Isolation and characterization of stem cell regulatory genes oct4 and stat3 from the model fish medaka LIU RONG NATIONAL UNIVERSITY OF SINGAPORE 2006 Isolation and characterization of stem cell regulatory genes oct4 and stat3 from the model fish medaka LIU RONG (Master of Biological Sciences) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF SCIENCE DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2006 Acknowledgement Acknowledgement I first would like to thank Associate Professor Hong Yunhan, my supervisor, for his scientific guidance and patience I would like to thank my lab colleagues: Madam Deng Jiaorong, Madam Veronic Wong, Haobin, Tongming, Weijia, Meng Huat, June, Kat, Tianshen, Mingyou, Zhendong, Wenqin, Xiaoming, Lianju, Zhiqiang, Jene, Leon and Feng I also wish to thank my fellow graduate students Wenjun, Zhiyuan, Min, Yu and Jingang Thank you all for making these years’ fun ones and sharing your knowledge I wish to extend my heartfelt thanks to National University of Singapore (NUS) for providing me the scholarship, to Department of Biological Sciences for the opportunity to study and for facilities as well services The staff in the department is very nice In particular, I want to acknowledge Dr Philippa Melamed for sharing the luminometer, Dr Ng Huck Hui for several plasmids, Mr Loh Mun Seng for helps in frozen sectioning and to staff in DNA sequencing lab I am indebted to Dr Austin J Cooney, USA, for sharing his plasmids Finally, I owe my warmest thanks to the constant support of my family members for their encouragement and patience i Contents TABLE OF CONTENTS Acknowledgements i Contents ii List of tables and figures vii List of Abbreviations x Abstract xii Chapter I Introduction 1.1 Stem cells 1.1.1 Developmental potency of stem cells 1.1.2 Fundermental features of stem cells 1.1.3 Signalling pathways modulating pluripotency in stem cells 1.1.4 Transcription factors controlling pluripotency of stem cells 1.2 Transcription factor Oct4 1.2.1 POU (Pit-Oct-Unc) family 1.2.2 Structure and function of Oct4 Protein 1.2.3 Expression pattern of Oct4 11 1.2.4 Regulation of oct4 gene expression 12 1.2.4.1 Regulation by upstream promoter 12 1.2.4.2 Regulation by epigenetic mechanism 13 1.2.4.3 Regulation by transcription factors 14 1.2.5 Molecular interaction of Oct4 in ES cells 15 1.2.6 Oct4 in animals 18 1.3 Transcription factor Stat3 19 1.3.1 STAT family 20 1.3.2 Expression pattern of stat3 25 1.3.3 Biological functions of Stat3 in pluripotency 25 1.3.4 Molecular interaction of Stat3 in ES cells 26 ii Contents 1.4 Medaka as a model organism 28 1.4.1 General features of medaka as a model organism 28 1.4.2 Medaka as unique model for stem cell research 29 1.5 The objective of this study Chapter II Materials and methods 2.1 Materials 31 32 32 2.1.1 Organisms 32 2.1.2 Cells 32 2.1.3 Oligonucleotides 32 2.1.4 Plasmids 33 2.2 Methods 2.2.1 RNA work 35 35 2.2.1.1 Isolation of total RNA from tissue and cells 35 2.2.1.2 Spectrophotometric quantization of nucleic acids 35 2.2.1.3 In situ hybridization analysis of RNA 36 2.2.1 3.1 Labeling of RNA with DIG 36 2.2.1.3.2 In situ hybridization on frozen tissue