\ Chapter Morpholino antisense oligonucleotide knock-down and functional characterization of SGIV proteins Manuscript in preparation Functional characterization of Singapore grouper iridovirus proteins using Morpholino antisense oligonucleotide knock-down. 101 4.1 Introduction Morpholino antisense oligonucleotides (oligos or morpholinos) or MO in short is a gene knock-down agent. MOs used for SGIV gene knock-down were synthesized by GeneTools based on the full sequence of SGIV genome and ORFs. We have carried out MO knock-downs for SGIV ORFs whose expression stages are different, ORF18R and ORF140R are late stage genes, ORF135L is an early gene. On the other hands, antibodies of these proteins are available. In this project, we knocked down SGIV ORF18R, ORF140R and ORF135L and analyzed the effects on SGIV and host protein expression profiles using iTRAQ method. In all SGIV gene knock-downs, only MO knock-down of ORF018R (MO18) showed a phenotype. This ORF18 was demonstrated to be involved in serine/threonine phosphorylation and virion assembly (Wang et al., 2008). Hence, we have included MO18 in this project as a positive control and further examine its function using other approaches. 4.2 Material and methods 4.2.1 MO knock-down MOs were delivered using Nucleofactor kit T (Amaxa), program T27. Briefly, the fresh cells were harvested and washed with PBS, resuspended in the mixture of 98 μL of 102 nucleotransfector solution (with supplement) and μL of MOs to get a final concentration of 20 μM MO, transferred into a cuvette for electrophoresis. The mixture was transferred immediately into the cell culture flask with fresh medium. The negative control MO (MOctrl) is the standard control oligo from GeneTools. All MOs used in this projects are listed in Table 11. The virus was added into the tranfected cells at 40 hours post transfection (hpt). All the samples were harvested at 48 hpi for iTRAQ analysis or at different time courses for transmission electron microscopy experiment and Tissue Culture Infectious Dose50 (TCID50 test). 4.2.2 iTRAQ sample preparation This has been described in Chapter (3.2.2) 4.2.3 LC-MALDI MS This has been described in Chapter (3.2.3) 4.2.4 Transmission Electron Microscrope (TEM) The cells were fixed in 2.5 % glutaraldehyde, % paraformaldehyde in 1X PBS (pH 7.4) overnight and post-fixed with % Osmium tetroxide for hours, followed by dehydration in an ethanol series of 50 %, 75 % and 100 %. The samples were embeded using the Spurr kit (Sigma), sliced into ultra thin sections (70-90 μm) and stained with % uranyl acetate, % lead citrate. The ultra thin sections were viewed under JOEL JEM 2010F electron microscopy. 4.2.5 TCID50 test 103 GE cells were transfected with MOs and infected with SGIV at 40 hpt at m.o.i (multiplicity of infection) of and 0.5 for high and low m.o.i respectively. Unabsorbed virions were removed at hpi and the cells were washed twice with PBS. The cell culture supernatant and cell pellet from different time intervals (48 hpi, 72 hpi and 96 hpi) were diluted from 10-2 to 10-7 and used to infect GE cells with six repetitions per dilution to perform the TCID50 assay. The viral titres were calculated using the Spearman-Karber method (Hamilton et al., 1977). 4.2.6 Western Blot analysis This was described earlier in chapter (2.2.11) 4.2.7 Real time PCR In order to examine the mRNA level, semi-quantitative real-time RT-PCR was applied and βactin was used as the endogenous control. The specific primers for real-time PCR are in Table 12. The normal PCR using these primers showed a single, specific band after running on a % agarose gel. The total RNA samples were reverse-transcribed using SuperScript III first strand synthesis (Invitrogen) with random primers (d(N)6, 0.5 μg μL -1 ). cDNA (10 ng) was subsequently subjected to real time PCR using Power SYBR® Green PCR Master mix (ABI). Each real-time PCR reaction had a total of repetitions of biological replica and technical replica. The real-time data were collected and analysed with the –ΔΔCt method (Livak and Schmittgen, 2001) using ABI Prism SDS software. 104 Table 11 The sequences of Morpholinos for knock-down experiments. Knock-down target Synthesized MO Target location Negative control CCTCTTACCTCAGTTACAATTTATA ORF018R GCGTTCAGATAGTTTTACGGACATC -1-- +24 ORF135L AATACGCTTGTACGAGTTCTTCCAT -- +25 ORF140R GACCCCTAAATTCTGACATTTTTAT -6 -- +19 105 Table 12 The specific primers for real-time PCR OFR/Gene Forward primer Sense primer ORF007L TGACCATGTGACGATAACTATAAGCCCGG AGGGTATATCTATCGGTTCGGC ORF012L TGACCATGCCGAATGTTTGACCCGAA GAGCGCGGACAAGATGGAT ORF046L TGACCATGGGACGCGAACGATATAGTGA GAAGTCCTTGAGGGCCTGGT ORF101R TGACCATGACGAAGACAGCTGGGCCAT CGATCTAAAGGTTCCACGACG ORF125R TGACCATGCCGTGCGTGGGTATGTGTA CATTGACCTCCTGAGAACGTTC ORF136R TGACCATGGGATGAATCAAGAAATGCAGAC GAAAAGGGATGCAGCAACA 106 4.3 Results and Discussions: 4.3.1 MO knock-down of ORF018R, ORF140R and ORF135L To examine the specificity and efficiency of MO knock-down, we analyzed the expression of knocked-down proteins using Western Blot, in which GE cells were transfected using MO and infected by SGIV. The Western Blot results showed no detectable amount of proteins 018R, 140L and 135R with the specific knock-down (Figure 18). We also included other SGIV proteins such as ORF026R and ORF093L which were expressed normally in all knock-downs. It was concluded that ORF018R,ORF140R and ORF135L were specifically and efficiently knocked down by MO18, MO140 and MO135 respectively. 