figure 6.5B). This is the first study reporting large-scale changes in phosphorylation of proteins due to GGDEF/EAL domain proteins suggesting a link to altered c-di-GMP levels. Figure 6.5. Effect of c-di-GMP on protein phosphorylation in P. putida (A) and P. aeruginosa (B). The numbers represent the number of phosphopeptides that are found in WT, morA KO, and morA OE strains of respective species. The ones that are present only in morA KO and those in both WT and morA OE are highly significant since they show direct effect of MorA activity. 124 Table 6.4. Effect of MorA-c-di-GMP signalling on protein phosphorylationa. morA+ morA- P. putida Pfl01_5066 30S ribosomal protein S14 Pfl01_0887 Thioredoxin reductase Pfl01_5087 50S ribosomal protein L7/L12 Pfl01_2957 cytochrome c-type biogenesis protein CcmE Pfl01_1541 Anti-Sigma-factor antagonist (STAS) Pfl01_2592 sigma-54 dependent trancsriptional regulator Pfl01_4758 chemotaxis sensory transducer Pfl01_5352 Predicted signal transduction protein Pfl01_5542 Phosphomannomutase Pfl01_1507 flagellar hook-associated protein FlgL Pfl01_4238 Hypothetical protein Pfl01_4601 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase Pfl01_0125 Hypothetical protein Pfl01_3133 Anti-Sigma-factor antagonist (STAS) P. aeruginosa PA2640 NADH dehydrogenase I chain E PA4252 50S ribosomal protein L24 PA0074 serine/threonine protein kinase PpkA PA4520 probable chemotaxis transducer PA2424 PvdL PA3001 probable glyceraldehyde-3phosphate dehydrogenase PA0170 hypothetical protein PA0074 serine/threonine protein kinase PpkA PA5184 hypothetical protein PA1382 probable type II secretion system protein PA4156 probable TonB-dependent receptor PA4308 conserved hypothetical protein PA5062 conserved hypothetical protein a morA+ represents proteins that are “only” phosphorylated in the presence of morA i.e. in both WT and OE strains and morA- represents proteins “only” phosphorylated in the absence morA i.e. morA KO strain. 125 In P. putida, most significant ones are the signal transduction proteins (Pfl01_4758 and Pfl01_5352) and sigma-54 dependent transcriptional regulator containing predicted response regulator activity (sigma-54 interaction domain and DNA binding domain). Another remarkable phosphoprotein identified is FlgL, a hook-associated protein located at the hook-filament junction of flagella (Homma et al., 1990) essential for lateral flagellar formation, swimming, and swarming (Altarriba et al., 2003). Other proteins of interest include ribosomal proteins (Pfl01_5066 and Pfl01_5087), and the oxidative stress pathway proteins, thioredoxin reductase and cytochrome c-type biogenesis protein CcmE. Oxidative stress proteins are of interest especially because MorA has redox sensor domains. We speculate that the chemotaxis and the hypermotility phenotypes observed in morA knockout (KO) (Choy et al., 2004) may be associated directly or indirectly with some of these above-mentioned phosphorylation changes resulting from variation of c-diGMP levels. In P. aeruginosa, noteworthy ones include the serine/ threonine kinase PpkA and the probable type II secretion protein (PA1382). Role of PpkA in T6SS regulation has been well established in P. aeruginosa (Mougous et al., 2007) and chapter 5 of this report shows an obvious effect of MorA on the type II secretion phenotype. Hence these are potential targets for further validation of the crosstalk mechanism. Others include the probable chemotaxis regulator and the iron transport related proteins: PvdL and probable TonB-dependent receptor (PA 4156). Acquiring host iron supplies is essential for replication and P. aeruginosa produces two major siderophores, pyochelin and pyoverdin to facilitate this process (Vasil & Ochsner, 1999). Pyocyanin, a blue-green pigment, is responsible for impairment of epithelial vacuolar ATPase function, interference with 126 antioxidant defenses and stimulation of inflammatory response (Kong et al., 2006). Furthermore, these are involved in disabling polymorphonuclear leucocytes (PMNs), which are a major first line of defense of the host (Jensen et al., 2007). 6.4. CONCLUSIONS AND FUTURE DIRECTIONS Results presented in this chapter reveal that Comparative analysis at interspecies level shows firstly that functional distribution of phosphoproteins in the Pseudomonas species seems to be similar to those in B. subtilis and E. coli. Key members involved in the survival and virulence pathways of Pseudomonas sp. may involve Ser/Thr/Tyr phosphorylation We have identified several previously validated phosphoproteins such as Fha1 homologue and isocitrate dehydrogenase. A substantial fraction of membrane-localized proteins are phosphorylated in P. aeruginosa. This is significant since many surface-related phenomena play vital role in the virulence of this pathogen and some such proteins have been phosphorylated. Protein phosphorylation seems a likely mechanism for large-scale posttranscriptional affects of c-di-GMP signaling and may involve novel Ser/Thr/Tyr protein kinases in P. putida and P. aeruginosa. It is still unclear whether c-di-GMP controls and/or depends on Ser/Thr/Tyr phosphorylation events in Pseudomonas. Thus, the information from this analysis opens up several questions to be addressed. Since Pseudomonas inhabit varied niches, it would 127 be exciting to study phosphorylation pattern changes under such different environmental conditions and its impact on the cellular processes. However, it is to be noted that phosphoproteome may be very dynamic (Levine et al., 2006). Hence the data presented here and by others for different species may not portray a complete picture of the phosphorylation states of all proteins at all times. For comparison purpose, we have tried to keep the growth conditions same for all strains and experimental conditions for the samples. As a follow-up of this study, some ongoing experiments are Phosphoproteome analysis of strains with mutations of known eukaryotic-like serine/ threonine kinases in P. aeruginosa. Comparison of these with the wildtype and morA KO profiles will throw insight into i) targets for the individual kinases and ii) kinases and respective targets that are regulated by MorA (if any). Functional validation of selected P. aeruginosa phosphoproteins For this purpose, proteins involved in very critical surface-related phenomena required for adaptability, defense and/or virulence have been chosen as shown in Table 6.5. Table 6.5. Phosphopeptides of interest for validating functional significance of phosphorylation Acc. Number Protein Description Phosphopeptide Location on phosphoprotein PA4520 probable chemotaxis transducer AIGAYSLGQGFLNSSSpSAR* S216 PA5253 alginate regulatory protein AlgP AREpTISDLEEALDTLK T80 PA1092 flagellin type B NLNASSNDLNp(TS)LQR* T27, S28 NLNASSNDLNpTSLQR PA3115 Motility protein FimV DILDEVLAEGNDpSQQAEAR S906 128 PA5322 phosphomannomutase AlgC pSGVMLTGSHNPPDYNGFK S101, T106, S108 SGVMLpTGSHNPPDYNGFK SGVMLTGpSHNPPDYNGFK *Ambiguous phosphorylated site on the residues in parentheses. Point mutation(s) at the site(s) of phosphorylation are being created. Such a point mutant when introduced into the corresponding gene mutant background will show relevance of the phosphorylation in protein function since a normal copy from chromosome is not present. Currently, importance has been given to FliC and FimV since they are involved in key phenotypes (motility and biofilm formaton) that have been shown to be affected by MorA. Also, these phenomena are quintessential for the survival of P. aeruginosa especially under stress. FimV is known to affect twitching motility and is thought to be part of the conduit through which pili pass through the bacterial double membrane layer. Other than these, the probable chemotaxis transducer and probable type II secretion system protein are being investigated as well, since they are relevant to phenotypes affected by MorA. The phosphosite identified on FliC is present in the innermost domain of the flagellar filament (Yonekura et al., 2003). This region is highly conserved across all varieties of flagellum (Beatson et al., 2006). Hence it may be involved in transport of proteins through the filament or in the tight packing of the flagellin subunits itself forming an intact core. Also, this region has been proposed to be the transport signal for flagellin subunits (Vegh et al., 2006). Hence, studying the functional significance of phosphorylation on this site is of prime importance not only for P. aeruginosa motility or 129 virulence but to establish a general mechanism in bacteria. Preliminary results have shown that one of the two (ambiguous) sites mutated did not show any significant difference in motility (data not shown). Further investigation of the effect of this mutation on biofilm, construction of the second site and double point mutations are underway. 130 CHAPTER 7 CONCLUDING REMARKS C-di-GMP signaling is ubiquitous in bacteria and is known to affecrt multiple survival and virulence mechanisms. Widely known phenotypes to be affected include motility, biofilm formation, type III secretion system, lipopolysaccharide production and aggregation. Here we have studied the role of MorA-c-di-GMP signaling in P. aeruginosa virulence mechanisms during host invasion. Understanding in two new areas has been established in this study. A central and constitutive secretion pump, Type II secretion system (T2SS), has been shown to be affected by this signaling system. Signaling affects the rate of the secretion process in a post-translational manner. As proteases secreted by T2SS are implicated in many interactions with the microbial surroundings, this report broadens the significance of the role of c-di-GMP signaling in the survival and virulence of P. aeruginosa. In this first report of P. aeruginosa Ser/Thr/Tyr phosphoproteome, we find widely conserved phosphorylated targets between diverse microbial species belonging to both Gram-positive and Gram-negative groups. Further, phosphoproteome is affected by MorA-c-di-GMP signaling. Thus we have added a new mechanism through which this second messenger signaling controls its target pathways. Taken together, this report has added a highly ubiquitous target pathway (T2SS) to the ones controlled by c-di-GMP signaling and has highlighted the role of post-translational mechanisms through which this signaling system may function. 