sections 37 2.2.1.3.3 In situ hybridization on whole embryos 37 2.2.2 DNA work 2.2.2.1 Preparation of DNA 38 38 2.2.2.1.1 Isolation of genomic DNA from the whole fish 38 2.2.2.1.2 Isolation of plasmid DNA from E.coli 39 2.2.2.2 Gel electrophoresis of DNA 40 2.2.2.2.1 DNA electrophoresis on native agarose gels 40 2.2.2.2.2 DNA eletrophoresis on native polyacrylamide gels 41 2.2.2.2.3 Recovery of DNA fragments following gel eletrophoresis 42 2.2.2.2.4 Purification of synthetic oligonucleotides by PAGE 43 2.2.2.3 Polymerase Chain Reaction (PCR) 43 2.2.2.3.1 Standard PCR 43 2.2.2.3.2 RT- PCR 44 iii Contents 2.2.2.3.3 Degenerate PCR 45 2.2.2.3.4 RACE- PCR 45 2.2.2.3.5 Colony PCR 46 2.2.2.4 Cloning DNA fragment in Plasmids 47 2.2.2.4.1 Digestion of DNA with restriction endonucleases 47 2.2.2.4.2 Filling of 5´-Protruding terminal of DNA fragments 47 2.2.2.4.3 5’ phosphorylation of DNA with T4 polynucleotide kinase 48 2.2.2.4.4 DNA ligation 48 2.2.2.4.5 Transformation of E.coli 48 2.2.2.5 DNA Sequencing and sequence analysis 50 2.2.2.6 Labeling of DNA probes and Southern blot analysis of DNA 51 2.2.3 Protein work 53 2.2.3.1 Protein extraction 53 2.2.3.2 Protein assay 53 2.2.3.3 SDS-PAGE 53 2.2.3.4 Anti-peptide antibody production 54 2.2.3.5 Western blot analysis 55 2.2.3.6 Immunohistochemistry 56 2.2.4 DNA-Protein interaction: EMSA 57 2.2.5 Gene transfer into eukaryotic cells and expression analysis in vitro 60 2.2.5.1 Construction of plasmid of DNA 60 2.2.5.2 Cell culture 61 2.2.5.2.1 Culture conditions 61 2.2.5.2.2 Freezing and thawing of the cells 62 2.2.5.2.3 Transfection of cells 63 2.2.5.3 Promoter analysis with Luciferase 63 2.2.6 Gene transfer into fish embryos and expression analysis in vivo 64 2.2.7 Misccellaneous 65 2.2.7.1 Microscope and photograph 65 2.2.7.2 Promoter sequence analysis 65 iv Contents Chapter III Results 3.1 Cloning and characterization of medaka oct4 67 67 3.1.1 Cloning and identification of medaka oct4 cDNA 67 3.1.2 RNA expression of medaka oct4 73 3.1.2.1 Expression patterns by RT-PCR 73 3.1.2.2 Spatiotemporal RNA expression during embryogenesis 74 3.1.2.3 Spatiotemporal RNA expression during gametogenesis 76 3.1.3 Expression of Medaka Oct4 protein 78 3.1.3.1 Production and characterization of antibody against medaka Oct4 78 3.1.3.3 Medaka Oct4 protein expression by immunofluroscense 80 3.1.4 Subcellular localization of medaka Oct4 81 3.1.5 Binding of medaka Oct4 to an octamer consensus sequence 83 3.1.6 The medaka oct4 gene organization and evolution 85 3.1.6.1 Single copy oct4 gene 85 3.1.6 Exon–intron structure of oct4 gene 85 3.1.6.3 Conserved synteny between oct4 genes 86 3.1.7 Medaka Oct4 promoter sequence analysis 90 3.1.8 Activity of the medaka Oct4 promoter in vivo in medaka embryos 91 3.1.9 Activity of the medaka Oct4 promoter in vitro in medaka cells 92 3.1.9.1 5’deletion analysis of the medaka Oct4 promoter 94 3.1.9.2 RA- downregulation of medaka oct4 97 3.1.9.3 Autoregulation of medaka oct4 98 3.1.9.4 Cooperative regulation by Oct4 and Sox2 100 3.1.9.4.1 Identification of Oct4-Sox2 elemenent 95 3.1.9.2.2 Synergistic regulation by Oct4 and Sox2 97 3.1.9.2.3 OSE alone is sufficient