4.3.2 Effect of MO135 knock-down on SGIV and host proteins expressions To study the effect of knock-downs on the viral and host proteins expressions, we analyzed the protein profile of knock-down GE cells using iTRAQ method. The fresh GE cells were transfected by MOs, infected by SGIV (m.o.i of 5, infected at 40 hpt), harvested at 48 hpi, and prepared for iTRAQ samples. In this project, we used 4-plex iTRAQ to analyse protein samples of MOctrl, MO140, MO135 and MO18 knock-down cells. ORF135L is an early gene with unknown function (Chen et al., 2006). It encodes a small nonstructure protein of 13 kDa (Song et al., 2004). The knock-down of ORF135L using MO135 has 107 caused several changes in protein expression of SGIV and host proteins (Table 13). SGIV ORF101R protein was significantly increased after the knock-down. ORF101R is also an early gene (Chen et al., 2006) which encodes a 35 kDa structure protein (Song et al., 2006). We were not able to validate the change of ORF101R protein expression by Western blot due to the unavailability of the anti-ORF101R protein antibody. On the other hands, we examine the mRNA expression level of ORF101R using real-time PCR method. The real-time PCR result showed the increase of ORF101R mRNA by 1.5 fold (Figure 19) after MO135 knock-down. It is likely that protein 101R was negatively regulated by 135L protein. In addition, MO135 knock-down has led to the decrease of several host proteins including the elongation factor 1-alpha (eEF1A) and Retinoblastoma A associcated protein. eEF1A is an isoform of the alpha subunit of the elongation factor-1 complex, which is resposible for the enzymatic delivery of aminoacyl tRNAs to the ribosome, thereby regulating the fidelity and rate of polypeptide elongation during translation (Condeelis, 1995). Association of eEF1A with specific virus molecules may play a role in the replication of virus genome (Johnson et al, 2001; Cimarelli & Luban, 1997; Blackwell & Brinton, 1997). Retinoblastoma associated protein may have diverse function in regulation in cell proliferation (Pacifico et al, 2007; Giordano et al., 2007) and transcription regulator (Hofman et al, 2003; Yan et al., 2000). By reduction of both eEF1A and retinoblastoma associated protein, MO135 knowk-down may have significant influences on transcription regulation and replication of virus genome. 4.3.3 Effect of MO18 knock-downs on SGIV and host proteins expressions 108 ORF018R is a late gene (Chen et al., 2006) which encodes a 32 kDa structure protein (Song et al., 2004). It was reported that ORF018R is involved in serine/threonine phosphorylation and virion assembly (Wang et al., 2008). In this study, MO18 knock-down appeared to regulate the protein expression of ORF007L, 012L, 046L, 125R and 140R (Table 14). ORF007L, 012L, 046L and 140R are late stage viral genes (Chen et al., 2006) that would further confirms ORF018R has an effect on late stage genes (Wang et al., 2008). Furthermore, the reduction of protein 140R in MO18 knock-down (Wang et al., 2008) were confirmed by iTRAQ analysis. It is possible that ORF140R is one down-stream gene regulated by ORF018R. In addition to the effect on SGIV proteins, MO18 knock-down caused significant changes in the expression of several host proteins (Table 14) including the splicing factor arginine/serine rich protein (SFRS2 or SR) which was up regulated in MO140 and MO135 knock-down. SFRS2 is required for early spliceosome assembly for protein-protein interaction and can function as activators of pre-mRNA splicing (Lopato et al., 1996; Graveley & Manaitis, 1998). Both depletion and over expression of SFR2 could cause serious impact to the transcription and splicing machineries during gene expression (Wang and Manley, 1995; Fededa and Kornblihtt, 2008; Lin et al., 2008; Xiao et al., 2007). It has been reported that the overexpression of SR proteins caused a large reduction of genomic RNA, down-regulate the late steps of HIV-1 replication (Jacquenet et al., 2005). Besides, MO18 also reduced protein expression of RhoA (Ras homolog gene family, member A) which is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers (Ridley, 2001). RhoA GTPase was known with roles in facilititating virus entry, adherent target cell and infection by involving remodel of actin cytoskeleton for phagocytosis- 109 like uptake (Clement et al., 2006; Veettil et al, 2006; Coyne et al, 2007; Jimenez-Baranda et al., 2007). RhoA-GTPase is also essential for entry stages of infection involved in the modulation of microtubular dynamics, movement of virus in the cytoplasm, and nuclear delivery of viral DNA (Raghu et al, 2007). In addition, RhoA signaling is associated with filamentous virus morphology, cell-to-cell fusion, syncytium formation (Gower et al., 2005). Interestingly, it was reported that MO18 knock-down resulted in a reduction of virus infectivity and distortion of viral particle assembly (Wang et al., 2008). Hence, in MO18 transfected cells, the decrease of cellular RhoA, which is an crucial protein for virus entry, infection and delivery of viral DNA, might contribute to these knock-down’s effects. 