131 REFERENCES Altarriba, M., Merino S., Gavín R., Canals R., et al. A polar flagella operon (flg) of Aeromonas hydrophila contains genes required for lateral flagella expression. Microb Pathog 2003, 34:249-259. Arora, S.K., Bangera M., Lory S., Ramphal R. A genomic island in Pseudomonas aeruginosa carries the determinants of flagellin glycosylation. Proc Natl Acad Sci U S A 2001, 98:9342-9347. Arora, S.K., Neely A. N., Blair B., Lory S., Ramphal R. Role of motility and flagellin glycosylation in the pathogenesis of Pseudomonas aeruginosa burn wound infections. Infect Immun 2005, 73:4395-4398. Arora, S.K., Ritchings B. W., Almira E. C., Lory S., Ramphal R. The Pseudomonas aeruginosa flagellar cap protein, FliD, is responsible for mucin adhesion. Infect Immun 1998, 66:1000-1007. Arora, S.K., Wolfgang M. C., Lory S., Ramphal R. Sequence polymorphism in the glycosylation island and flagellins of Pseudomonas aeruginosa. J Bacteriol 2004, 186:2115-2122. Bakal, C.J., Davies J. E. No longer an exclusive club: eukaryotic signalling domains in bacteria. Trends Cell Biol 2000, 10:32-38. Ball, G., Chapon-Hervé V., Bleves S., Michel G., Bally M. Assembly of XcpR in the cytoplasmic membrane is required for extracellular protein secretion in Pseudomonas aeruginosa. J Bacteriol 1999, 181:382-388. Ball, G., Durand E., Lazdunski A., Filloux A. A novel type II secretion system in Pseudomonas aeruginosa. Mol Microbiol 2002, 43:475-485. Bauman, S.J., Kuehn M. J. Purification of outer membrane vesicles from Pseudomonas aeruginosa and their activation of an IL-8 response. Microbes Infect 2006, 8:2400-2408. Bayan, N., Guilvout I., Pugsley A. P. Secretins take shape. Mol Microbiol 2006, 60:1-4. Beatson, S.A., Minamino T., Pallen M. J. Variation in bacterial flagellins: from sequence to structure. Trends Microbiol 2006, 14:151-155. Beatson, S.A., Whitchurch C. B., Sargent J. L., Levesque R. C., Mattick J. S. Differential regulation of twitching motility and elastase production by Vfr in 132 Pseudomonas aeruginosa. J Bacteriol 2002, 184:3605-3613. Bechet E., Guiral S., Torres S., Mijakovic I., et al. Tyrosine-kinases in bacteria: from a matter of controversy to the status of key regulatory enzymes. Amino acids 2009, 37:499-507. Bendt, A.K., Burkovski A., Schaffer S., Bott M., et al. Towards a phosphoproteome map of Corynebacterium glutamicum. Proteomics 2003, 3:16371646. Bitter, W. Secretins of Pseudomonas aeruginosa: large holes in the outer membrane. Arch Microbiol 2003, 179:307-314. Bjarnsholt, T., Jensen P. Ø., Jakobsen T. H., Phipps R., et al. Quorum sensing and virulence of Pseudomonas aeruginosa during lung infection of cystic fibrosis patients. PloS one 2010, 5:e10115. Bjarnsholt, T., Tolker-Nielsen T., Høiby N., Givskov M. Interference of Pseudomonas aeruginosa signalling and biofilm formation for infection control. Expert Rev Mol Med 2010, 12:e11. Bleves, S., Voulhoux R., Michel G., Lazdunski A., et al. The secretion apparatus of Pseudomonas aeruginosa: identification of a fifth pseudopilin, XcpX (GspK family). Mol Microbiol 1998, 27:31-40. Bloemberg, G.V., O'Toole G. A., Lugtenberg B. J., Kolter R. Green fluorescent protein as a marker for Pseudomonas spp. Appl Environ Microbiol 1997, 63:45434551. Bodenmiller, D., Toh E., Brun Y. V. Development of surface adhesion in Caulobacter crescentus. J Bacteriol 2004, 186:1438-1447. Boehm, A., Kaiser, M., Li, H., Spangler, C., et al. Second messenger-mediated adjustment of bacterial swimming velocity. Cell 2010, 141: 107-116. Borlee, B.R., Goldman A. D., Murakami K., Samudrala R., et al. Pseudomonas aeruginosa uses a cyclic-di-GMP-regulated adhesin to reinforce the biofilm extracellular matrix. Mol Microbiol 2010, 75:827-842. Bradley, D.E. A function of Pseudomonas aeruginosa PAO polar pili: twitching motility. Can J Microbiol 1980, 26:146-154. Braun, P., de Groot A., Bitter W., Tommassen J. Secretion of elastinolytic enzymes and their propeptides by Pseudomonas aeruginosa. J Bacteriol 1998, 133 180:3467-3469. Brok, R., Van Gelder P., Winterhalter M., Ziese U., et al. The C-terminal domain of the Pseudomonas secretin XcpQ forms oligomeric rings with pore activity. J Mol Biol 1999, 294:1169-1179. Brown, D.A., London E. Structure and function of sphingolipid- and cholesterolrich membrane rafts. J Biol Chem 2000, 275:17221-17224. Caiazza, N.C., Shanks R. M. Q., O'Toole G. A. Rhamnolipids modulate swarming motility patterns of Pseudomonas aeruginosa. J Bacteriol 2005, 187:7351-7361. Carbonnelle, E., Helaine S., Nassif X., Pelicic V. A systematic genetic analysis in Neisseria meningitidis defines the Pil proteins required for assembly, functionality, stabilization and export of type IV pili. Mol Microbiol 2006, 61:1510-1522. Choy, W., Bajic V., Heng M., Veronika M., Swarup S. Regulatory Networks of Genes Affected by MorA, a global regulator containing GGDEF and EAL domains in Pseudomonas aeruginosa. World Scientific (Series on Advances in Bioinformatics and Computational Biology) 2008, 8 Choy, W.K., Zhou L., Syn C. K., Zhang L. H., Swarup S. MorA Defines a New Class of Regulators Affecting Flagellar Development and Biofilm Formation in Diverse Pseudomonas Species. J Bacteriol 2004, 186:7221-7228. Clausen, M., Koomey M., Maier B. Dynamics of type IV pili is controlled by switching between multiple states. Biophys J 2009, 96:1169-1177. Cornelis, P. (Ed.) Pseudomonas: Genomics and Molecular biology. 2008. Norfolk, UK: Caister Academic Press. Cossart, P., Sansonetti P. J. Bacterial invasion: the paradigms of enteroinvasive pathogens. Science 2004, 304:242-248. Costerton, J.W., Lewandowski Z., Caldwell D. E., Korber D. R., Lappin-Scott H. M. Microbial biofilms. Annu Rev Microbiol 1995, 49:711-745. Costerton, J.W., Stewart P. S., Greenberg E. P. Bacterial biofilms: a common cause of persistent infections. Science 1999, 284:1318-1322. Cotter, P.A., Stibitz S. c-di-GMP-mediated regulation of virulence and biofilm formation. Curr Opin Microbiol 2007, 10:17-23. Cowell, B.A., Twining S. S., Hobden J. A., Kwong M. S. F., Fleiszig S. M. J. Mutation of lasA and lasB reduces Pseudomonas aeruginosa invasion of epithelial 134 cells. Microbiology 2003, 149:2291-2299. Cozzone, A.J. Role of protein phosphorylation on serine/threonine and tyrosine in the virulence of bacterial pathogens. J Mol Microbiol Biotechnol 2005, 9:198-213. Cozzone A.J. Bacterial tyrosine kinases: novel targets for antibacterial therapy? Trends in Microbiol 2009, 17: 536-543. D'Argenio, D.A., Calfee M. W., Rainey P. B., Pesci E. C. Autolysis and autoaggregation in Pseudomonas aeruginosa colony morphology mutants. J Bacteriol 2002, 184:6481-6489. Dailey, F.E., Berg H. C. Change in direction of flagellar rotation in Escherichia coli mediated by acetate kinase. J Bacteriol 1993, 175:3236-3239. Darling, K.E.A., Dewar A., Evans T. J. Role of the cystic fibrosis transmembrane conductance regulator in internalization of Pseudomonas aeruginosa by polarized respiratory epithelial cells. Cell Microbiol 2004, 6:521-533. Dasgupta, N., Ferrell E. P., Kanack K. J., West S. E. H., Ramphal R. fleQ, the gene encoding the major flagellar regulator of Pseudomonas aeruginosa, is sigma70 dependent and is downregulated by Vfr, a homolog of Escherichia coli cyclic AMP receptor protein. J Bacteriol 2002, 184:5240-5250. Dasgupta, N., Wolfgang M. C., Goodman A. L., Arora S. K., et al. A four-tiered transcriptional regulatory circuit controls flagellar biogenesis in Pseudomonas aeruginosa. Mol Microbiol 2003, 50:809-824. Davey, M.E., Caiazza N. C., O'Toole G. A. Rhamnolipid surfactant production affects biofilm architecture in Pseudomonas aeruginosa PAO1. J Bacteriol 2003, 185:1027-1036. de Bentzmann, S., Roger P., Dupuit F., Bajolet-Laudinat O., et al. Asialo. GM1 is a receptor for Pseudomonas aeruginosa adherence to regenerating respiratory epithelial cells. Infect Immun 1996, 64:1582-1588. Deutscher, J., Saier M. H. Ser/Thr/Tyr protein phosphorylation in bacteria - for long time neglected, now well established. J Mol Microbiol Biotechnol 2005, 9:125131. Di, A., Brown M. E., Deriy L. V., Li C., et al. CFTR regulates phagosome acidification in macrophages and alters bactericidal activity. Nat Cell Biol 2006, 8:933-944. Diggle, S.P., Stacey R. E., Dodd C., Cámara M., et al. The galactophilic lectin, 135 LecA, contributes to biofilm development in Pseudomonas aeruginosa. Environ Microbiol 2006, 8:1095-1104. Drenkard, E., Ausubel F. M. Pseudomonas biofilm formation and antibiotic resistance are linked to phenotypic variation. Nature 2002, 416:740-743. Durand, E., Bernadac A., Ball G., Lazdunski A., et al. Type II protein secretion in Pseudomonas aeruginosa: the pseudopilus is a multifibrillar and adhesive structure. J Bacteriol 2003, 185:2749-2758. Durand, E., Michel G., Voulhoux R., Kürner J., et al. XcpX controls biogenesis of the Pseudomonas aeruginosa XcpT-containing pseudopilus. J Biol Chem 2005, 280:31378-31389. Durocher, D., Taylor I. A., Sarbassova D., Haire L. F., et