for regulated expression 3.2 Cloning and characterization of two isoforms of the medaka stat3 104 109 3.2.1 Isolation of stat3 cDNAs from the medaka 109 3.2.2 Medaka Stat3 produces two isoforms Stat3a and Stat3b 112 3.2.3 The medaka stat3 gene organization and evolution 116 3.2.4 Medaka stat3 mRNA expression pattern 116 v Contents 3.2.5 Medaka Stat3 regulates Oct4 and Nanog promoters 118 Chapter IV Discussion 4.1 Medaka oct4 120 4.1.1 Medaka oct4 120 4.1.2 Medaka oct4 expression 122 4.1.3 Medaka oct4 regulation 126 4.2 Medaka stat3 130 4.2.1 Medaka stat3 130 4.2.2 Medaka stat3 mRNA expression 132 4.2.3 Medaka Stat3 trans-activation activity 133 Chapter V Conclussion 136 5.1 The main findings in this study 136 5.2 Future directions 137 Appendix 140 Reference 143 vi List of Abbreviations List of Tables and Figures Table Comparison of ESCs from mouse and human Tabel Basic plasmids used in the study 34 Table Identity values between vertebrate Oct4 proteins 72 Fig.1-1 Stem cell hierarchy Fig.1-2 Intracellular signalings and crosstalks in mouse ES cells Fig.1-3 Transcription factors in early mouse embryos and ES cells Fig.1-4 Interaction of Oct4-POU/Sox2-HMG complexes on UTF1 gene 10 Fig 1-5 Regulatory circuitry in hESCs 17 Fig 1-6 Domain structure of STATs 20 Fig 1-7 Alternative splicing variants and protein isoforms Stat3 23 Fig 1-8 LIF/JAK/STAT pathways 24 Fig 3-1 Cloning strategy of the medaka oct4 (Oloct4) 69 Fig.3-2 Sequences of Oloct4 cDNA and its deduced protein 70 Fig 3-3 Alignment of medaka Oct4 protein and its homologs 71 Fig 3-4 Phylogenetic relationship of medaka Oct4 72 Fig 3-5 Expression of Oloct4 in medaka adult tissues and embyos 73 Fig 3-6 In situ hybridization of Oloct4 during embryogenesis 75 Fig 3-7 In situ hybridization of Oloct4 during gametogenesis 77 Fig 3-8 Titration of rabbit antiserum against medaka Oct4 using ELISA 79 Fig 3-9 Protein expression of medaka Oct4 by western blot 79 Fig 3-10 Immunostaining of medaka OlOct4 protein in female germ cells 80 Fig 3-11 Nuclear localization of OlOct4 in cells 82 vii Introduction Fig 3-12 EMSA analysis of Oct4 binding to the octamer consensus oligo 84 Fig 3-13 Southern blot analysis of the Oloct4 88 Fig 3-14 Schematic genomic structure of Oloct4 88 Fig 3-15 C-terminal oct4 sequence comparison between medaka and zebrafish 89 Fig 3-16 Syntenic relationships of oct4-bearing chromosomes in vertebrates 89 Fig 3-17 Nucleotide sequence of the the OlOct4 promoter 92 Fig 3-18 Activity of OlOct4 promoter in early medaka embryos 93 Fig 3-19 Deletion analysis of the OlOct4 promoter 96 Fig 3-20 Downregulation of OlOct4 promoter activity by retinoic acid 97 Fig 3-21 Autoregulation of medaka oct4 99 Fig 3-22 Synergistic regulation of medaka Oct4 promoter by Oct4 and Sox2 103 Fig 3-23 Oct4-Sox2 element can drive expression in medaka stem cells 106 Fig 3-24 Activation of Oct4-Sox2 element by Oct4 and Sox2 108 Fig 3-25 Scheme for cloning medaka stat3 cDNA 110 Fig 3-26 Sequence of medaka stat3 cDNAs and proteins 111 Fig 3-27 Homology of vertebrate Stat3 proteins 114 Fig 3-28 Phylogenetic tree of Stat3 proteins 115 Fig 3-29 Schematic domain structure of medaka Stat3a and