4.3.4 Effect of MO140 knock-downs on SGIV and host proteins expressions ORF140R encodes a late, non-structural protein of 32 kDa (Song et al., 2004; Chen et al., 2006). MO140 knock-down resulted in several changes of SGIV and host protein expression (Table 15). ORF046L, a late and structure protein, was decreased after MO140 knock-down. ORF046L was also shown to be down-regulated in MO18 transfected cells. However, MO140 knock-down had no impact on ORF007L, 012L, 125R which were declined in MO18 knockdown. Except for ORF125R that is an intermediate early gene, ORF018R, 007L, 012L and 046L are all late stage genes (Chen et al., 2006). It was confirmed that ORF140R protein was reduced in MO18 transfected cell, however in this study, ORF018L protein expression was not affected by MO140. We might hypothesize that ORF007L and 012L are in the middle of the pathway, in which ORF140R is a down stream gene regulated by ORF018R; and ORF046L is further down stream, under regulation of both ORF018R and ORF140R. 110 be used to solve the protein structures which would greatly enhance the functional study of these genes. Moreover, we also aim to determine the structure of SGIV structural proteins to elucidate function of the presumptive proteins based on the structures, which should provide insight into design the inhibitor or anti- viral drug. 5.2.4 Structural determination of SGIV virion particles In addition to the structural determination of SGIV proteins, we can also target to study the 3D structure of SGIV virion particles using cryo electro microscopy (CryoEM). CryoEM is a form of electron microscopy where the sample is studied at cryogenic temperatures (liquid nitrogen or helium). CryoEM has the potential of revealing structural details at near atomic level of macromolecular complexes, subcellular assemblies that are either too large or too heterogeneous to be investigated by conventional X-ray crystallograpy or NMR. Interestingly, this method can examine structural changes of the molecule during its functional activities (Henderson, 1995). Recently, a group of scientists at Purdue Univesity (USA) has reported a 22-MDa structure of the capsid of the infectious epsilon15 particle by cryoEM. With the resolution of 4.5 Å, a complete backbone and its major capsid proteins were constructed (Jiang et al., 2008). SGIV particle sample can be prepared for cryoEM by rapid plugging into liquid nitrogen and imaged at low temperature in the EM. The overall 3D structure and symmetry of the virion and nucleocapsids can be generated. 125 References Anderson, N.L., and Anderson, N.G. 1998. Proteome and proteomics: new technologies, new concepts and new words. Electrophoresis 19, 1853-61 Arnason,T., Ellison, M.J., 1994. Stress resistance in Saccharomyces cerevisiae is strongly correlated with assembly of a novel type of multiubiquitin chain. Mol Cell Biology. 14, 7876-7883. Bax, A., 2003. Weak alignment offers new NMR opportunities to study protein structure and dynamics. Protein Sci. 1, 1-16. Beal, R., Deveraux, Q., Xia, Q., Rechsteiner, M., Pickart, C., 1996. Surface hydrophobic residues of multiubiquitin chains essential for proteolytic targeting. Proc Natl Acad Sci USA. 93,861-866. Belz, T., Pham, A.D., Beisel, C., Anders, N., Bogin, J., Kwozynski, S., and Sauer, F. 2002. In vitro assays to study protein ubiquitination in transcription. Methods 26: 233244. Blackwell, J.L., Brinton, M.A. 1997. Translation elongtaion factro-1 alpha interacts with the 3’ stem-loop region of West Nile virus genomic RNA. J Virol 71, 6433-44. Blenis, J. & Erikson, R. L. (1984) Phosphorylation of the ribosomal protein S6 is elevated in cells transformed by a variety of tumor viruses J. Virol. 50, 966-969 Bloch, F., Hansen, W.W., and Packart, M., 1946. Nuclear Induction. Phys. Rev. 69, 127150 Branden C, Tooze J 1999. Introduction to Protein Structure. Garland Publishing, New York, p. 251-281. Branden, C., and Tooze, J. 1999. Introduction to Protein Structure. Garland Publishing, New York, p. 251-281. Caron, E., Hall, A. 1998. Identification of two distinct mechanisms of phagocytosis controlled by different Rho GTPases. Science. 282, 1717-21. Cao, R., and Zhang, Y. 2004. The functions of E(Z)/EZH2-mediated methylation of lysine 27 in histone H3. Curr. Opin. Genet. Dev. 14, 155–164. Clore, G.M., and Gronenborn, A.M., 1991. Structures of Larger Proteins in Solution: Three- and Four-Dimensional Heteronuclear NMR Spectroscopy. Science 252, 13901399. Chau, V., Tobias, J.W., Bachmair. L., Marriott, D., Ecker, D.J., Gonda, D.K., Warshawsky, A., 1989. A multiubiquitin chain is confined to specific lysine in a targeted short-lived protein. Science 243, 1576-83. 126 Chen, L.M., Wang, F., Song, W.J., Hew, C.L., 2006. Temporal and differential gene expression of Singapore grouper iridovirus. Journal of General Virology 87, 2907–2915. Chew-Lim, M., Ngoh, G.H., Ng, M.L., Lee, J.M., Chew, P., Li, J., Chan, Y.C., and Howe, J.L.C. 1994. Grouper cell line for propagating grouper viruses. Singapore J. Primary Ind. 22, 113-116. Chua, F.H., Ng.M.L., Ng. K.L., Loo. J.J., and Wee, J.Y. 1994. Investigation of outbreaks of novel disease, ‘Sleepy Grouper disease’, affecting the brown-spotted grouper, Epinephelus tauvina Forskal. J. Fish. Dis. 17, 417- 427. Ciechanover, A., 1998. The ubiquitin proteasome pathway: on protein death and cell life. The EMBO journal 17, 7151-7160. Cimarelli, A., Luban, J. 1999. Translation elongation factor 1-alpha interacts specifically with the human immunodeficiency virus type Gag polyprotein. J Virol 73, 5388-401. Clement, C., Tiwari, V., Scanlan, P.M., Valyi-Nagy, T., Yue, B.Y., Shukla, D. 2006. A novel role for phagocytosis-like uptake in herpes simplex virus entry. J Cell Biol 174, 1009-21. Condeelis, J. 1995. Elongation factor alpha, translation and the cytoskeleton. Trends Biochem Sci 20, 169-70. Coyne, C.B., Kim, K.S., Bergelson, J.M. 2007. Poliovirus entry into human brain microvascular cells requires receptor-induced activation of SHP-2. EMBO J 26, 4016-28 Decker, S. (1981). Phosphorylation of ribosomal protein S6 in avian sarcoma virustransformed chicken embryo fibroblasts. Proc. Natl. Acad. Sci. USA 78, 4112-4115. Delhon, G., Tulman, E.R., Afonson, C.L., Lu, Z., Becnel, J.J., Moser, B.A., Kutish, G.F., Rock, D.L., 2006. Genome of invertebrate iridescence virus type (Mosquito iridescent virus). Journal of Virology 80, 8439-8449. Deng, L., Wang, C., Spencer, E., Yang, L., Braun, A., You, J., Slaughter, C., Pickart, C., and Chen, Z., 2000. Activation of the IkB kinase complex requires a dimeric ubiquitin conjugating enzyme complex and the formation of a unique polyubiquitin chain. Cell 103, 351-361. Do,J.W., Moon, C.H., Kim, H.J., Ko, M.S., Kim, S.B., Son, J.H., Kim, J.S., An, E.J., Kim, M.K., Lee, S.K., Han, M.S., Cha, S.J., Park, M.S., Park, M.A., Kim, Y.C., Kim, J.W., Park, J.K., 2004. Complete genomic DNA sequence of rock bream iridovirus. Virology 325, 351-363. 