al. The molecular basis of FHA domain:phosphopeptide binding specificity and implications for phosphodependent signaling mechanisms. Mol Cell 2000, 6:1169-1182. Engel, L.S., Hill J. M., Caballero A. R., Green L. C., O'Callaghan R. J. Protease IV, a unique extracellular protease and virulence factor from Pseudomonas aeruginosa. J Biol Chem 1998, 273:16792-16797. Ernst, R.K., Yi E. C., Guo L., Lim K. B., et al. Specific lipopolysaccharide found in cystic fibrosis airway Pseudomonas aeruginosa. Science 1999, 286:1561-1565. Esen, M., Grassmé H., Riethmüller J., Riehle A., et al. Invasion of human epithelial cells by Pseudomonas aeruginosa involves src-like tyrosine kinases p60Src and p59Fyn. Infect Immun 2001, 69:281-287. Evans, D.J., Frank D. W., Finck-Barbançon V., Wu C., Fleiszig S. M. Pseudomonas aeruginosa invasion and cytotoxicity are independent events, both of which involve protein tyrosine kinase activity. Infect Immun 1998, 66:1453-1459. Evans, D.J., Kuo T. C., Kwong M., Van R., Fleiszig S. M. J. Mutation of csk, encoding the C-terminal Src kinase, reduces Pseudomonas aeruginosa internalization by mammalian cells and enhances bacterial cytotoxicity. Microb Pathog 2002, 33:135-143. Ferreira, R.B.R., Antunes L. C. M., Greenberg E. P., McCarter L. L. Vibrio parahaemolyticus ScrC modulates cyclic dimeric GMP regulation of gene expression relevant to growth on surfaces. J Bacteriol 2008, 190:851-860. Field, J., Nikawa J., Broek D., MacDonald B., et al. Purification of a RASresponsive adenylyl cyclase complex from Saccharomyces cerevisiae by use of an 136 epitope addition method. Mol Cell Biol 1988, 8:2159-2165. Filloux, A. The underlying mechanisms of type II protein secretion. Biochim Biophys Acta 2004, 1694:163-179. Filloux, A., Hachani A., Bleves S. The bacterial type VI secretion machine: yet another player for protein transport across membranes. Microbiology 2008, 154:1570-1583. Filloux, A., Michel G., Bally M. GSP-dependent protein secretion in gram-negative bacteria: the Xcp system of Pseudomonas aeruginosa. FEMS Microbiol Rev 1998, 22:177-198. Fleiszig, S.M., Wiener-Kronish J. P., Miyazaki H., Vallas V., et al. Pseudomonas aeruginosa-mediated cytotoxicity and invasion correlate with distinct genotypes at the loci encoding exoenzyme S. Infect Immun 1997, 65:579-586. Fleiszig, S.M.J., Evans D. J. Contact lens infections: can they ever be eradicated? Eye Contact Lens 2003, 29:S67-71; discussion S83. Folders, J., Tommassen J., van Loon L. C., Bitter W. Identification of a chitinbinding protein secreted by Pseudomonas aeruginosa. J Bacteriol 2000, 182:12571263. Galperin, M.Y. A census of membrane-bound and intracellular signal transduction proteins in bacteria: bacterial IQ, extroverts and introverts. BMC Microbiol 2005, 5:35. Gardy, J.L., Laird M. R., Chen F., Rey S., et al. PSORTb v.2.0: expanded prediction of bacterial protein subcellular localization and insights gained from comparative proteome analysis. Bioinformatics 2005, 21:617-623. Gérard-Vincent, M., Robert V., Ball G., Bleves S., et al. Identification of XcpP domains that confer functionality and specificity to the Pseudomonas aeruginosa type II secretion apparatus. Mol Microbiol 2002, 44:1651-1665. Gilboa-Garber, N., Sudakevitz D., Sheffi M., Sela R., Levene C. PA-I and PA-II lectin interactions with the ABO(H) and P blood group glycosphingolipid antigens may contribute to the broad spectrum adherence of Pseudomonas aeruginosa to human tissues in secondary infections. Glycoconj J 1994, 11:414-417. Gillis, R.J., White K. G., Choi K. H., Wagner V. E., et al. Molecular basis of azithromycin-resistant Pseudomonas aeruginosa biofilms. Antimicrob Agents Chemother 2005, 49:3858-3867. 137 Gomelsky, M. Cyclic-di-GMP-binding CRP-like protein: a spectacular new role for a veteran signal transduction actor. J Bacteriol 2009, 191:6785-6787. Goodier, R.I., Ahmer B. M. SirA orthologs affect both motility and virulence. J Bacteriol 2001, 183:2249-2258. Goodman, A.L., Kulasekara B., Rietsch A., Boyd D., et al. A signaling network reciprocally regulates genes associated with acute infection and chronic persistence in Pseudomonas aeruginosa. Dev Cell 2004, 7:745-754. Govan, J.R., Deretic V. Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol Rev 1996, 60:539574. Grande, K.K., Gustin J. K., Kessler E., Ohman D. E. Identification of critical residues in the propeptide of LasA protease of Pseudomonas aeruginosa involved in the formation of a stable mature protease. J Bacteriol 2007, 189:3960-3968. Grangeasse, C., Cozzone A. J., Deutscher J., Mijakovic I. Tyrosine phosphorylation: an emerging regulatory device of bacterial physiology. Trends Biochem Sci 2007, 32:86-94. Grassme, H., Jendrossek V., Riehle A., von Kurthy G., et al. Host defense against Pseudomonas aeruginosa requires ceramide-rich membrane rafts. Nat Med 2003, 9:322-330. Grassme, H., Kirschnek S., Riethmueller J., Riehle A., et al. CD95/CD95 ligand interactions on epithelial cells in host defense to Pseudomonas aeruginosa. Science 2000, 290:527-530. Gupta, S.K., Berk R. S., Masinick S., Hazlett L. D. Pili and lipopolysaccharide of Pseudomonas aeruginosa bind to the glycolipid asialo GM1. Infect Immun 1994, 62:4572-4579. Ha, U.H., Kim J., Badrane H., Jia J., et al. An in vivo inducible gene of Pseudomonas aeruginosa encodes an anti-ExsA to suppress the type III secretion system. Mol Microbiol 2004, 54:307-320. Hanna, S.L., Sherman N. E., Kinter M. T., Goldberg J. B. Comparison of proteins expressed by Pseudomonas aeruginosa strains representing initial and chronic isolates from a cystic fibrosis patient: an analysis by 2-D gel electrophoresis and capillary column liquid chromatography-tandem mass spectrometry. Microbiology 2000, 146 ( Pt 10):2495-2508. 138 Hauser, A.R., Engel J. N. Pseudomonas aeruginosa induces type-III-secretionmediated apoptosis of macrophages and epithelial cells. Infect Immun 1999, 67:5530-5537. Haussler, S., Tummler B., Weissbrodt H., Rohde M., Steinmetz I. Small-colony variants of Pseudomonas aeruginosa in cystic fibrosis. Clin Infect Dis 1999, 29:621625. Hazes, B., Sastry P. A., Hayakawa K., Read R. J., Irvin R. T. Crystal structure of Pseudomonas aeruginosa PAK pilin suggests a main-chain-dominated mode of receptor binding. J Mol Biol 2000, 299:1005-1017. Heale, J.P., Pollard A. J., Stokes R. W., Simpson D., et al. Two distinct receptors mediate nonopsonic phagocytosis of different strains of Pseudomonas aeruginosa. J Infect Dis 2001, 183:1214-1220. Heurlier, K., Dénervaud V., Haas D. Impact of quorum sensing on fitness of Pseudomonas aeruginosa. Int J Med Microbiol 2006, 296:93-102. Hickman, J.W., Harwood C. S. Identification of FleQ from Pseudomonas aeruginosa as a c-di-GMP-responsive transcription factor. Mol Microbiol 2008, 69:376-389. Hickman, J.W., Tifrea D. F., Harwood C. S. A chemosensory system that regulates biofilm formation through modulation of cyclic diguanylate levels. Proc Natl Acad Sci U S A 2005, 102:14422-14427. Hirakata, Y., Srikumar R., Poole K., Gotoh N., et al. Multidrug efflux systems play an important role in the invasiveness of Pseudomonas aeruginosa. J Exp Med 2002, 196:109-118. Hobbs, M., Collie E. S., Free P. D., Livingston S. P., Mattick J. S. PilS and PilR, a two-component transcriptional regulatory system controlling expression of type 4 fimbriae in Pseudomonas aeruginosa. Mol Microbiol 1993, 7:669-682. Høiby, N., Bjarnsholt T., Givskov M., Molin S., Ciofu O. Antibiotic resistance of bacterial biofilms. Int J Antimicrob Agents 2010, 35:322-332. Homma, M., DeRosier D. J., Macnab R. M. Flagellar hook and hook-associated proteins of Salmonella typhimurium and their relationship to other axial components of the flagellum. J Mol Biol 1990, 213:819-832. Hopp, T.P., Prickett K. S., Price V L, Libby R. T., et al. A short polypeptide marker sequence useful for recombinant protein identification and purification. 139 Biotechnology 1988, 6:1204-1210. Huang, B., Whitchurch C. B., Mattick J. S. FimX, a multidomain protein connecting environmental signals to twitching motility in Pseudomonas aeruginosa. J Bacteriol 2003, 185:7068-7076. Imundo, L., Barasch J., Prince A., Al-Awqati Q. Cystic fibrosis epithelial cells have a receptor for pathogenic bacteria on their apical surface. Proc Natl Acad Sci U S A 1995, 92:3019-3023. Isberg, R.R., Barnes P. Subversion of integrins by enteropathogenic Yersinia. J Cell Sci 2001, 114:21-28. Jansson, A.L., Yasmin L., Warne P., Downward J., et al. Exoenzyme S of Pseudomonas aeruginosa is not able to induce apoptosis when cells express activated proteins, such as Ras or protein kinase B/Akt. Cell Microbiol 2006, 8:815822. Jarrell, K.F. (Ed.) Pili and Flagella: Current research and future trends. 2009. Norfolk, UK: Caister Academic Press. Jenal, U. Cyclic di-guanosine-monophosphate comes of age: a novel secondary messenger involved in modulating cell surface structures in bacteria? Curr Opin Microbiol 2004, 7:185-191. Jenal, U., Malone J. Mechanisms of cyclic-di-GMP signaling in bacteria. Annu Rev Genet 2006, 40:385-407. Jensen, P.