Stat3b proteins 115 Fig 3-30 Schematic structure of medaka stat3 115 Fig 3-31 RNA expression pattern of medaka stat3 in adult tissues 117 Fig.3-32 OlStat3 isoforms differentially regulate Oct4 and Nanog promoters 119 viii Appendix Appendix Table The sequence of primers and oligonucleotides used for cloning cDNA Primers pair 5′ primer 3′ primer Size (bp) The sequence of primers used for cloning cDNA and RT-PCR 1.1 For medaka oct4 Pou5/Pou3 ggnkwyacicargcigaygtigg ttytgickickrttrcaraacca 354 PR53/UPM gtggtgcgtgtttggttctgcaaccgg ctaatacgactcactatagggca gtggtatcaacgcagagt 907 UPM/ PR52 ctaatacgactcactatagggca gtggtatcaacgcagagt cccgagctcctggaaaaggggcttcagct 1056 PP1/PP2 ccgccatggatgtctgacaggccgcaca cccgaattctcatcctgtcaggtgaccta 1407 Pf1/pf3 cccaagcttgctgattgggaaaacctgt cccgagctcgagtttgaacacatttact 2412 PR53/Psb gtggtgcgtgtttggttctgcaaccgg atttgcacggcatgaacacaagcagcc 616 PR51/PP2 atgtgcaagctgaagccccttctccag cccgaattctcatcctgtcaggtgaccta 492 PR51/Psb atgtgcaagctgaagccccttctccag atttgcacggcatgaacacaagcagcc 750 1.2 For medaka stat3 ST1/ST2 cccggatccatgggcncartggaycay cccgaattcgtnggngtnacrcadatraa 2163 SR31/Ssb ctgtggaacgaaggatacatcatgggc acaggatggagacaccaaacatttggc 1044 SR51/UPM cagttgcagcagctggagaccaggta ctaatacgactcactatagggca gtggtatcaacgcagagt 3013 UPM/SR53 ctaatacgactcactatagggca gtggtatcaacgcagagt atcctcctctccagctgctgcaactg 426 PS1/RPS2 atggctcagtggaatcagttgcagcag catggggaagcgacgtccatgtccaa 2340 SR31/RPS2 ctgtggaacgaaggatacatcatgggc catggggaagcgacgtccatgtccaa 563 Primers used for generation of medaka Oct4 promoter deletion and enhancer reporter constructs Xh2.0/H35P1 cccctcgaggatagaagttgagtcagatt cgcaagcttttctggccccacaggttt -2091/+28 Xh1.5/H35P1 ccccctccagccttttgcatgacaattctt cgcaagcttttctggccccacaggttt -1525/+28 Xh1.0/H35P1 ccccctccaggatcaaaaggtgaatgagt cgcaagcttttctggccccacaggttt -911/+28 142 Appendix Primers pair 5′ primer 3′ primer Size (bp) Primers used for generation of medaka Oct4 promoter deletion and enhancer reporter constructs XhOS2/H35P1 ccccctccagattcagactaaagctcag cgcaagcttttctggccccacaggttt -349/+28 Xh6Oc/H35P1 ccccctccagatcaaaggtcattcacaaa cgcaagcttttctggccccacaggttt -94/+28 Xh7Oc/H35p ccccctccagtcatttgagcttgaaggt caaaagcttggagtctttgacgtcccctc -39/+245 Xh8Oc/H35p ccccctccagggttatgtctcactaaaa caaaagcttggagtctttgacgtcccctc -98/+245 Xh6Oc/H35p ccccctccagatcaaaggtcattcacaa caaaagcttggagtctttgacgtcccctc -94/+245 Xh2.0/H35p cccctcgaggatagaagttgagtcagatt caaaagcttggagtctttgacgtcccctc -2091/+245 Xh1.5/H35p ccccctccagccttttgcatgacaattctt caaaagcttggagtctttgacgtcccctc -1525/+245 Xh1.0/H35p ccccctccaggatcaaaaggtgaatgagt caaaagcttggagtctttgacgtcccctc -911/+245 XhOS2/H35p ccccctccagattcagactaaagctcag caaaagcttggagtctttgacgtcccctc -349/+245 the oligonucleotides used for EMSA Oct-1F/R ggtgagctgcatctatgggctaatgagtc gactcattagcccatagatgcagctcacc Oc1 F/R gcggtaactgcttcttaatttgctaaccct gcggagggtatgcaaattaagaagcagtta Oc1Fm/Rm gcggtaactgcttcttacaagtgtgaccct gcggagggtcacacttgtaagaagcagtta 143 Appendix List of publications Journal Articles Hong Y., Liu T., Zhao H., Xu H., Wang W., Liu R., Chen T., Deng J and Gui J (2004) Establishment of a normal medakafish spermatogonial cell line capable of sperm production in vitro Proc