127 Eaton, H.E., Metcalf, J., Penny, E., Tcherepanov, V., Upton, C., Brunetti, C.R. 2007. Comparative genomic analysis of the family Iridoviridae: re-annotating and defining the core set of iridovirus genes. Virology Journal 4(11). Emiliani, C. 1993. Extinction and viruses. Biosystems 31(2-3): 155-9. Fededa, J.P., and Kornblihtt, A. 2008. A splicing regulator promotes transcriptional elongation. Nature structural & molecular biology 15, 779-81 Fesik, S.W., Zuiderweg, E. R. P., 1990. Heteronuclear 3-Dimensional Nmr Spectroscopy of Isotopically Labelled Biological Macromolecules. Quart. Rev.Biophys. 23, 97-131. Finley, D.B., Bartel, and Varshavsky. A. 1989. The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis. Nature, 338: 394-401 Fitzgerald, A.L., Graves, M.V., Li, X., Hartigan, J., Pfitzner, A.J.P., Hoffart, E., Etten, J.L.V., 2007. Sequence and annotation of the 288-kb ATCV-1 virus that infects and endosymbiotic chlorella strain of the heliozoon Acanthocystis turfacea. Virology 362, 350-361. Freeman,R., Anderson,W.A., 1962. Use of weak perturbing radio-frequency fields in nuclear magnetic double resonance. J. Chem. Phys. 37, 2053-2073. Gan, C.S., Chong, P.K., Pham, T.K., and Wright. P.C. 2006. Technical, experimental and biological variation in Isobaric Tags for Relative and Absolute Quantitation (iTRAQ). J. Proteome Res. 6, 821-827. Gomi, S., Majima, K., Maeda, S., 1999. Sequence analysis of the genome of Bombyx mori nucleopolyhedrovirus. Journal of General Virology 80, 1323-1337. Goorha, R., and Murti, K.G. 1982. The genome of frog virus 3, and animal DNA virus, is circularly permuted and terminally redundant. Proc. Natl. Acad. Sci. USA 79: 248-252. Giordano, A., Bellacchio, E., Bagella, L., Paggi, M.G. 2007. Interaction between the Cdk2/cyclin A complex and a small molecule derived from the pRb2/p130 spacer domain: a theoretical model. Cell Cycle 6, 2591-3. Gower, T.L., Pastey, M.K., Peeples, M.E., Collins, P.L., McCurdy, L.H., Hart, T.K., Guth, A., Johnson, T.R., Graham, B.S. 2005. RhoA signalling is required for respiratory syncytial virus-induced syncytium formation and filamentous virion morphology. J Virol 79, 5326- 36. Graveley, B.R., and Manaitis, T. 1998. Arginine/serine-rich domains of SR proteins can function as activators of pre-mRNA splicing. Mol Cell 1, 765-71. 128 Guarino, L.A., 1990. Identification of viral gene encoding a ubiquitin like protein. Proc. Natl. Acad. Sci. U.S.A. 87, 409-413. Guarino, L.A., Smith, G., Dong, W., 1995. Ubiquitin is attached to membranes of baculovirus particles by a novel tye of phospholipid anchor. Cell 80: 301-309. Hamilton, M.A., Russo, R.C., and Thurston, R.V. 1977. Trimmed Spearman-Karber method for estimating median lethal concentrations in tocicity bioassays. Environ Sci Technol 11, 714-719. He, J.G., Deng, M., Weng, S.P., Li, Z., Zhou, S.Y., Long, Q.X., Wang, X.Z., Chan, S.M., 2001. Complete genome analysis of Mandarin fish infectious spleen and kidney necrosis iridorivus.Virology 291, 126-139. Henderson, R. 1995. The potential and limitations of neutrons, electrons and X-rays for atomic resolition microscopy of unstained biological molecules. Q Rev Biophys 28, 17193. Hermann, J., Lerman, L.O., Lerman, A., 2007. Ubiquitin and Ubiquitin –like proteins in Protein Reguation. Circulation Research 100, 1276-1291. Hicke, L., 2001. Protein regulation y monoubiquitin. Nature reviews molecular cell biology 2, 195-200. Hofman, K., Swinnen, J.V., Claessens, F., Verhoeven, G., Heyns, W. 2003. The retinoblastoma protein-associated transcription repressor RBaK interacts with the androgen receptor and enhances its transcriptional activity. J Mol Endocrinol 31, 583-96 Hofmann, R.M., Pickart, C.M., 1999. Noncanonical MMS2-encoded ubiquitin conjugating enzyme functions in assembly of novel polyubiquitin chains for DNA repair. Cell 96, 645-653. Hudziak, R.M., Barofsky, E., Barofsky, D.F., Weller, D.L., Huang, S.B., Weller, D.D. Resistance of morpholino phosphorodiamidate oligomers to enzymatic degradation. Antisense Nucleic Acid Drug Dev. 1996, 6(4), 267-272. Huyen Y., Zgheib O., Ditullio R. A. J., Gorgoulis V. G., Zacharatos P., Petty T. J., Sheston E. A., Mellert H. S., Stavridi E. S., Halazonetis T. D. 2004. Methylated lysine 79 of histone H3 targets 53BP1 to DNA double-strand breaks. Nature 432, 406–411. Imai, N., Matsuda, N., Tanaka, K., Nakano, A., Matsumoto, S., Kang, W., 2003. Ubiquitin ligase activities of Bombyx mori nucleopolyhedrovirus RING finger proteins. J Virology. 77, 923-30. 