Ø., Bjarnsholt T., Phipps R., Rasmussen T. B., et al. Rapid necrotic killing of polymorphonuclear leukocytes is caused by quorum-sensing-controlled production of rhamnolipid by Pseudomonas aeruginosa. Microbiology 2007, 153:1329-1338. Jia, J., Wang Y., Zhou L., Jin S. Expression of Pseudomonas aeruginosa toxin ExoS effectively induces apoptosis in host cells. Infect Immun 2006, 74:6557-6570. Kader, A., Simm R., Gerstel U., Morr M., Römling U. Hierarchical involvement of various GGDEF domain proteins in rdar morphotype development of Salmonella enterica serovar Typhimurium. Mol Microbiol 2006, 60:602-616. Karatan, E., Watnick P. Signals, regulatory networks, and materials that build and break bacterial biofilms. Microbiol Mol Biol Rev 2009, 73:310-347. Kazmierczak, B.I., Lebron M. B., Murray T. S. Analysis of FimX, a phosphodiesterase that governs twitching motility in Pseudomonas aeruginosa. Mol 140 Microbiol 2006, 60:1026-1043. Kazmierczak, B.I., Mostov K., Engel J. N. Epithelial cell polarity alters RhoGTPase responses to Pseudomonas aeruginosa. Mol Biol Cell 2004, 15:411-419. Kelly-Wintenberg, K., South S. L., Montie T. C. Tyrosine phosphate in a- and btype flagellins of Pseudomonas aeruginosa. J Bacteriol 1993, 175:2458-2461. Kennelly, P.J. Protein kinases and protein phosphatases in prokaryotes: a genomic perspective. FEMS Microbiol Lett 2002, 206:1-8. King, E.O., Ward M. K., Raney D. E. Two simple media for the demonstration of pyocyanin and fluorescin. J Lab Clin Med 1954, 44:301-307. Kipnis, E., Sawa T., Wiener-Kronish J. Targeting mechanisms of Pseudomonas aeruginosa pathogenesis. Med Mal Infect 2006, 36:78-91. Kirillina, O., Fetherston J. D., Bobrov A. G., Abney J., Perry R. D. HmsP, a putative phosphodiesterase, and HmsT, a putative diguanylate cyclase, control Hmsdependent biofilm formation in Yersinia pestis. Mol Microbiol 2004, 54:75-88. Klein, G., Dartigalongue C., Raina S. Phosphorylation-mediated regulation of heat shock response in Escherichia coli. Mol Microbiol 2003, 48:269-285. Kondo, A., Hirakata Y., Gotoh N., Fukushima K., et al. Quorum sensing system lactones do not increase invasiveness of a MexAB-OprM efflux mutant but do play a partial role in Pseudomonas aeruginosa invasion. Microbiol Immunol 2006, 50:395401. Kong, F., Young L., Chen Y., Ran H., et al. Pseudomonas aeruginosa pyocyanin inactivates lung epithelial vacuolar ATPase-dependent cystic fibrosis transmembrane conductance regulator expression and localization. Cell Microbiol 2006, 8:11211133. Koo, J., Tammam S., Ku S. Y., Sampaleanu L. M., et al. PilF is an outer membrane lipoprotein required for multimerization and localization of the Pseudomonas aeruginosa Type IV pilus secretin. J Bacteriol 2008, 190:6961-6969. Kowalski, M.P., Pier G. B. Localization of cystic fibrosis transmembrane conductance regulator to lipid rafts of epithelial cells is required for Pseudomonas aeruginosa-induced cellular activation. J Immunol 2004, 172:418-425. Kuchma, S.L., Connolly J. P., O'Toole G. A. A three-component regulatory system regulates biofilm maturation and type III secretion in Pseudomonas aeruginosa. J 141 Bacteriol 2005, 187:1441-1454. Kulasakara, H., Lee V., Brencic A., Liberati N., et al. Analysis of Pseudomonas aeruginosa diguanylate cyclases and phosphodiesterases reveals a role for bis-(3'-5')cyclic-GMP in virulence. Proc Natl Acad Sci U S A 2006, 103:2839-2844. Kulasekara, H.D., Miller S. I. Threonine phosphorylation times bacterial secretion. Nat Cell Biol 2007, 9:734-736. Laskowski, M.A., Osborn E., Kazmierczak B. I. A novel sensor kinase-response regulator hybrid regulates type III secretion and is required for virulence in Pseudomonas aeruginosa. Mol Microbiol 2004, 54:1090-1103. Leduc, J.L., Roberts G. P. Cyclic di-GMP allosterically inhibits the CRP-like protein (Clp) of Xanthomonas axonopodis pv. citri. J Bacteriol 2009, 191:7121-7122. Lee, K.K., Sheth H. B., Wong W. Y., Sherburne R., et al. The binding of Pseudomonas aeruginosa pili to glycosphingolipids is a tip-associated event involving the C-terminal region of the structural pilin subunit. Mol Microbiol 1994, 11:705-713. Lestrate, P., Dricot A., Delrue R. M., Lambert C., et al. Attenuated signaturetagged mutagenesis mutants of Brucella melitensis identified during the acute phase of infection in mice. Infect Immun 2003, 71:7053-7060. Levi, A., Jenal U. Holdfast formation in motile swarmer cells optimizes surface attachment during Caulobacter crescentus development. J Bacteriol 2006, 188:53155318. Lévine, A., Vannier F., Absalon C., Kuhn L., et al. Analysis of the dynamic Bacillus subtilis Ser/Thr/Tyr phosphoproteome implicated in a wide variety of cellular processes. Proteomics 2006, 6:2157-2173. Macek, B., Gnad F., Soufi B., Kumar C., et al. Phosphoproteome analysis of E. coli reveals evolutionary conservation of bacterial Ser/Thr/Tyr phosphorylation. Mol Cell Proteomics 2008, 7:299-307. Macek, B., Mijakovic I., Olsen J. V., Gnad F., et al. The serine/threonine/tyrosine phosphoproteome of the model bacterium Bacillus subtilis. Mol Cell Proteomics 2007, 6:697-707. Martin, P.R., Watson A. A., McCaul T. F., Mattick J. S. Characterization of a five-gene cluster required for the biogenesis of type 4 fimbriae in Pseudomonas aeruginosa. Mol Microbiol 1995, 16:497-508. 142 Martínez, A., Ostrovsky P., Nunn D. N. Identification of an additional member of the secretin superfamily of proteins in Pseudomonas aeruginosa that is able to function in type II protein secretion. Mol Microbiol 1998, 28:1235-1246. Matsumoto, K. Role of bacterial proteases in pseudomonal and serratial keratitis. Biol Chem 2004, 385:1007-1016. Meissner, A., Wild V., Simm R., Rohde M., et al. Pseudomonas aeruginosa cupAencoded fimbriae expression is regulated by a GGDEF and EAL domain-dependent modulation of the intracellular level of cyclic diguanylate. Environ Microbiol 2007, 9:2475-2485. Melvin, L.H. Structural and functional characterization of Pseudomonas MorA. B.Sc., Honor's Thesis 2006, Meyer, J.M. Pyoverdines: pigments, siderophores and potential taxonomic markers of fluorescent Pseudomonas species. Arch Microbiol 2000, 174:135-142. Meyer, J.M., and Abdallah M. A. The fluorescent pigment of Pseudomonas fluorescens: biosynthesis, purification and physicochemical properties. J Gen Microbiol 1978, 107:319-328. Michel, G.P.F., Durand E., Filloux A. XphA/XqhA, a novel GspCD subunit for type II secretion in Pseudomonas aeruginosa. J Bacteriol 2007, 189:3776-3783. Mikkelsen, H., Bond N. J., Skindersoe M. E., Givskov M., et al. Biofilms and type III secretion are not mutually exclusive in Pseudomonas aeruginosa. Microbiology 2009, 155:687-698. Morand, P.C., Bille E., Morelle S., Eugène E., et al. Type IV pilus retraction in pathogenic Neisseria is regulated by the PilC proteins. EMBO J 2004, 23:2009-2017. Morihara, K., Tsuzuki H., Oka T., Inoue H., Ebata M. Pseudomonas aeruginosa elastase. Isolation, Crystallization, and preliminary characterization. J Biol Chem 1965, 240:3295-3304. Mossialos, D., Ochsner U., Baysse C., Chablain P., et al. Identification of new, conserved, non-ribosomal peptide synthetases from fluorescent pseudomonads involved in the biosynthesis of the siderophore pyoverdine. Mol Microbiol 2002, 45:1673-1685. Mougous, J.D., Gifford C. A., Ramsdell T. L., Mekalanos J. J. Threonine phosphorylation post-translationally regulates protein secretion in Pseudomonas aeruginosa. Nat Cell Biol 2007, 9:797-803. 143 Novakova, L., Saskova L., Pallova P., Janecek J. Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates. FEBS Journal 2005, 2005:12431254. Obritsch, M.D., Fish D. N., MacLaren R., Jung R. Nosocomial infections due to multidrug-resistant Pseudomonas aeruginosa: epidemiology and treatment options. Pharmacotherapy 2005, 25:1353-1364. Pallen, M.J., Wren B. W. Bacterial pathogenomics. Nature 2007, 449:835-842. Palma, M., Zurita J., Ferreras J. A., Worgall S., et al. Pseudomonas aeruginosa SoxR does not conform to the archetypal paradigm for SoxR-dependent regulation of the bacterial oxidative stress adaptive response. Infect Immun 2005, 73:2958-2966. Pavlovskis, O.R., Iglewski B. H., Pollack M. Mechanism of action of Pseudomonas aeruginosa exotoxin A in experimental mouse infections: adenosine diphosphate ribosylation of elongation factor 2. Infect Immun 1978, 19:29-33. Peabody, C.R., Chung Y. J., Yen M. R., Vidal-Ingigliardi D., et al. Type II protein secretion and its relationship to bacterial type IV pili and archaeal flagella. Microbiology 2003, 149:3051-3072. Pendrak, M.L., Perry R. D. Proteins essential for expression of the Hms+ phenotype of Yersinia pestis. Mol Microbiol 1993, 8:857-864. Pereira S. S. F., Goss L., Dworkin J. Eukaryote-Like Serine/Threonine Kinases and Phosphatases in Bacteria. Microbiol and Mol Biol Rev 2011, 75: 192-212. Pier, G. Pseudomonas aeruginosa: a key problem in cystic fibrosis. ASM News 1998, 64:339-347. Pier, G.B. Role of the cystic fibrosis transmembrane conductance regulator in innate immunity to Pseudomonas aeruginosa infections. Proc Natl Acad Sci U S A 2000, 97:8822-8828. Pier, G.B., Grout M., Zaidi T. S. Cystic fibrosis transmembrane conductance regulator is an epithelial cell receptor for clearance of Pseudomonas aeruginosa from the lung. Proc Natl Acad Sci U S A 1997, 94:12088-12093. Plotkowski, M.C., de Bentzmann S., Pereira S. H., Zahm J. M., et al. Pseudomonas aeruginosa internalization by human epithelial respiratory cells depends on cell differentiation, polarity, and junctional complex integrity. Am J Respir Cell Mol Biol 1999, 20:880-890. 144 Ponting, C.P., Aravind L., Schultz J., Bork P., Koonin E. V. Eukaryotic signalling domain homologues in archaea and bacteria. Ancient ancestry and horizontal gene transfer. J Mol Biol 1999, 289:729-745. Postma, P.W., Lengeler J. W., Jacobson G. R. Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol Rev 1993, 57:543-594. Pratt, J.T., Tamayo R., Tischler A. D., Camilli A. PilZ domain proteins bind cyclic diguanylate and regulate diverse processes in Vibrio cholerae. J Biol Chem 2007, 282:12860-12870. Prüss, B.M., Wolfe A. J. Regulation of acetyl phosphate synthesis and degradation, and the control of flagellar expression in Escherichia coli. Mol Microbiol 1994, 12:973-984. Ramos, J.L. (Ed.) Pseudomonas: Virulence and gene regulation (Volume 2). 