Natl Acad Sci USA 101: 8011-8016 Liu.R and Hong Y Molecular cloning, expression pattern and promoter analysis of the oct4 gene in medaka (Oryzias laptias) In preparation 2006 Liu.R and Hong Y Cloning and characterization of two stat3 isoforms in medaka (Oryzias laptias) In preparation 2006 Conference Abstracts Liu.R and Hong Y Poster presentation “Molecular characterization of Oloct4, a key regulator of embryonic stem cells from medaka” at 30th Biology in Asia international conference, 7-10 Dec, 2004, Singapore Liu.R and Hong Y Oral presentation “Molecular cloning and developmental expression of an octamer-binding transcription factor-4 (oct4) from medaka” at 9th Biological Sciences Graduate Congress, 17-20 Dec 2004, Thailand Liu.R and Hong Y Poster presentation “Characterization of stem cell marker oct4 from the model fish medaka” at 1st Faculty Graduate Congress, Oct 2005, Singapore Liu.R., Li MY and Hong Y Poster presentation “Characterization of an Oct4-like transcription factor from the model fish medaka” at 10th Biological Sciences Graduate Congress, Nov 2005, Singapore 144 Reference Reference Akira S., Nishio Y., Inoue M, Wang XJ., Wei S., Matsusaka T., Yoshida K., Sudo T., Naruto M and Kishimoto T (1994) Molecular cloning of APRF, a novel IFN stimulated gene factor p91-related transcription factor involved in the gp130mediated signaling pathway Cell 77: 63-71 Aizawa K., Shimada A., Naruse k., Mitani H., Shima A (2003) The medaka midblastula transition as reavealed by the expression of the paternal genome Gene Expr Patterns 3: 43-47 Avilion AA., Nicolis SK., Pevny LH., Perez L., Vivian N and Lovell- Badge R (2003) Multipotent cell lineages in early mouse development depend on SOX2 function Genes Dev 17:126-140 Azam M., Lee C., Strehlow I and Schindler C (1997) Functionally distinct isoforms of STAT5 are generated by protein processing Immunity 6: 691-701 Bachvarova RF., Masi T., Drum M., Parker N., Mason K., Patient R and Johnson AD (2004) Gene expression in the axolotl germ line: Axdazl, Axvh, Axoct-4, and Axkit Dev Dyn 231:871-80 Barnea E and Bergman Y (2000) Synergy of SF1 and RAR in activation of Oct-3/4 promoter J Biol Chem 275: 6608-6619 Béjar J., Hong Y and Schartl, M (2003) Mitf expression is sufficient to direct differentiation of medaka blastula derived stem cells to melanocytes Development 130: 6545–6553 Ben Shushan E, Pikarsky F, Klar A, Bergman Y (1993) Extinction of Oct-3/4 gene expression in embryonal carcinoma X fibroblast somatic cell hybrids is accompanied by changes in the methylation status, chromatin structure, and transcriptional activity of the Oct-3/4 upstream region Mol Cell Biol 13: 891–901 Ben-Shushan E., Sharir H., Pikarsky E and Bergman Y (1995) A dynamic balance between ARP-1/COUP-TFII, EAR-3/COUP-TFI, and retinoic acid receptor: retinoid X receptor heterodimers regulates Oct-3/4 expression in embryonal carcinoma cells Mol Cell Biol 15:1034-1048 Bernardi G and Bernardi G (1990) Compositional patterns in the nuclear genome of cold-blooded vertebrates J Mol Evol 31: 265-81 Biethahn S., Alves F., Wilde S., Hiddemann W and Spiekermann K (1999) Expression of granulocyte colony-stimulating