129 Irmler, M., Hartl, D., Schmidt, T., Schuchhardt, J., Lach, C., Meyer, H.E., Hrabe de Angelis, M., Klose, J., Beckers, J. 2008. An approach to handling and interpretation of ambiguous data in transcriptome and proteome comparisons. Proteomics 8, 1165-9 Jacquenet, S., Decimo, D., Muriaux, D. and Darlix, J.L. 2005. Dual effect of the SR protein ASF/SF2, SC35 and 9G8 on HIV-1 RNA splicing and virion production. Retrovirology 22, 2-33. Jakob, N.J., Muller K, Bahr U, Darai G. 2001. Analysis of the first complete DNA sequence of an invertebrate iridovirus: coding strategy of the genome of Chilo iridescent virus. Virology 286, 182-196. Jennings E. 1995. Folic acid as a cancer preventing agent. Medical Hypotheses 45 (3): 297-303 Jentsch, S., Pyrowolakis, G., 2000. Ubiquitin and its kin: How close are the family ties? Trends Cell Biology 10, 335-342. Jiang, W., Baker, M.L., Jakana, J., Weigele, P.R., King, J., and Chiu, W. 2008. Backbone structure of the infectious ε15 virus capsid revealed by electron cryomicroscopy. Nature 451, 1130-1136. Jimenez-Baranda, S., Gomez-Mouton, C., Rojas, A., Martinez-Prats, L., Mira, E., Ana Lacalle, R., Valencia, A., Dimitrov, D.S., Viola, A., Delgado, R., Martinez-A, C., Manes, S. 2007. Filamin-A regulates actin-dependent clustering of HIV receptors. Nat Cell Biol 9, 838-46. Johnson, C.M., Perez, D.R., French, R., Merrick, W.C, Donis, R.O. 2001. The NS5A protein of bovine viral diarrhoea virus interacts with the alpha subunit of translation elongation factor-1. J Gen Virol 82, 2935-43. Kalic, M., Lauterwein, J., Busselmann, G., Kamp, G. 2000. Assignment of overlapping (1)H NMR signals in carp seminal plasma by proton-detected 2D C,H correlation spectroscopy. Biochem. Biophys. Res. Commun. 269(1), 76-80. Kerscher, O., Felberbaum, R., Hochstrasser, M. 2006. Modification of proteins by ubiquitin and ubiquitin-like proteins. Annu. Rev. Cell Dev. Biol. 22, 159-180. Kim ,H.T., Kim , K.P., Lledias, F., Lisselev, A.F., Scaglione, K.M., Skowyra, D., Gygi, S.P., Goldberg, A.L., 2007. Certain pairs of ubiquitin-conjugating enzymes (E2s) and ubiquitin-protein ligases (E3s) synthesize nondegradable forked ubiquitin chains containing all possible isopeptide linkages. J. Biol. Chem. 282, 17375-86. Klug, A., Franklin, R.E., Humphreys-Owen, S.P. 1959. The crystal structure of Tipula iridescent virus as determined by Bragg reflection of visible light. Biochim Biophys Acta 32(1): 203-19. 130 Lazar, G.A., Johnson, E.C., Desjarlais, J.R., Handel, T.M. 1999. Rotamer strain as a determinant of protein structural specificity. Protein Sci. 8, 2598- 2610. Leyva, J.A., Bianchet, M.A., Amzel, L.M.2003. Understanding ATP synthesis: structure and mechanism of the F1-ATPase. Mol. Membr. Biol. 20: 27-33. Li, L., Donly, C., Li, Q., Willis, L.G., Keddil, B.A., Erlandson, M.A., Theilmann, D.A., 2002. Identification and genomic analysis of a second species of Nucleopolyhedrovirus isolated from Mamestra configurata. Virology 297, 226-244. Li, Z., Lin, Q., Chen, J., Wu, J.L., Lim, T.K., Loh, S.S., Tang, X., and Hew, C.L. 2007. Shotgun identification of the structural proteome of shrimp white spot syndrome virus and iTRAQ differentiation of envelope and nucleocapsid subproteomes. Mol Cell Proteomics. 6(9):1609-20. Lin, S., Coutinho-Mansfield, G., Wang, D., Pandit, S., and Fu, X.D. 2008. The splicing factor SC35 has an active role in transcriptional elongation. Nature structural & molecular biology 15, 819-26. Livak, K.J., and Schmittgen, T.D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-CT method. Methods 25, 402-408. Loeffler, F., Frosch, P. 1898. Report of the commission for research on foot-and-mouth disease." Zentrabl. Bacteriol. Parastenkunde Infektionkrankh 23: 371-391. Lopato, S., Waigmann, E., Barta, A. 1996. Characterization of a Novel Arginine/SerineRich Spciling Factor in Arabidopsis. The Plant Cell 8, 2255-2264. Lu, L., Zhou, S.Y., Chen, C., Weng, S.P., Chan, S.M., He, J.G., 2005. Complete genome sequence analysis of an iridovirus isolated from the orange- spotted grouper, Epinephelus coicodes. Virology 339, 81-10. Lu, H., Yang , Y., Allister, E.M., Wijesekara, N., Wheeler, M.B. 2008. The identification of potential factors associated with the development of type diabetes: a quantitative proteomics approach. Mol Cell Proteomics 7, 1434-51 Luger K., Mäder A. W., Richmond R .K., Sargent D. F. , and Richmond T. J. 1997. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389 (6648): 251–60. Maller, J. L., Foulkes, J. G., Erikson, E. & Baltimore, D. (1985). Phosphorylation of ribosomal protein S6 on serine after microinjection of the Abelson murine leukemia virus tyrosine-specific protein kinase into Xenopus oocytes. Proc. Natl. Acad. Sci. USA 82, 272-276. 131 Martin C., and Zhang Y. 2005. The diverse functions of histone lysine methylation. Nat Rev Mol Cell Biol. (11):838-49 McGhee, J.D., and Felsenfeld, G. 1980. Nucleosome structure. Annu. Rev. Biochem. 49, 1115-56. Meyers, G., Tautz, N., Dubovi, E.J., Thiel. H.J., 1991. Viral cytopathogenicity correlated with integration of ubiquitin-coding sequences. Virology 180, 602-612. Nakatsu, F., Sakuma, M., Matsuo, Y., Arase, H., Yamasaki, S., Nakamura, N., Saito, T., Ohno, H., 2000. A di-leucine signaling the ubiquitin moiety: possible involvement in ubiquitin-mediated endocytosis. J Biol Chem. 275, 26213-26219. Nash, G , Anderson, I.G , Shariff, M., and Shamsudin, M. N. 1987. Bacteriosis associated with epizootic in the giant sea perch, Later calcarifer, and the estuarine grouper, Epinephelus tauvina, cage cultured in Malaysia. Aquaculture 67:105-111. Okada Y., Feng Q., Lin Y., Jiang Q., Li Y., Coffield V. M., Su L., Xu G., Zhang Y. 2005. hDOT1L links histone methylation to leukemogenesis. Cell 121, 167–178. Overhauser, A.W., 1953. Polarization of Nuclei in Metals. Phys. Rev. 92, 411-415. Pacifico, F., Paolillo, M., Chiappetta, G., Crescenzi, E., Arena, S., Scaloni, A., Monaco, M., Vascotto, C., Tell, G., Formisano. S., Leonardi, A. 2007. RbAp48 is a target of nuclear factor kappaB activity in thyroid cancer. J Clin Endocrinol Metab 92, 1458-66. Pang, Y., Yu, J., Wang, L., Hu, X., Bao, W., Li, G., Chen, G., Han, H., Hu, S., Yang, H., 2001. Sequence analysis of the Spodoptera litura Multicapsid Nucleopolyhedrovirus Genome. Virology 287, 391-404. Park, Y., Shin, C.Y., Lee, W.J., Jo, M.J., Ryu, J.R., Choi, E.Y., Kim, K.C., Ko, K.H. 2001. Immunological characterization of a mucin- asscociated protein from hamster tracheal epithelial cell culture. Hybridoma. 