2004. Springer. Ramos, J.L., Filloux, A. (Eds.) Pseudomonas: A model system in biology (Volume 5). 2007. Springer. Ramphal, R., Carnoy C., Fievre S., Michalski J. C., et al. Pseudomonas aeruginosa recognizes carbohydrate chains containing type 1 (Gal beta 1-3GlcNAc) or type 2 (Gal beta 1-4GlcNAc) disaccharide units. Infect Immun 1991, 59:700-704. Ramphal, R., Koo L., Ishimoto K. S., Totten P. A., et al. Adhesion of Pseudomonas aeruginosa pilin-deficient mutants to mucin. Infect Immun 1991, 59:1307-1311. Rey, S., Acab M., Gardy J. L., Laird M. R., et al. PSORTdb: a protein subcellular localization database for bacteria. Nucleic Acids Res 2005, 33:D164-D168. Robert, V., Filloux A., Michel G. P. F. Role of XcpP in the functionality of the Pseudomonas aeruginosa secreton. Res Microbiol 2005, 156:880-886. Robert, V., Filloux A., Michel G. P. F. Subcomplexes from the Xcp secretion system of Pseudomonas aeruginosa. FEMS Microbiol Lett 2005, 252:43-50. Roger, P., Puchelle E., Bajolet-Laudinat O., Tournier J. M., et al. Fibronectin and alpha5beta1 integrin mediate binding of Pseudomonas aeruginosa to repairing airway epithelium. Eur Respir J 1999, 13:1301-1309. Romling U, Simm R. Prevailing Concepts of c-di-GMP Signaling. In: Collin, Mattias; Schuch, Raymond, editor. Bacterial sensing and signaling. S Karger Pub; 145 2009. 16p. 230. Römling, U., Gomelsky M., Galperin M. Y. C-di-GMP: the dawning of a novel bacterial signalling system. Mol Microbiol 2005, 57:629-639. Ross, P., Weinhouse H., Aloni Y., Michaeli D., et al. Regulation of cellulose synthesis in Acetobacter xylinum by cyclic diguanylic acid. Nature 1987, 325:279281. Rostand, K.S., Esko J. D. Cholesterol and cholesterol esters: host receptors for Pseudomonas aeruginosa adherence. J Biol Chem 1993, 268:24053-24059. Roy-Burman, A., Savel R. H., Racine S., Swanson B. L., et al. Type III protein secretion is associated with death in lower respiratory and systemic Pseudomonas aeruginosa infections. J Infect Dis 2001, 183:1767-1774. Ryan, R.P., Fouhy Y., Lucey J. F., Dow J. M. Cyclic di-GMP signaling in bacteria: recent advances and new puzzles. J Bacteriol 2006, 188:8327-8334. Ryjenkov, D.A., Tarutina M., Moskvin O. V., Gomelsky M. Cyclic diguanylate is a ubiquitous signaling molecule in bacteria: insights into biochemistry of the GGDEF protein domain. J Bacteriol 2005, 187:1792-1798. Sadikot, R.T., Blackwell T. S., Christman J. W., Prince A. S. Pathogen-host interactions in Pseudomonas aeruginosa pneumonia. Am J Respir Crit Care Med 2005, 171:1209-1223. Saiman, L., Prince A. Pseudomonas aeruginosa pili bind to asialoGM1 which is increased on the surface of cystic fibrosis epithelial cells. J Clin Invest 1993, 92:1875-1880. Sansonetti, P.J., Phalipon A. M cells as ports of entry for enteroinvasive pathogens: mechanisms of interaction, consequences for the disease process. Semin Immunol 1999, 11:193-203. Sato, H., Feix J. B., Hillard C. J., Frank D. W. Characterization of phospholipase activity of the Pseudomonas aeruginosa type III cytotoxin, ExoU. J Bacteriol 2005, 187:1192-1195. Scharfman, A., Arora S. K., Delmotte P., Van Brussel E., et al. Recognition of Lewis x derivatives present on mucins by flagellar components of Pseudomonas aeruginosa. Infect Immun 2001, 69:5243-5248. Schirm, M., Arora S. K., Verma A., Vinogradov E., et al. Structural and genetic characterization of glycosylation of type a flagellin in Pseudomonas aeruginosa. J 146 Bacteriol 2004, 186:2523-2531. Senf, F., Tommassen J., Koster M. Polar secretion of proteins via the Xcp type II secretion system in Pseudomonas aeruginosa. Microbiology 2008, 154:3025-3032. Sheth, H.B., Lee K. K., Wong W. Y., Srivastava G., et al. The pili of Pseudomonas aeruginosa strains PAK and PAO bind specifically to the carbohydrate sequence beta GalNAc(1-4)beta Gal found in glycosphingolipids asialo-GM1 and asialo-GM2. Mol Microbiol 1994, 11:715-723. Simm, R., Morr M., Kader A., Nimtz M., Römling U. GGDEF and EAL domains inversely regulate cyclic di-GMP levels and transition from sessility to motility. Mol Microbiol 2004, 53:1123-1134. Simpson, D.A., Ramphal R., Lory S. Genetic analysis of Pseudomonas aeruginosa adherence: distinct genetic loci control attachment to epithelial cells and mucins. Infect Immun 1992, 60:3771-3779. Singh, P.K., Schaefer A. L., Parsek M. R., Moninger T. O., et al. Quorum-sensing signals indicate that cystic fibrosis lungs are infected with bacterial biofilms. Nature 2000, 407:762-764. Skerker, J.M., Berg H. C. Direct observation of extension and retraction of type IV pili. Proc Natl Acad Sci U S A 2001, 98:6901-6904. Smith, R.S., Iglewski B. H. P. aeruginosa quorum-sensing systems and virulence. Curr Opin Microbiol 2003, 6:56-60. Sonawane, A., Jyot J., Ramphal R. Pseudomonas aeruginosa LecB is involved in pilus biogenesis and protease IV activity but not in adhesion to respiratory mucins. Infect Immun 2006, 74:7035-7039. Soong, G., Reddy B., Sokol S., Adamo R., Prince A. TLR2 is mobilized into an apical lipid raft receptor complex to signal infection in airway epithelial cells. J Clin Invest 2004, 113:1482-1489. Soscia, C., Hachani A., Bernadac A., Filloux A., Bleves S. Cross talk between type III secretion and flagellar assembly systems in Pseudomonas aeruginosa. J Bacteriol 2007, 189:3124-3132. Soufi, B., Gnad F., Jensen P. R., Petranovic D., et al. The Ser/Thr/Tyr phosphoproteome of Lactococcus lactis IL1403 reveals multiply phosphorylated proteins. Proteomics 2008, 8:3486-3493. Stover, C.K., Pham X. Q., Erwin A. L., Mizoguchi S. D., et al. Complete genome 147 sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 2000, 406:959-964. Sudarsan, N., Lee E. R., Weinberg Z., Moy R. H., et al. Riboswitches in eubacteria sense the second messenger cyclic di-GMP. Science 2008, 321:411-413. Sugiyama, N., Masuda T., Shinoda K., Nakamura A., et al. Phosphopeptide enrichment by aliphatic hydroxy acid-modified metal oxide chromatography for nano-LC-MS/MS in proteomics applications. Mol Cell Proteomics 2007, 6:11031109. Sugiyama, N., Nakagami H., Mochida K., Daudi A., et al. Large-scale phosphorylation mapping reveals the extent of tyrosine phosphorylation in Arabidopsis. Mol Syst Biol 2008, 4:193. Sun, X., Ge F., Xiao C. L., Yin X. F., et al. Phosphoproteomic analysis reveals the multiple roles of phosphorylation in pathogenic bacterium Streptococcus pneumoniae. J Proteome Res 2010, 9:275-282. Tamayo, R., Pratt J. T., Camilli A. Roles of cyclic diguanylate in the regulation of bacterial pathogenesis. Annu Rev Microbiol 2007, 61:131-148. Tao, F., He Y. W., Wu D. H., Swarup S., Zhang L. H. The cyclic nucleotide monophosphate domain of Xanthomonas campestris global regulator Clp defines a new class of cyclic di-GMP effectors. J Bacteriol 2010, 192:1020-1029. Tielker, D., Hacker S., Loris R., Strathmann M., et al. Pseudomonas aeruginosa lectin LecB is located in the outer membrane and is involved in biofilm formation. Microbiology 2005, 151:1313-1323. Tischler, A.D., Camilli A. Cyclic diguanylate (c-di-GMP) regulates Vibrio cholerae biofilm formation. Mol Microbiol 2004, 53:857-869. Toole, C.M., Plank T. L., Grossman A. R., Anderson L. K. Bilin deletions and subunit stability in cyanobacterial light-harvesting proteins. Mol Microbiol 1998, 30:475-486. Touhami, A., Jericho M. H., Boyd J. M., Beveridge T. J. Nanoscale characterization and determination of adhesion forces of Pseudomonas aeruginosa pili by using atomic force microscopy. J Bacteriol 2006, 188:370-377. Traidej, M., Caballero A. R., Marquart M. E., Thibodeaux B. A., O'Callaghan R. J. Molecular analysis of Pseudomonas aeruginosa protease IV expressed in Pseudomonas putida. Invest Ophthalmol Vis Sci 2003, 44:190-196. 148 Tseng, T.T., Tyler B. M., Setubal J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol 2009, 9 Suppl 1:S2. van Delden C. Virulence factors in Pseudomonas aeruginosa. In: Ramos, J, editor. Pseudomonas. 2004. p. 3-45. van Schaik, E.J., Giltner C. L., Audette G. F., Keizer D. W., et al. DNA binding: a novel function of Pseudomonas aeruginosa type IV pili. J Bacteriol 2005, 187:1455-1464. Vanhaesebroeck, B., Alessi D. The PI3K-PDK1 connection: more than just a road to PKB. Biochem J 346 Pt 2000, 3:561-576. Vasil, M.L., Ochsner U. A. The response of Pseudomonas aeruginosa to iron: genetics, biochemistry and virulence. Mol Microbiol 1999, 34:399-413. Vegh, B., Gal P., Dobo J., Zavodszky P., Vonderviszt F. Localization of the flagellum-specific secretion signal in Salmonella flagellin Åô. Biochem Biophys Res Commun 2006, 345:93-98. Ventre, I., Goodman A. L., Vallet-Gely I., Vasseur P., et al. Multiple sensors control reciprocal expression of Pseudomonas aeruginosa regulatory RNA and virulence genes. Proc Natl Acad Sci U S A 2006, 103:171-176. Venturi, V. Regulation of quorum sensing in Pseudomonas. FEMS Microbiol Rev 2006, 30:274-291. Verma, A., Arora S. K., Kuravi S. K., Ramphal R. Roles of specific amino acids in the N terminus of Pseudomonas aeruginosa flagellin and of flagellin glycosylation in the innate immune response. Infect Immun 2005, 73:8237-8246. Verma, A., Schirm M., Arora S. K., Thibault P., et al. Glycosylation of b-Type flagellin of Pseudomonas aeruginosa: structural and genetic basis. J Bacteriol 2006, 188:4395-4403. Weber, H., Pesavento C., Possling A., Tischendorf G., Hengge R. Cyclic-diGMP-mediated signalling within the sigma network of Escherichia coli. Mol Microbiol 2006, 62:1014-1034. Whitchurch, C.B., Alm R. A., Mattick J. S. The alginate regulator AlgR and an associated sensor FimS are required for twitching motility in Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 1996, 93:9839-9843. Whitchurch, C.B., Leech