factor– and granulocyte-macrophage colonystimulating factor–associated signal transduction proteins of the JAK/STAT pathway in normal granulopoiesis and in blast cells of acute myelogenous leukemia Exp Hematol 27: 885-94 Blau HM., Brazelton TR and Weimann JM (2001) The evolving concept of a stem cell: entity or function? Cell 105: 829–841 Boeuf H., Hauss C., Graeve FD., Baran N and Kedinger C (1997) Leukemia inhibitory factor-dependent transcriptional activation in embryonic stem cells J Cell Biol 138: 1207-17 Boiani M and Schöler HR (2005) Regulatory networks in embryo-derived pluripotent stem cells Nature Reviews Mol Cell Biol 6: 872-881 Boiani M., Eckardt S., Schöler HR and McLaughlin K J (2002) Oct4 distribution and level in mouse clones: consequences for pluripotency Genes Dev 16: 1209-1219 145 Reference Botquin V., Hess H., Fuhrmann G., Anastassiadis C., Gross MK., Vriend G and Scholer HR (1998) New POU dimer configuration mediates antagonistic control of an osteopontin preimplantation enhancer by Oct-4 and Sox-2 Genes Dev 12: 2073-2090 Boyer LA., Lee TI., Cole MF., Johnstone SE., Levine SS., Zucker JP., Guenther MG., Kumar RM., Murray HL., Jenner RG., Gifford DK., Melton DA., Jaenisch R and Young RA (2005) Core transcriptional regulatory circuitry in human embryonic stem cells Cell 122: 947–956 Brehm A., Ohbo K and Scholer HR (1997) The carboxy-terminal transactivation domain of Oct-4 acquires cell specificity through the POU domain Mol Cell Biol 17: 154-162 Brehm A., Ohbo K., Zwerschke W., Botquin V., Jansen-Durr P and Scholer HR (1999) Synergism with germ line transcription factor Oct-4: viral oncoproteins share the ability to mimic a stem cell-specific activity Mol Cell Biol 19: 2635-2643 Burgess S., Reim G., Chen W., Hopkins N and Brand M (2002) The zebrafish spielohne-grenzen (spg) gene encodes the POU domain protein Pou2 related to mammalian Oct4 and is essential for formation of the midbrain and hindbrain, and for pre-gastrula morphogenesis Development 129: 905–916 Caldenhoven E., van Dijk TB., Solari R., Armstrong J., Raaijmakers JA., Lammers JW., Koenderman L and de Groot RP (1996) STAT3beta, a splice variant 60 of transcription factor STAT3, is a dominant negative regulator of transcription J Biol Chem 271:13221-7 Cavaleri F and Scholer HR (2003) Nanog: a new recruit to the embryonic stem cell orchestra Cell 113: 551-557 Carpenter MK., Rosler ES., Fisk GJ., Brandenberger R., Ares X., Miura T., Lucero M and Rao MS (2003) Properties of four human embryonic stem cell lines maintained in a feeder-free culture system Dev Dyn 229: 243–258 Chakraborty SM., White TS., Schaefer ED., Ball DF., Dyer and Tweardy DJ (1996) Granulocyte colony-stimulating factor activation of Stat3α and Stat3β in immature normal and leukemic human myeloid cells Blood 88: 2442 Chakraborty A and Tweardy, D J (1998) Granulocyte colony-stimulating factor activates a 72-kDa isoform of STAT3 in human neutrophils J Leukoc Biol 64: 675680 Chambers I., Colby D., Robertson M., Nichols J., Lee S., Tweedie S and Smith A (2003) Functional expression cloning of nanog, a pluripotency sustaining factor in embryonic stem cells Cell 113: 