20 (2): 123-129. Peterson C. L. and Laniel M. A. 2004. Histones and histone modifications. Curr. Biol. 27;14(14):R546-51 Pham, A.D., Sauer, F., 2000. Ubiquitin activating/conjugating activity of TAF250, a mediator of activation of gene expression in Drosophila. Science 289, 2357-2360. Pierce et al., 2007. Eight-channel iTRAQ enables comparison of the activity of leukaemogenic tyrosine kinases. Mol. Cell. Proteomics Oct 21 (Epub ahead of print) Purcell, E.M., Torrey, H.C., and Pound, R.V., 1946. Resonance Absorption by Nuclear Magnetic Moments in a Solid. Phys. Res. 69, 37-38 132 Qin, Q.W., Lam, T.J., Sin, Y.M., Shen, H., Chang, S.F., Ngoh, G.H., Chen, C.L., 2001. Electron microscopic observations of a marine fish iridovirus isolated from brownspotted grouper, Epinephelus tauvina.J. Virol. Methods. 98, 17- 24. Qin, Q. W., S. F. Chang, G. H. Ngoh-Lim, S. Gibson-Kueh, C. Shi, and T. J. Lam. 2003. Characterization of a novel ranavirus isolated from grouper Epinephelus tauvina. Dis. Aquat. Organ. 53:1-9. Raghu, H., Sharma-Walia, N., Veettil, M.V., Sadagopan, S., Caballero, A., Sivakumar, R., Varge, L., Bottero, V., Chandran, B. 2007. Lipid rafts of primary endothelial cells are essential for Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8-induced phosphatidylinositol 3-kinase and RhoA-GTPases critical for microtubule dynamics and nuclear delivery of viral DNA but dispensable for binding and entry. J Virol 81, 7941-59 Redmann, K.L., Rechsteiner, M. 1989. Identification of the long ubiquitin extension as ribosomal protein S27a. Nature, 338: 438-440. Rehm, T., Huber, R., Holak, T.A. 2002. Application of NMR in structural proteomics: screening for proteins amenable to structural analysis. Structure 10(12), 1613-8. Reilly, L.M., Guarino, L.A., 1996. The viral ubquitin gene of Autographa californica Nuclear Polyhedrosis virus is not essential for viral replication. Virology 218 : 243-247. Ridley, A.J. 2001. Rho family proteins: coordinating cell responses. Trends Cell Biol 11, 471-477. Robzyk, K., Recht, J., Osley, M.A., 2000. Rad6 dependent ubiquitination of histone H2B in yeast. Science 287, 501-504. Ross et al,. 2004. Multiplexed protein quantitation in Saccharomyces cerevisiae using amine-reactive isobaric tagging reagent. Mol. Cell. Proteomics 3(12), 1154-70. Seth, G., Philp, R.J., Jiun, K.Y., Yap, M., Hu, W.S. 2007. Molecular portrait of high productivity in recombinant NS0 cells. Biotechnol Bioeng 97, 933-51. Schlesinger, D.H., Goldstein, G., Niall, H.D., 1975. The complete amino acid sequence of ubiquitin, an adenylate cyclase stimulating polypeptide probably universal in living cells. Biochemistry 14, 2214-2218. Schwartz, A.L., Ciechanover, A., 1999. The ubiquitin proteasome pathway and pathogenesis of human diseases. Annual Review of Medicine 50, 57-74. Sheehan, J.K., Kesimer, M., Pickles, R. 2006. Innate immunity and mucus structure and function. Norvatis Found Symp. 279, 155-166; discussion 167-9, 216-9. Shih, S.C., Sloper-Mould, K.E., Hicke, L., 2000. Monoubiquitin carries a novel 133 internalization signal that is appended to activated receptors. EMBO J . 19, 187-198. Song. W., Qin. Q., Qiu. J., Huang. C., Wang. F., and Hew. C. L. 2004. Functional genomics analysis of Singapore grouper iridovirus: complete sequence determination and proteomic analysis. Journal of Virology 78: 12576- 12590. Song, W., Lin, Q., Joshi, S.B., Lim, T.K., and Hew, C.L. 2006. Proteomic Studies of the Singapore Grouper Iridovirus. Mol. Cell. Proteomics 5, 256-264. Spence, J., Sadis, S., Hass, A.L., Finley, D., 1995. A ubiquitin mutant with specific defects in DNA repair and multiubiquitination. Mol Cell Biol.15, 1265-1273. Summerton, J. 1999. Morpholino Antisense Oligomers: The Case for an RNase-H Independent Structural Type. Biochimica et Biophysica Acta, 1489, 141-158. Summerton, J. Morpholinos and PNAs compared. Lett. Pep. Sci. 2004, 10, 215-236. Summerton, J. 2007. Morpholino, siRNA, and S-DNA compared: impact of structure and mechanism of action on off-target effects and sequence specificity. Current topics in Med. Chem. 7, 651-660. Summerton, J., and Weller, D. Morpholino Antisense Oligomers: Design, Preparation and Properties. Antisense Nucleic Acid Drug Dev. 1997, 7, 187-195. Sturgill, T.W., Ray, L.B., Erikson, E., Maller.J.L. 1988. Insulin-stimulated MAP-2 kinase phosphorylates and activates ribosomal protein S6 kinase II. Nature 334, 715-8. Tettelin et al. 2005. Genome analysis of multiple pathogenic isolates of Streptococcus agalactiae: implications for the microbial 'pan-genome'. Proc. Natl. Acad. Sci. U.S.A. 102:13950-13955. Tidona, C.A., Schnitzler, P., Kehm, R., Darai, G. 1998. Is the major capsid protein of iridoviruses a suitable target for the study of viral evolution? Virus Genes 16, 59-66. Ting, J.W., Wu, M.F., Tsai, C.T., Lin, C.C., Guo, I.C., and Chang, C.Y. 2004. Identification and characterization of a novel gene of grouper iridovirus encoding a purine nucleoside