A. J., Young M. D., Kennedy D., et al. Characterization 149 of a complex chemosensory signal transduction system which controls twitching motility in Pseudomonas aeruginosa. Mol Microbiol 2004, 52:873-893. Whiteley, M., Bangera M. G., Bumgarner R. E., Parsek M. R., et al. Gene expression in Pseudomonas aeruginosa biofilms. Nature 2001, 413:860-864. Wilderman, P.J., Vasil A. I., Johnson Z., Wilson M. J., et al. Characterization of an endoprotease (PrpL) encoded by a PvdS-regulated gene in Pseudomonas aeruginosa. Infect Immun 2001, 69:5385-5394. Winsor, G.L., Van Rossum T., Lo R., Khaira B., et al. Pseudomonas Genome Database: facilitating user-friendly, comprehensive comparisons of microbial genomes. Nucleic Acids Res 2009, 37:D483-D488. Winther-Larsen, H.C., Wolfgang M., Dunham S., van Putten J. P. M., et al. A conserved set of pilin-like molecules controls type IV pilus dynamics and organelleassociated functions in Neisseria gonorrhoeae. Mol Microbiol 2005, 56:903-917. Winzer, K., Falconer C., Garber N. C., Diggle S. P., et al. The Pseudomonas aeruginosa lectins PA-IL and PA-IIL are controlled by quorum sensing and by RpoS. J Bacteriol 2000, 182:6401-6411. Wolfe, A.J. The acetate switch. Microbiol Mol Biol Rev 2005, 69:12-50. Wolfe, A.J., Chang D. E., Walker J. D., Seitz-Partridge J. E., et al. Evidence that acetyl phosphate functions as a global signal during biofilm development. Mol Microbiol 2003, 48:977-988. Wolfe, A.J., Visick K. L. Get the message out: cyclic-Di-GMP regulates multiple levels of flagellum-based motility. J Bacteriol 2008, 190:463-475. Wolfgang, M., van Putten J. P., Hayes S. F., Dorward D., Koomey M. Components and dynamics of fiber formation define a ubiquitous biogenesis pathway for bacterial pili. EMBO J 2000, 19:6408-6418. Woods, D.E., Straus D. C., Johanson W. G., Berry V. K., Bass J. A. Role of pili in adherence of Pseudomonas aeruginosa to mammalian buccal epithelial cells. Infect Immun 1980, 29:1146-1151. Wooldridge, K. (Ed.) Bacterial Secreted Proteins: Secretory mechanisms and role in pathogenesis. 2009. Norfolk, UK: Caister Academic Press. Wu, J., Ohta N., Zhao J. L., Newton A. A novel bacterial tyrosine kinase essential for cell division and differentiation. Proc Natl Acad Sci U S A 1999, 96:13068- 150 13073. Wu, W., Jin S. PtrB of Pseudomonas aeruginosa suppresses the type III secretion system under the stress of DNA damage. J Bacteriol 2005, 187:6058-6068. Wurgler-Murphy, S.M., King D. M., Kennelly P. J. The Phosphorylation Site Database: A guide to the serine-, threonine-, and/or tyrosine-phosphorylated proteins in prokaryotic organisms. Proteomics 2004, 4:1562-1570. Yonekura, K., Maki-Yonekura S., Namba K. Complete atomic model of the bacterial flagellar filament by electron cryomicroscopy. Nature 2003, 424:643-650. Zaborina, O., Kohler J. E., Wang Y., Bethel C., et al. Identification of multi-drug resistant Pseudomonas aeruginosa clinical isolates that are highly disruptive to the intestinal epithelial barrier. Ann Clin Microbiol Antimicrob 2006, 5:14. Zaidi, T., Mowrey-McKee M., Pier G. B. Hypoxia increases corneal cell expression of CFTR leading to increased Pseudomonas aeruginosa binding, internalization, and initiation of inflammation. Invest Ophthalmol Vis Sci 2004, 45:4066-4074. Zierdt, C.H., Schmidt P. J. Dissociation in Pseudomonas aeruginosa. J Bacteriol 1964, 87:1003-1010. 151 APPENDICES Appendix I Supplementary information on gene cloning done in this study a. Sequences of the T2SS proteases) for protein expression to be used as antigen for raising protease-specific antibody. Regions cloned into pETM vector are underlined and the respective primers used for amplification from genomic DNA are highlighted. > CbpD ATGAAACACTACTCAGCCACCCTGGCACTCCTGCCACTCACCCTCGCCCTGTTCCTGCCCCAGGCAGCCCATGCCCACGGCTCGATGGAAACGCC GCCCAGTCGGGTCTACGGCTGCTTCCTCGAAGGTCCGGAGAATCCCAAGTCGGCCGCCTGCAAGGCCGCCGTCGCCGCCGGCGGCACCCAGGCAC TGTACGACTGGAATGGCGTCAACCAGGGCAACGCCAACGGCAACCACCAGGCGGTGGTCCCCGACGGCCAGCTCTGCGGCGCCGGCAAGGCACTG TTCAAGGGCCTGAACCTGGCTCGCAGCGACTGGCCCAGCACTGCCATCGCGCCGGACGCCAGCGGCAACTTCCAGTTCGTCTACAAGGCCAGCGC GCCGCACGCGACCCGCTACTTCGACTTCTACATCACCAAGGACGGCTATAACCCCGAGAAGCCGCTGGCCTGGAGCGACCTGGAACCCGCGCCGT TCTGCTCGATCACCAGCGTCAAGCTGGAGAACGGCACCTACCGGATGAACTGCCCGCTGCCCCAGGGCAAGACCGGCAAGCATGTGATCTATAAC GTCTGGCAGCGCTCGGACAGCCCGGAAGCCTTCTACGCCTGCATCGACGTGAGCTTCAGCGGCGCCGTCGCCAACCCCTGGCAAGCGCTGGGCAA CCTGCGCGCGCAGCAGGACCTGCCAGCCGGTGCTACCGTCACCCTGCGTCTGTTCGATGCCCAGGGCCGCGACGCCCAGCGTCACAGCCTGACCC TGGCCCAGGGCGCCAACGGTGCCAAGCAATGGCCGCTGGCGCTGGCGCAGAAGGTCAACCAGGACTCCACCCTGGTCAACATCGGCGTGCTGGAT GCCTACGGGGCGGTCAGCCCGGTGGCCAGCTCGCAGGACAACCAGGTCTACGTGCGCCAGGCCGGCTACCGCTTCCAGGTCGACATCGAACTGCC GGTCGAGGGCGGCGGCGAGCAACCGGGCGGCGACGGCAAGGTCGACTTCGACTATCCGCAAGGCCTGCAGCAATACGACGCCGGGACCGTAGTGC GCGGTGCCGATGGCAAGCGCTACCAGTGCAAGCCCTACCCGAACTCCGGCTGGTGCAAGGGCTGGGACCTCTACTACGCCCCGGGCAAGGGCATG GCCTGGCAGGACGCCTGGACCCTGCTGTAA >PrpL ATGCATAAGAGAACGTACCTGAATGCATGCCTGGTTCTGGCGTTGGCTGCCGGCGCGAGCCAGGCCTTGGCGGCGCCCGGTGCGAGCGAAATGGC TGGCGACGTCGCCGTGCTCCAGGCCTCTCCGGCGAGCACCGGTCACGCCCGCTTCGCCAACCCCAACGCGGCGATCTCGGCGGCCGGCATCCACT TCGCCGCGCCCCCCGCCCGCCGCGTGGCCCGCGCCGCGCCGCTGGCGCCGAAACCGGGTACGCCGCTGCAAGTGGGCGTGGGCCTGAAAACGGCG ACTCCGGAAATCGACCTGACAACCCTCGAATGGATCGACACTCCGGACGGGCGCCACACCGCGCGCTTCCCGATCAGCGCTGCGGGGGCCGCCAG CCTGCGCGCCGCGATTCGCCTGGAAACCCACAGCGGCTCGCTGCCCGACGACGTGCTGCTGCACTTCGCCGGCGCCGGCAAGGAAATCTTCGAGG CCAGCGGCAAGGACCTCTCGGTCAACCGTCCCTACTGGAGCCCGGTCATCGAGGGCGATACCCTGACCGTCGAACTGGTGCTGCCGGCCAACCTG CAACCGGGCGACCTGCGCCTGTCGGTACCCCAGGTATCGTATTTCGCCGACTCCCTGTACAAGGCCGGCTACCGCGACGGCTTCGGCGCCAGCGG CAGCTGCGAGGTGGATGCGGTCTGCGCGACCCAGAGCGGCACACGGGCCTACGACAACGCCACCGCAGCGGTGGCGAAGATGGTCTTCACCAGCT CGGCGGACGGCGGCAGCTACATCTGCACCGGCACCCTGCTGAACAACGGCAACTCGCCCAAGCGCCAGTTGTTCTGGTCGGCCGCGCACTGCATC GAGGACCAGGCCACCGCCGCGACGCTGCAGACCATCTGGTTCTACAACACCACCCAGTGCTACGGCGACGCCTCGACCATCAACCAGAGCGTCAC CGTGCTGACCGGCGGGGCGAATATCCTGCACCGCGACGCGAAGCGCGACACCCTGCTGCTGGAACTCAAGCGCACTCCGCCGGCCGGCGTGTTCT ACCAGGGCTGGAGCGCCACGCCGATCGCCAACGGCTCGCTCGGCCATGACATCCACCATCCGCGCGGCGACGCCAAGAAGTACTCGCAGGGCAAC GTCTCGGCAGTGGGCGTCACCTACGACGGGCATACCGCCCTGACCCGCGTCGACTGGCCGTCGGCGGTGGTCGAAGGCGGCTCGTCCGGCTCGGG CCTGCTGACCGTCGCCGGCGACGGCTCCTACCAGCTGCGCGGTGGCCTGTACGGCGGCCCCTCGTACTGCGGCGCGCCCACCTCACAGCGCAATG ACTACTTCTCCGATTTCAGCGGCGTCTATTCGCAGATCTCCCGCTACTTCGCGCCCTGA >LasB ATGAAGAAGGTTTCTACGCTTGACCTGTTGTTCGTTGCGATCATGGGTGTTTCGCCGGCCGCTTTTGCCGCCGACCTGATCGACGTGTCCAAACT CCCCAGCAAGGCTGCCCAGGGCGCGCCCGGCCCGGTCACCTTGCAAGCCGCGGTCGGCGCTGGCGGTGCCGACGAACTGAAAGCGATCCGCAGCA CGACCCTGCCCAACGGCAAGCAGGTCACCCGCTACGAGCAATTCCACAACGGCGTACGGGTGGTCGGCGAAGCCATCACCGAAGTCAAGGGTCCC GGCAAGAGCGTGGCGGCGCAGCGCAGCGGCCATTTCGTCGCCAACATCGCTGCCGACCTGCCGGGCAGCACCACCGCGGCGGTATCCGCCGAGCA GGTGCTGGCCCAGGCCAAGAGCCTGAAGGCCCAGGGCCGCAAGACCGAGAATGACAAAGTGGAACTGGTGATCCGCCTGGGCGAGAACAACATCG CCCAACTGGTCTACAACGTCTCCTACCTGATTCCCGGCGAGGGACTGTCGCGGCCGCATTTCGTCATCGACGCCAAGACCGGCGAAGTGCTCGAT CAGTGGGAAGGCCTGGCCCACGCCGAGGCGGGCGGCCCCGGCGGCAACCAGAAGATCGGCAAGTACACCTACGGTAGCGACTACGGTCCGCTGAT CGTCAACGACCGCTGCGAGATGGACGACGGCAACGTCATCACCGTCGACATGAACAGCAGCACCGACGACAGCAAGACCACGCCGTTCCGCTTCG CCTGCCCGACCAACACCTACAAGCAGGTCAACGGCGCCTATTCGCCGCTGAACGACGCGCATTTCTTCGGCGGCGTGGTGTTCAAACTGTACCGG GACTGGTTCGGCACCAGCCCGCTGACCCACAAGCTGTACATGAAGGTGCACTACGGGCGCAGCGTGGAGAACGCCTACTGGGACGGCACGGCGAT GCTCTTCGGCGACGGCGCCACCATGTTCTATCCGCTGGTGTCGCTGGACGTGGCGGCCCACGAGGTCAGCCACGGCTTCACCGAGCAGAACTCCG GGCTGATCTACCGCGGGCAATCAGGCGGAATGAACGAAGCGTTCTCCGACATGGCCGGCGAGGCTGCCGAGTTCTATATGCGCGGCAAGAACGAC 152 TTCCTGATCGGCTACGACATCAAGAAGGGCAGCGGTGCGCTGCGCTACATGGACCAGCCCAGCCGCGACGGGCGATCCATCGACAACGCGTCGCA GTACTACAACGGCATCGACGTGCACCACTCCAGCGGCGTGTACAACCGTGCGTTCTACCTGTTGGCCAATTCGCCGGGCTGGGATACCCGCAAGG CCTTCGAGGTGTTCGTCGACGCCAACCGCTACTACTGGACCGCCACCAGCAACTACAACAGCGGCGCCTGCGGGGTGATTCGCTCGGCGCAGAAC CGCAACTACTCGGCGGCTGACGTCACCCGGGCGTTCAGCACCGTCGGCGTGACCTGCCCGAGCGCGTTGTAA b. Verification of cloning peptide tag sequence to elastase (LasB) gene for immunoblot analysis for quantification of secreted levels. Tags inserted are highlighted in grey. >LasB-FLAG sequenced LasB -----------------------------------------------------------ATGAAGAAGGTTTCTACGCTTGACCTGTTGTTCGTTGCGATCATGGGTGTTTCGCCGGCC 60 sequenced LasB -----------------------------------------------------------GCTTTTGCCGCCGACCTGATCGACGTGTCCAAACTCCCCAGCAAGGCTGCCCAGGGCGCG 120 sequenced LasB -----------------------------------------------------------CCCGGCCCGGTCACCTTGCAAGCCGCGGTCGGCGCTGGCGGTGCCGACGAACTGAAAGCG 180 sequenced LasB -----------------------------------------------------------ATCCGCAGCACGACCCTGCCCAACGGCAAGCAGGTCACCCGCTACGAGCAATTCCACAAC 240 sequenced LasB -----------------------------------------------------------GGCGTACGGGTGGTCGGCGAAGCCATCACCGAAGTCAAGGGTCCCGGCAAGAGCGTGGCG 300 sequenced LasB -----------------------------------------------------------GCGCAGCGCAGCGGCCATTTCGTCGCCAACATCGCTGCCGACCTGCCGGGCAGCACCACC 360 sequenced LasB -----------------------------------------------------------GCGGCGGTATCCGCCGAGCAGGTGCTGGCCCAGGCCAAGAGCCTGAAGGCCCAGGGCCGC 420 sequenced LasB -----------------------------------------------------------AAGACCGAGAATGACAAAGTGGAACTGGTGATCCGCCTGGGCGAGAACAACATCGCCCAA 480 sequenced LasB -----------------------------------------------------------CTGGTCTACAACGTCTCCTACCTGATTCCCGGCGAGGGACTGTCGCGGCCGCATTTCGTC 540 sequenced LasB -----------------------------------------------------------ATCGACGCCAAGACCGGCGAAGTGCTCGATCAGTGGGAAGGCCTGGCCCACGCCGAGGCG 600 sequenced LasB -----------------------------------------------------------GGCGGCCCCGGCGGCAACCAGAAGATCGGCAAGTACACCTACGGTAGCGACTACGGTCCG 660 sequenced LasB -----------------------------------------------------------CTGATCGTCAACGACCGCTGCGAGATGGACGACGGCAACGTCATCACCGTCGACATGAAC 720 