643–655 Chambers I (2004) The molecular basis of pluripotency in mouse embryonic stem cells Cloning Stem Cells 6: 386–391 Chew JL., Loh YH., Zhang W., Chen X., Tam WL., Yeap LS., Li P., Ang YS., Lim B., Robson P and Ng HH (2005) Reciprocal transcriptional regulation of Pou5f1 and Sox2 via the Oct4/Sox2 complex in embryonic stem cells Mol Cell Biol 25: 6031-46 Chung AC., Katz D., Pereira FA., Jackson KJ., DeMayo FJ., Cooney AJ and O'Malley BW (2001) Loss of orphan receptor germ cell nuclear factor function results in ectopic development of the tail bud and a novel posterior truncation Mol Cell Biol 21: 663-677 Conway G (2006) STAT3-dependent pathfinding and control of axonal branching and target election Dev Biol 296:119-36 146 Reference Copeland NG., Gilbert DJ., Schindler C., Zhong Z., Wen Z., Darnell JE Jr., Mui AL., Miyajima A., Quelle FW., Ihle JN and et al (1995) Distribution of the mammalian Stat gene family in mouse chromosomes Genomics 29:225-8 Darnell JE., Jr (1997) STATs and gene regulation Science 277: 1630-5 Deb-Rinker P., Ly D., Jezierski A., Sikorska M and Roy Walker P (2005) Sequential DNA Methylation of the Nanog and Oct-4 Upstream Regions in Human NT2 Cells during Neuronal Differentiation J Biol Chem 280: 6257-6260 Decker T and Kovarik P (2000) Serine phosphorylation of STATs Oncogene 19:262837 Evans MJ and Kaufman, MH (1981) Establishment in culture of pluripotential cells from mouse embryos Nature 292:154–156 Forsyth NR., Wright WE and Shay JW (2002) Telomerase and differentiation in multicellular organisms: turn it off, turn it on, and turn it off again Differentiation 69:188-97 Frankenberg S., Tisdall D and Selwood L (2001) Identification of a homologue of POU5F1 (OCT3/4) in a marsupial, the brushtail possum Mol Reprod Dev 58: 255-61 Fuhrmann G., Chung AC., Jackson KJ., Hummelke G., Baniahmad A., Sutter J., Sylvester I., Scholer HR and Cooney AJ (2001) Mouse germline restriction of Oct4 expression by germ cell nuclear factor Dev Cell 1: 377-387 Gidekel S and Bergman Y (2002) A unique developmental pattern of Oct3/4 DNA methylation is controlled by a cis-demodification element J.Biol Chem 277: 3452134530 Gidekel S., Pizov G., Bergman Y and Pikarsky E (2003) Oct-3/4 is a dose-dependent oncogenic fate determinant Cancer Cell 4: 361-370 Ginis I., Luo Y., Miura T., Thies S., Brandenberger R., Gerecht-Nir S., Amit M., Hoke A., Carpenter MK., Itskovitz-Eldor J and Rao MS (2004) Differences between human and mouse embryonic stem cells Dev Biol 269: 360–380 Goto T., Adjaye J., Rodeck C H and Monk M (1999) Identification of genes expressed in human primordial germ cells at the time of entry of the female germ line into meiosis Mol Hum Reprod 5: 851-860 Greenstein D., Hird S., Plasterk RH., Andachi Y., Kohara, Y., Wang B., Finney M and Ruvkun G (1994) Targeted mutations in the Caenorhabditis elegans POU homeo box gene ceh-18 cause defects in oocyte cell cycle arrest, gonad migration, and epidermal differentiation Genes Dev 8: 1935-1948 Gu P., Goodwin B., C.-K Arthur C.