phosphorylase. J. Gen. Viol. 85, 2882-2892. Tsai, C.T., Ting, J.W., Wu, M.S., Wu, M.F., Guo, I.C., Chang, C.Y. 2005. Complete genome sequence of the grouper iridovirus and comparison of genomic organization with those of other iridoriviruses. Journal of Virology 79, 2010-2023. Twyman, R.M. 2004. Principles of proteomics. Garland Science/ BIOS Scientific Publishers, UK. 134 Veettil, M.V., Sharma-Walia, N., Sadagopan, S., Raghu, H., Sivakumar, R., Naranatt, P.P., Chandran, B. 2006. RhoA-GTPase facilitates entry of Kaposi’s sarcoma-associated herpesvirus into adherent target cells in a Src-dependent manner. J Virol 80, 11432-46. Wang, F., Bi, X., Chen., L.M., and Hew, C.L. 2008. ORF018R, a highly abundant virion protein from Singapore grouper iridovirus, is involved in serine/threonine phosphorylation anf virion assembly. Journal of General Virology 89, 1169-1178. Wang, J., and Manley, J.L. 1995. Overexpression of the SR protein ASF/SF2 and SC35 influences alternative splicing in vivo in diverse ways. RNA 1, 335-46. Westwood. Melissa, Aplin, J.D., Collinge, I.A., White. Anne, Gibson, J.M. 2001. Alpha 2- Macroglobulin : a new component in the insulin-like growth factor/ insulin- like growth factor binding protein-1 axis. J Biol Chem. 256 (45): 41668- 74. Williams, T. 1996. The iridoviruses. Advances in virus research. 46: 345-412. Williams, T., Barbosa-Solomieu, V., and Chinchar, V. G. 2006. A decade of advances in iridovirus research. Advances in virus research 65: 173-248. Wherlock M. and Mellor H. 2002. The Rho GTPase family: a Racs to Wrchs story. Journal of Cell Science 115, 239-240 Wrigley, N.G. 1969. An Electron microscope studey of the structure of Sericesthis Iridescent Virus. J. Gen. Virol. 5, 123-134. Wu, B.F, Lagrazon, K., Yuan, W., Baer, R. 2003. The BRCA1/BARD1 heterodimer assembles polyubiquitin chains through an unconventional linkage involving lysine residue K6 of ubiquitin. J Biol Chem. 278, 34743-34746. Xiao, R., Sun,Y., Ding, J.H., Lin, S., Rose, D.W., Rosenfeld, M.G., Fu, X.D., and Li, X. 2007. Splicing regulator SC35 is essential for genomic stability and cell proliferation during mammalian organogenesis. Molecular and cellular Biology 27, 5393-402. Xu, Y., Zheng, Y., Fan, J.S. and Yang, D. 2006. A new strategy for structure determination of large proteins in solution without deuteration. Nat Methods 3, 931-7 Yan, X., Zhao, X., Qian, M., Guo, N., Gong, X., Zhu, X. 2000. Characterization and gene structure of a novel retinoblastoma protein associated protein similar to the transcription regulator TFII-I. Biochem J. 345, 749-57. Young, D.W. 1986. The biosynthesis of the vitamins thiamin, riboflavin and folic acid. Nat Prod Rep. Aug (4), 395-419. Zieske, L.R. 2006. A perspective on the use of iTRAQTM reagent technology for protein complex and profiling studies. J Exp Bot 57, 1501-8. 135 http://www.astbury.leeds.ac.uk/facil/MStut/mstutorial.htm http://www.ncbi.nlm.nih.gov/blast/Blast 136 Appendix pGEX-6P-1 Luria- Bertani (LB) medium and agar plate LB broth (per liter) To 950 mL of MQ H2O, add: Bacto-tryptone 10 g Bacto-yeast extract g NaCl 10 g Dissolve solutes. Adjust pH to 7.0 with M NaOH. Adjust volume to 1L with MQ H2O. Sterilize by autoclaving. For LB agar plates, the medium was supplemented with 15 g/L agar and sufficient amount of appropriate antibiotics (if required). Ampicillin (Amp) g of Ampicillin was dissolved in 10 ml of autoclaved MQ H2O to get a final concentration of 100 mg/ml. The stock solution was sterile- filtered through 0.22 μm membrane and stored in aliquots at -20 oC until use. The stock solution was diluted : 1000 when added to the medium. Tfb I (per liter) To 950 mL of MQ H2O, add: CH3COOK 2.94 g RbCl 12.1 g CaCl2∙2H2O 14.7 g 137 MnCl2∙4H2O Glycerol 9.9 g 150 mL Adjust pH to 5.8 with dilute acetic acid, add MQ H2O to L and autoclave. Tfb II (per liter) To 950 mL of MQ H2O, add: MOPS 2.1 g CaCl2 11.1 g RbCl 1.21 g Glycerol 150 mL Adjust pH to 6.5 with M NaOH, add MQ H2O to L and autoclave. PCR The PCR reaction was performed by thermal cycler under the program of four steps: (i) initial denature at 94 oC for mins; (ii) 30 cycles of 95 oC for 30 sec, 50 oC – 58 oC for 30 sec and 72 oC for 60 sec; (iii) final extension at 72 oC for 15 mins. The parameters are needed to be optimized to overcome nonspecific or unsuccessful reactions. Agarose gel electrophoresis Agarose gel electrophoresis was used to analyze the amplified PCR products or plasmids or enzyme digestion of plasmid or DNA In this study, 1.2% agarose was used. 1.2 g of agarose was dissolved in 100 μL of 1X TAE buffer containing 10 μL/mL ethidium bromide. 10X Tris- acetate- EDTA (TAE) buffer (per lillter) Tris –base Acetic acid EDTA MQ water. 48.4 g Tris- base 10.9 ml 2.92g 1L Cell culture medium (per litter) EMEM FBS NaCl Penicillin G Streptomycin sulfate HEPES NaHCO3 9.66 g 100 mL 2.67 g × 105 IU 0.1 g 1.3 g 0.525 g Sigma, #M-0643 Sigma, #F-2442 The medium was then filter in the cell culture hood. 10 × TE buffer (per liter) 138 To 950 mL of MQ H2O, add: Tris 6.05 g EDTA 0.292 g Adjust pH to 7.4 with M HCl and add MQ H2O to L. Isopropyl β-D-1- thiogalactopyranoside (IPTG) 2.38 g of IPTG was dissolved in 10 ml of autoclaved MQ H2O to get a final concentration of M. The stock solution was sterile- filtered through 0.22 μm membrane and stored in aliquots at -20 oC until use. 5X M9 salt buffer (per litter) Na2HPO4 33.89g KH2 PO4 15g NaCl 2.4g H2O added to L The buffer was then autoclaved at 121 oC for 20 min. M9 medium (per litter) 5X M9 salt buffer M MgSO4 Thiamine 1M CaCl2 100 mg/ml Ampicillin (15NH4)2SO4 Glucose 13 C Glucose 200 mL mL 10 mg 0.1 mL mL gr gr if M9 is used for single 15N protein label gr if M9 is used for double 15N/ 13C protein label All the reagents except M9 salt were filtered using 0.22 μm membrane dd H2O was added to get final volume of litter 139 Publication and conference attendence Tran, B.N., Liu, Y., and Hew, C.L. 2008. Comparative sequence analysis and NMR structure of a ubiquitin-like protein from Singapore grouper iridovirus. Poster presentation at Experimental Biology 2008 conference, San Diego, USA. Travel award winner for post-graduate student. Chen*. L.M., Tran*, B.N., Lin, Q., Lim, T.K., Wang, F., and Hew, C.L. 2008. iTRAQ analysis of Singapore grouper iridovirus infection in a grouper embryonic cell line. J Gen Virol 89, 2869-76. 