sequenced LasB -----------------------------------------------------------AGCAGCACCGACGACAGCAAGACCACGCCGTTCCGCTTCGCCTGCCCGACCAACACCTAC 780 sequenced LasB -----------------------------------------------------------AAGCAGGTCAACGGCGCCTATTCGCCGCTGAACGACGCGCATTTCTTCGGCGGCGTGGTG 840 sequenced LasB -----------------------------------------------------------TTCAAACTGTACCGGGACTGGTTCGGCACCAGCCCGCTGACCCACAAGCTGTACATGAAG 900 sequenced LasB -----------------------------------------------------------GTGCACTACGGGCGCAGCGTGGAGAACGCCTACTGGGACGGCACGGCGATGCTCTTCGGC 960 sequenced ------ACGATCTGAGAGCGTTCCCTATTCCCGCTGGTCGCTG-ACTGCGTAGAGTCAGC 53 153 LasB GACGGCGCCACCATGTTCTATCCGCTGGTGTCGCTGGACGTGGCGGCCCACGAGGTCAGC 1020 * * * * * ** * ****** ** * * ****** sequenced LasB -ACCGCTTCACCGAGCAGA--CCCGGGCTGATCTAC-GCGG-CAATCAGGCG--ATGAAC 106 CACGGCTTCACCGAGCAGAACTCCGGGCTGATCTACCGCGGGCAATCAGGCGGAATGAAC 1080 ** *************** ************** **** ********** ****** sequenced LasB GAAAGCGTTTTCCGACATGCC--GCGAGCTGCCCGAGTTCTATAATGCGCGGCAAGAACG 164 GAA-GCGTTCTCCGACATGGCCGGCGAGGCTGCCGAGTTCTATA-TGCGCGGCAAGAACG 1138 *** ***** ********* * ***** ************ *************** sequenced LasB ACCTCCTGATCGGCTACGACATCAAGAAGGGCAGCGGTGCGCTGCGCTACATGGACCAGC 224 ACTTCCTGATCGGCTACGACATCAAGAAGGGCAGCGGTGCGCTGCGCTACATGGACCAGC 1198 ** ********************************************************* sequenced LasB CCAGCCGCGACGGGCGATCCATCGACAACGCGTCGCAGTACTACAACGGCATCGACGTGC 284 CCAGCCGCGACGGGCGATCCATCGACAACGCGTCGCAGTACTACAACGGCATCGACGTGC 1258 ************************************************************ sequenced LasB ACCACTCCAGCGGCGTGTACAACCGTGCGTTCTACCTGTTGGCCAATTCGCCGGGCTGGG 344 ACCACTCCAGCGGCGTGTACAACCGTGCGTTCTACCTGTTGGCCAATTCGCCGGGCTGGG 1318 ************************************************************ sequenced LasB ATACCCGCAAGGCCTTCGAGGTGTTTGTCGACGCCAACCGCTACTACTGGACCGCCACCA 404 ATACCCGCAAGGCCTTCGAGGTGTTCGTCGACGCCAACCGCTACTACTGGACCGCCACCA 1378 ************************* ********************************** sequenced LasB GCAACTACAACAGCGGCGCCTGCGGGGTGATTCGCTCGGCGCAGAACCGCAACTACTCGG 464 GCAACTACAACAGCGGCGCCTGCGGGGTGATTCGCTCGGCGCAGAACCGCAACTACTCGG 1438 ************************************************************ sequenced LasB CGGCTGACGTCACCCGGGCGTTCAGCACCGTCGGCGTGACCTGCCCGAGCGCGTTGATGG 524 CGGCTGACGTCACCCGGGCGTTCAGCACCGTCGGCGTGACCTGCCCGAGCGCGTTGATGG 1498 ************************************************************ sequenced LasB ACTACAAGGACGACGATGATAAGGGCTAAGCTCGGTGGTCCCGGCCGGCACTCCAGGAAG 584 ACTACAAGGACGACGATGATAAGGGCTAAGCTCGGTGGTCCCGGCCGGCACTCCAGGAAG 1558 ************************************************************ sequenced LasB GAATGCCGGTCGGGGTCGCTCAAGCCGTCTTCCGCCAGGAGGGCGGCTGCTTTATGTCGC 644 GAATGCCGGTCGGGGTCGCTCAAGCCGTCTTCCGCCAGGAGGGCGGCTGCTTTATGTCGC 1618 ************************************************************ sequenced LasB TTGGGCCGTTGGCCTCCGCGAACCCGGTCTAAAGTTCAGGTGTGAGCACTTATTCCAAGA 704 TTGGGCCGTTGGCCTCCGCGAACCCGGTCTAAAGTTCAGGTGTGAGCACTTATTCCAAGA 1678 ************************************************************ sequenced LasB CCGACCGGGAGTCCTGCCATGAGTCTGCTGTTCGAGCCTCTTAGCCTGCGTCAAATCACC 764 CCGACCGGGAGTCCTGCCATGAGTCTGCTGTTCGAGCCTCTTAGCCTGCGTCAAATCACC 1738 ************************************************************ sequenced LasB TTGCCCAACCGCATCGCCGTATCGCCCATGTGCCAGTACTCGGCGCAGGAGGGCCTGGCC 824 TTGCCCAACCGCATCGCCGTATCGCCCATGTGCCAGTACTCGGCGCAGGAGGGCCTGGCC 1798 ************************************************************ sequenced LasB AACGACTGGCATCTCGTGCACCTGGGCAGCCGCGCGGTGGGCGGCGCCGGCCTGGTGATA 884 AACGACTGGCATCTCGTGCACCTGGGCAGCCGCGCGGTGGGCGGCGCCGGCCTGGTGATA 1858 ************************************************************ sequenced LasB GTCGAAGCCACCGCGGTGTTGCCCGAGGGGCGCATCACCGCTGACGACCTCGGCATCTGG 944 GTCGAAGCCACCGCGGTGTTGCCCGAGGGGCGCATCACCGCTGACGACCTCGGCATCTGG 1918 ************************************************************ sequenced LasB AGCGACGCGCATGTCGAGCCGT-GCATCCGCT---------------------------- 975 AGCGACGCGCATGTCGAGCCGTTGCATCGCATCACCCGTTTCATCGAATCCCAGGGCGCG 1978 ********************** ***** * sequenced LasB ------------------------------------------------GTCGCCGGGGTCCAGCTGGCCCACGCCGGGCGCAAGGCGAGTACCTGGC 2027 154 >LasB-HA sequenced LasB -----------------------------------------------------------ATGAAGAAGGTTTCTACGCTTGACCTGTTGTTCGTTGCGATCATGGGTGTTTCGCCGGCC 60 sequenced LasB -----------------------------------------------------------GCTTTTGCCGCCGACCTGATCGACGTGTCCAAACTCCCCAGCAAGGCTGCCCAGGGCGCG 120 sequenced LasB -----------------------------------------------------------CCCGGCCCGGTCACCTTGCAAGCCGCGGTCGGCGCTGGCGGTGCCGACGAACTGAAAGCG 180 sequenced LasB -----------------------------------------------------------ATCCGCAGCACGACCCTGCCCAACGGCAAGCAGGTCACCCGCTACGAGCAATTCCACAAC 240 sequenced LasB -----------------------------------------------------------GGCGTACGGGTGGTCGGCGAAGCCATCACCGAAGTCAAGGGTCCCGGCAAGAGCGTGGCG 300 sequenced LasB -----------------------------------------------------------GCGCAGCGCAGCGGCCATTTCGTCGCCAACATCGCTGCCGACCTGCCGGGCAGCACCACC 360 sequenced LasB -----------------------------------------------------------GCGGCGGTATCCGCCGAGCAGGTGCTGGCCCAGGCCAAGAGCCTGAAGGCCCAGGGCCGC 420 sequenced LasB -----------------------------------------------------------AAGACCGAGAATGACAAAGTGGAACTGGTGATCCGCCTGGGCGAGAACAACATCGCCCAA 480 sequenced LasB -----------------------------------------------------------CTGGTCTACAACGTCTCCTACCTGATTCCCGGCGAGGGACTGTCGCGGCCGCATTTCGTC 540 sequenced LasB -----------------------------------------------------------ATCGACGCCAAGACCGGCGAAGTGCTCGATCAGTGGGAAGGCCTGGCCCACGCCGAGGCG 600 sequenced LasB -----------------------------------------------------------GGCGGCCCCGGCGGCAACCAGAAGATCGGCAAGTACACCTACGGTAGCGACTACGGTCCG 660 sequenced LasB -----------------------------------------------------------CTGATCGTCAACGACCGCTGCGAGATGGACGACGGCAACGTCATCACCGTCGACATGAAC 720 sequenced LasB -----------------------------------------------------------AGCAGCACCGACGACAGCAAGACCACGCCGTTCCGCTTCGCCTGCCCGACCAACACCTAC 780 sequenced LasB -----------------------------------------------------------AAGCAGGTCAACGGCGCCTATTCGCCGCTGAACGACGCGCATTTCTTCGGCGGCGTGGTG 840 sequenced LasB -----------------------------------------------------------TTCAAACTGTACCGGGACTGGTTCGGCACCAGCCCGCTGACCCACAAGCTGTACATGAAG 900 sequenced LasB -----------------------------------------------------------GTGCACTACGGGCGCAGCGTGGAGAACGCCTACTGGGACGGCACGGCGATGCTCTTCGGC 960 sequenced LasB -----------------------------------------------------------GACGGCGCCACCATGTTCTATCCGCTGGTGTCGCTGGACGTGGCGGCCCACGAGGTCAGC 1020 sequenced LasB -----------------------------------------------------------CACGGCTTCACCGAGCAGAACTCCGGGCTGATCTACCGCGGGCAATCAGGCGGAATGAAC 1080 sequenced LasB -----------------------------------------------------------GAAGCGTTCTCCGACATGGCCGGCGAGGCTGCCGAGTTCTATATGCGCGGCAAGAACGAC 1140 sequenced ------------------------------------------------------------ 155 LasB TTCCTGATCGGCTACGACATCAAGAAGGGCAGCGGTGCGCTGCGCTACATGGACCAGCCC 1200 sequenced LasB -----------------------------------------------------------AGCCGCGACGGGCGATCCATCGACAACGCGTCGCAGTACTACAACGGCATCGACGTGCAC 1260 sequenced LasB -----------------------------------------------------------CACTCCAGCGGCGTGTACAACCGTGCGTTCTACCTGTTGGCCAATTCGCCGGGCTGGGAT 1320 sequenced LasB ----------------------TTGTTGACGCCAACCGCTATTACTGGACCTCCACCAGC 38 ACCCGCAAGGCCTTCGAGGTGTTCGTCGACGCCAACCGCTACTACTGGACCGCCACCAGC 1380 * ** ************** ********* ******** sequenced LasB AAATTCAACAGCGGCCCCTGCGGGGGGATTCGCTCTGGGCAGAACCGCAACTACTTGGCG 98 AACTACAACAGCGGCGCCTGCGGGGTGATTCGCTCGGCGCAGAACCGCAACTACTCGGCG 1440 ** * ********** ********* ********* * ***************** **** sequenced LasB GCTGACGTCACCCGGGCGTTCCGCACCGTCGGCGTGGCCTGCCCGAGCGCGTTGATGTAC 158 GCTGACGTCACCCGGGCGTTCAGCACCGTCGGCGTGACCTGCCCGAGCGCGTTGATGTAC 1500 ********************* ************** *********************** sequenced LasB CCATACGACCCAGACTACGCATAAGCTCGGTGGTCCCGGCCGGCACTCCAGGAAGGAATG 218 CCATACGACCCAGACTACGCATAAGCTCGGTGGTCCCGGCCGGCACTCCAGGAAGGAATG 1560 ************************************************************ sequenced LasB CCGGTCGGGGTCGCTCAAGCCGTCTTCCGCCAGGAGGGCGGCTGCTTTATGTCGCTTGGG 278 CCGGTCGGGGTCGCTCAAGCCGTCTTCCGCCAGGAGGGCGGCTGCTTTATGTCGCTTGGG 1620 ************************************************************ sequenced LasB CCGTTGGCCTCCGCGAACCCGGTCTAAAGTTCAGGTGTGAGCACTTATTCCAAGACCGAC 338 CCGTTGGCCTCCGCGAACCCGGTCTAAAGTTCAGGTGTGAGCACTTATTCCAAGACCGAC 1680 ************************************************************ sequenced LasB CGGGAGTCCTGCCATGAGTCTGCTGTTCGAGCCTCTTAGCCTGCGTCAAATCACCTTGCC 398 CGGGAGTCCTGCCATGAGTCTGCTGTTCGAGCCTCTTAGCCTGCGTCAAATCACCTTGCC 1740 ************************************************************ sequenced LasB CAACCGCATCGCCGTATCGCCCATGTGCCAGTACTCGGCGCAGGAGGGCCTGGCCAACGA 458 CAACCGCATCGCCGTATCGCCCATGTGCCAGTACTCGGCGCAGGAGGGCCTGGCCAACGA 1800 ************************************************************ sequenced LasB CTGGCATCTCGTGCACCTGGGCAGCCGCGCGGTGGGCGGCGCCGGCCTGGTGATAGTCGA 518 CTGGCATCTCGTGCACCTGGGCAGCCGCGCGGTGGGCGGCGCCGGCCTGGTGATAGTCGA 1860 ************************************************************ sequenced LasB AGCCACCGCGGTGTTGCCCGAGGGGCGCATCACCGCTGACGACCTCGGCATCTGGAGCGA 578 AGCCACCGCGGTGTTGCCCGAGGGGCGCATCACCGCTGACGACCTCGGCATCTGGAGCGA 1920 ************************************************************ sequenced LasB CGCGCATGTCGAGCCGT-GCATCCGGT--------------------------------- 604 CGCGCATGTCGAGCCGTTGCATCGCATCACCCGTTTCATCGAATCCCAGGGCGCGGTCGC 1980 ***************** ***** * sequenced LasB -------------------------------------------CGGGGTCCAGCTGGCCCACGCCGGGCGCAAGGCGAGTACCTGGC 2024 156 Appendix II Methods for Ser/Thr/Tyr Phosphoproteome analysis 1. Digestion of Pseudomonas cellular proteins The pellets were disrupted in 0.1 M Tris-HCl (pH 8.0), containing protein phosphatase inhibitor cocktails 1 & 2 (Sigma) and protease inhibitors (Sigma), with a Bioruptor UCW-310 (Cosmo Bio, Tokyo Japan). The homogenate was centrifuged at 1,500 x g for 10 minutes and the supernatant was reduced with dithiothreitol and alkylated with iodoacetamide. The protein fraction was purified by a PD-10 desalting column (GE healthcase, Buckinghamshire, UK) and digested with Lys-C, followed by dilution and trypsin digestion as described (Washburn et al., 2001; Ishihama et al., 2007). These digested samples were desalted using C-18 StageTips (Rappsilber et al., 2007). The peptide concentration of the eluates was adjusted to 1.0 mg/mL with 0.1% TFA, 80% acetonitrile. 