140 [...]... Song W., Qin Q., Qiu J., Huang C., Wang F., and Hew C L 20 04 Functional genomics analysis of Singapore grouper iridovirus: complete sequence determination and proteomic analysis Journal of Virology 78: 125 76- 125 90 Song, W., Lin, Q., Joshi, S.B., Lim, T.K., and Hew, C.L 20 06 Proteomic Studies of the Singapore Grouper Iridovirus Mol Cell Proteomics 5, 25 6 -26 4 Spence, J., Sadis, S., Hass, A.L., Finley,... epithelial cell culture Hybridoma 20 (2) : 123 - 129 Peterson C L and Laniel M A 20 04 Histones and histone modifications Curr Biol 27 ;14(14):R546-51 Pham, A.D., Sauer, F., 20 00 Ubiquitin activating/conjugating activity of TAF250, a mediator of activation of gene expression in Drosophila Science 28 9, 23 57 -23 60 Pierce et al., 20 07 Eight-channel iTRAQ enables comparison of the activity of 6 leukaemogenic tyrosine... short-lived protein Science 24 3, 1576-83 126 Chen, L.M., Wang, F., Song, W.J., Hew, C.L., 20 06 Temporal and differential gene expression of Singapore grouper iridovirus Journal of General Virology 87, 29 07 29 15 Chew-Lim, M., Ngoh, G.H., Ng, M.L., Lee, J.M., Chew, P., Li, J., Chan, Y.C., and Howe, J.L.C 1994 Grouper cell line for propagating grouper viruses Singapore J Primary Ind 22 , 113-116 Chua, F.H.,... Membr Biol 20 : 27 -33 Li, L., Donly, C., Li, Q., Willis, L.G., Keddil, B.A., Erlandson, M.A., Theilmann, D.A., 20 02 Identification and genomic analysis of a second species of Nucleopolyhedrovirus isolated from Mamestra configurata Virology 29 7, 22 6 -24 4 Li, Z., Lin, Q., Chen, J., Wu, J.L., Lim, T.K., Loh, S.S., Tang, X., and Hew, C.L 20 07 Shotgun identification of the structural proteome of shrimp white... transcriptome and proteome comparisons Proteomics 8, 1165-9 Jacquenet, S., Decimo, D., Muriaux, D and Darlix, J.L 20 05 Dual effect of the SR protein ASF/SF2, SC35 and 9G8 on HIV-1 RNA splicing and virion production Retrovirology 22 , 2- 33 Jakob, N.J., Muller K, Bahr U, Darai G 20 01 Analysis of the first complete DNA sequence of an invertebrate iridovirus: coding strategy of the genome of Chilo iridescent... W.W., and Packart, M., 1946 Nuclear Induction Phys Rev 69, 127 150 Branden C, Tooze J 1999 Introduction to Protein Structure Garland Publishing, New York, p 25 1 -28 1 Branden, C., and Tooze, J 1999 Introduction to Protein Structure Garland Publishing, New York, p 25 1 -28 1 Caron, E., Hall, A 1998 Identification of two distinct mechanisms of phagocytosis controlled by different Rho GTPases Science 28 2, 1717 -21 ... Protein MW (Da) 129 768.6 0.6634 02 2 629 8 .25 0.579507 23 111.84 0.573601 gi|566 926 83 ORF 125 R gi|566 927 62 ORF140R gi|566 927 77 36630.86 Zgc:55876 protein [Danio rerio] gi|41946787 26 663.96 gi|9837439 27 455.31 21 775.95 gi|4 722 8056 64087.05 gi |21 357415 51969.66 337 52. 51 NS L S IE S L NS 1.465898 gi |20 139890 L 0.649397 Ornithine aminotransferase precursor CG87 82- PA [Drosophila melanogaster] S 0.648509 unnamed... A.J.P., Hoffart, E., Etten, J.L.V., 20 07 Sequence and annotation of the 28 8-kb ATCV-1 virus that infects and endosymbiotic chlorella strain of the heliozoon Acanthocystis turfacea Virology 3 62, 350-361 Freeman,R., Anderson,W.A., 19 62 Use of weak perturbing radio-frequency fields in nuclear magnetic double resonance J Chem Phys 37, 20 53 -20 73 Gan, C.S., Chong, P.K., Pham, T.K., and Wright P.C 20 06 Technical,... repair and multiubiquitination Mol Cell Biol.15, 126 5- 127 3 Summerton, J 1999 Morpholino Antisense Oligomers: The Case for an RNase-H Independent Structural Type Biochimica et Biophysica Acta, 1489, 141-158 Summerton, J Morpholinos and PNAs compared Lett Pep Sci 20 04, 10, 21 5 -23 6 Summerton, J 20 07 Morpholino, siRNA, and S-DNA compared: impact of structure and mechanism of action on off-target effects and. .. 1 02: 13950-13955 Tidona, C.A., Schnitzler, P., Kehm, R., Darai, G 1998 Is the major capsid protein of iridoviruses a suitable target for the study of viral evolution? Virus Genes 16, 59-66 Ting, J.W., Wu, M.F., Tsai, C.T., Lin, C.C., Guo, I.C., and Chang, C.Y 20 04 Identification and characterization of a novel gene of grouper iridovirus encoding a purine nucleoside phosphorylase J Gen Viol 85, 28 82- 2892 . gi|566 926 44 323 09 .26 0.379483 L S ORF012L gi|566 926 49 129 768.6 0.6634 02 L NS ORF046L gi|566 926 83 26 298 .25 0.579507 L S ORF 125 R gi|566 927 62 23 111.84 0.573601 IE S SGIV protein ORF140R gi|566 927 77. protein ORF101R gi|566 927 38 1. 122 194 1.8 020 55 IE NS Retinoblastoma A associated protein [Xenopus laevis] gi|14 823 5471 5 122 5.35 0.5770 92 VAMP -2 [Macaca mulatta] gi|7413 620 1 138 52. 87 0.61 922 8 PREDICTED:. 4.3 .2 Effect of MO 135 knock-down on SGIV and host proteins expressions To study the effect of knock-downs on the viral and host proteins expressions, we analyzed the protein profile of knock-down