2. Enrichment of phosphopeptides Aliphatic hydroxy acid-modified metal oxide chromatography (HAMMOC) using titania and zirconia was performed to enrich phosphopeptides as described previously (Sugiyama et al., 2007; 2008). Briefly, custom-made metal oxide chromatography (MOC) tips were prepared using C2-StageTips and metal oxide bulk beads (0.5 mg beads per 10 µL pipette tip). Prior to loading samples, the MOC tips were equilibrated with 0.1% TFA, 80% acetonitrile, containing a hydroxy acid as a selectivity enhancer (solution A). As the enhancer, lactic acid (LA) was used at a concentration of 300 mg/ml for titania MOC tips and β-hydroxypropanoic acid (HPA) at 100 mg/ml for zirconia MOC tips. The digested sample from 100 µg of Pseudomonas total proteins was diluted 157 with 100 µL of solution and loaded onto the MOC tips. After successive washing with solution A and solution B (0.1% TFA, 80% acetonitrile), 0.5% ammonium hydroxide was used for elution. The eluted fraction was acidified with TFA, desalted using C18 StageTips as described above, and concentrated in a Tony CC-105 vacuum evaporator (Tokyo, Japan), followed by the addition of solution A for subsequent nanoLC-MS/MS analysis. 3. NanoLC-MS system An LTQ-Orbitrap (Thermo Fisher Scientific, Bremen, Germany) coupled with a Dionex Ultimate3000 pump (Germering, Germany) and an HTC-PAL autosampler (CTC Analytics AG, Zwingen, Switzerland) was used for nanoLC-MS/MS analyses throughout this study. An analytical column needle with “stone-arch” frit (Ishihama et al., 2002) was prepared with ReproSil C18 materials (3 µm, Dr.Maisch, Ammerbuch, Germany). Elutes from each phosphopeptide enrichment method (Ti-, Zr-HAMMOC) were analysed in triplicates. The injection volume was 5 µL and the flow rate was 500 nL/min. The mobile phases consisted of (A) 0.5% acetic acid and (B) 0.5% acetic acid and 80% acetonitrile. A three-step linear gradient of 5% to 10% B in 5 min, 10% to 40% B in 60 min, 40% to 100% B in 5 min and 100% B for 10 min was employed throughout this study. The MS scan range was m/z 300-1500, and the top ten precursor ions were selected (Haas et al., 2006) in MS scan by Orbitrap with R=60,000 for subsequent MS/MS scans by ion trap in the automated gain control (AGC) mode where AGC values of 5.00e+05 and 1.00e+04 were set for full MS and MS/MS, respectively. The normalized collision energy was set to be 35.0. A lock mass function was used for the LTQ-Orbitrap to obtain constant mass accuracy during gradient analysis (Olsen et al., 2005). 158 4. Database searching Mass Navigator v1.2 (Mitsui Knowledge Industry, Tokyo, Japan) and Mascot Distiller v 2.2.1.0 (Matrix Science, London) were used to create peak lists on the basis of the recorded fragmentation spectra. Details in this process were described below in section 5. Peptides and proteins were identified by automated database searching using Mascot v2.2 (Matrix Science) against (ftp://ftp.ncbi.nih.gov/genomes/Bacteria/Pseudomonas_fluorescens_PfO-1/) Pseudomonas putida samples and NC_007492 for Pseudomonas_aeruginosa_PAO1_2007-06-19 (http://www.pseudomonas.com/downloads/sequences) for Pseudomonas aeruginosa with a precursor mass tolerance of 3 ppm, a fragment ion mass tolerance of 0.8 Da and strict trypsin specificity (Olsen et al., 2004), allowing for up to two missed cleavages. Note that we added porcine trypsin and human keratins to the databases as possible contaminants. Carbamidomethylation of cysteine was set as a fixed modification, and oxidation of methionines and phosphorylation of serine, threonine and tyrosine were allowed as variable modifications. Peptides were considered identified if Mascot score was over the 99% confidence limit based on the significance threshold (p< 0.01) of each peptide and at least three successive y- or b-ions with an additional two and more y-, b- and/or precursor-origin neutral loss ions were observed, based on the error-tolerant peptide sequence tag concept (Mann et al., 1994). All spectra were further verified by manual inspection. All MSMS spectra were available in the supplementary section. A randomized decoy database created by a Mascot Perl program estimated 0.66% falsediscovery rate for all identified peptides within the criteria. Phosphorylated sites were 159 assigned with the criteria that the phosphorylated sites are unambiguously determined when y- or b-ions between which the phosphorylated residue exists are observed in the peak lists of the fragment ions. 5. Database searching Both Mass Navigator v1.2 and Mascot Distiller v 2.2.1.0 were used to create peak lists on the basis of the recorded fragmentation spectra. In order to improve the quality of MSMS spectra, Mass Navigator discarded all peaks with less than 10 absolute intensity and with less than 0.1% of the most intense peak in MSMS spectra, whereas Mascot Distiller discarded all peaks with S/N[...]... of MorA in P aeruginosa attachment to host surface via surface appendages and subsequent entry into host cell ii) To study the effect of MorA-c-di-GMP signaling on P aeruginosa secretion that aid in invasion of host iii) To investigate the mechanism(s) by which MorA may control host invasion of P aeruginosa 3 In this thesis, the second chapter (Chapter 2) provides review of bacterial invasion mechanisms,... aim of this study was to investigate the role of MorA-c-di-GMP signaling in P aeruginosa virulence mechanisms As previous studies have proven that function of bacterial surface appendages and protein secretion are critical in early stages of bacterial invasion, this study aimed to focus on the effect of MorA signaling on these factors The specific aims of this study were i) To understand the role of. .. to be affected by quorum sensing mechanism involving small molecule trafficking and/ or levels of nucleotide second messengers namely cyclic- AMP and cyclic diguanylate monophosphate (c-di-GMP) in P aeruginosa and other Gram-negative pathogens In recent years, the significance of c-di-GMP second messenger signaling is becoming apparent in the regulation of a multitude of cellular process and virulence... different stages of infection 11 Figure 2.3 Bacterial secretion systems 24 Figure 2.4 Type II secretion system in P aeruginosa 26 Figure 2.5 Phenotypes regulated by c-di-GMP and binding sites/domains 33 Figure 2.6 Regulation of flagellum-based motility by c-di-GMP signaling 36 Figure 2.7 Domain structure of MorA in P putida and P aeruginosa Figure 2.8 Verification of transcriptional level effect of MorA... mechanisms to be explored Initial stages of P aeruginosa infection include attachment to host surface followed by internalization into host cells eventually leading to invasion of tissue Known key adhesins include the surface appendages- flagellum and pili Their interaction with host causes changes at the host- pathogen interface leading to internalization of P aeruginosa Both pili and flagella are nanomachines... penetration and cellular damage that lead to apoptosis and necrosis of the host cells The expression of an arsenal of tissue-destructive enzymes and multiple mechanisms for attachment and replication in host tissues to enable these processes are very typical of P aeruginosa infection Besides, these some of the virulence determinants are employed to evade the host defense mechanisms A broad view of virulence... relevant virulence properties of P aeruginosa and their regulation, known c-di-GMP signaling mechanisms and Ser/Thr/Tyr phosphorylation in bacteria Chapter 3 gives the details of all the materials and methods that were used during the entire study Chapter 4 discusses effect of MorA on P aeruginosa -host attachment, bacterial surface structures aiding interaction, and changes at the host- pathogen interface... Ishihama, Y., Swarup, S Effects of cyclic- di-GMP signaling on protein phosphorylation and secretion in Pseudomonas sp In Program and Abstracts, 12th Biological Sciences Graduate Congress, University of Malaya, Kuala Lumpur, Malaysia, December 17-19, 2007 Ravichandran, A., Heng, M.W., Choy, W.K., Swarup, S MorA, the regulator of biofilm formation in P aeruginosa also affects the levels of virulence-associated... appendages mediate P aeruginosa host attachment 70 Figure 4.5 Entry mechanisms of P aeruginosa WT 72 Figure 5.1 Type III effector secretion levels are not affected by MorA 77 Figure 5.2 Levels of secreted proteases are affected by MorA in P aeruginosa 79 Figure 5.3 Elastase activity in extracellular fraction of P aeruginosa PAO1 WT and morA KO strains 85 Figure 5.4 Invasion efficiency corresponds to... overall internalization and dissemination process of Salmonella typhimurium and Shigella flexneri Once in close contact with the epithelium, Salmonellae induce degeneration of the enterocyte's microvilli, followed by profound membrane "ruffling" localized to the area of bacteria host cell attachment This is accompanied by extensive endocytosis and internalization of the bacteria into host cells as described