-K Chung A., Xu X., Wheeler D., Price RP., Galardi C., Peng L., Latour AM., Koller BH., Gossen J., Kliewer AS and Cooney AJ (2005) Orphan nuclear receptor LRH-1 is required to maintain Oct4 expression at the epiblast stage of embryonic development Mol Cell Biol 25: 3492-3505 Haegele L., Ingold B., Naumann H., Tabatabai G., Ledermann B and Brandner S (2003) Wnt signalling inhibits neural differentiation of embryonic stem cells by controlling bone morphogenetic protein expression Mol Cell Neurosci 24: 696-708 Hansis C., Grifo JA and Krey LC (2000) Oct-4 expression in inner cell mass and trophectoderm of human blastocysts Mol Hum Reprod 6: 999-1004 Hattori N., Nishino K., Ko Y G., Hattori N., Ohgane J., Tanaka S and Shiota K (2004) Epigenetic Control of Mouse Oct-4 Gene Expression in Embryonic Stem Cells and Trophoblast Stem Cells J Biol Chem 279: 17063–17069 147 Reference Hauptmann G and Gerster T (1995) Pou-2 a zebrafish gene active during cleavage stages and in the early hindbrain Mech Dev 51: 127-138 Hauptmann G., Belting HG., Wolke U., Lunde K and Soll I (2002) Spiel ohne grenzen/pou2 is required for zebrafish hindbrain segmentation Development.129:1645-55 Henderson JK., Draper JS., Baillie HS., Fishel S., Thomson JA., Moore H and Andrews PW (2002) Preimplantation human embryos and embryonic stem cells show comparable expression of stage-specific embryonic antigens Stem Cells 20: 329–337 Herr W and Cleary MA (1995) The POU domain: versatility in transcriptional regulation by a flexible two-in-one DNA-binding domain Genes Dev 9: 1679-1693 Herr W., Sturm RA., Clerc RG., Corcoran LM., Baltimore D., Sharp,PA., Ingraham HA., Rosenfeld MG., Finney M., Ruvkun G and Horovitz, HR (1988) The POU domain: a large conserved region in the mammalian pit-1, oct-1, oct-2, and Caenorhabditis elegans unc-86 gene products Genes Dev 2: 1513-1516 Hevehan DL., Miller WM and Papoutsakis ET (2002) Differential expression and phosphorylation of distinct STAT3 proteins during granulocytic differentiation Blood 99:1627-37 Hong Y., Liu T., Zhao H., Xu H., Wang W., Liu R., Chen T., Deng J and Gui J (2004) Establishment of a normal medakafish spermatogonial cell line capable of sperm production in vitro Proc Natl Acad Sci USA 101: 8011-8016 Hong Y., Winkler C., Liu T., Chai G and Schartl M (2004) Activation of the mouse Oct4 promoter in medaka embryonic stem cells and its use for ablation of spontaneous differentiation Mech Dev 5: 33-44 Hong Y and Schartl M (1996) Establishment and growth responses of early medakafish (Oryzias latipes) embryonic cells in feeder layer-free cultures Mol Mar Biol Biotechnol 5: 93–104 Hong Y., Winkler C and Schartl M (1996) Pluripotency and differentiation of embryonic stem cell lines from the medakafish (Oryzias latipes) Mech Dev 60: 33– 44 Hong Y., Winkler C and Schartl M (1998) Production of medakafish chimeras from a stable embryonic stem cell line Proc Natl Acad Sci 95: 3679–3684 Howley C and Ho R 2000 mRNA localization patterns in zebrafish oocytes Mech Dev 92: 305-309 Hübner K., Fuhrmann G., Christenson LK., Kehler J., Reinbold R., De La FR., Wood J., Strauss IIIJF., Boiani M and Schöler HR (2003) Derivation of oocytes from mouse embryonic stem cells Science 300: 1251–1256 Ichiba M., Nakajima K., Yamanaka Y., Kiuchi N and Hirano T (1998) Autoregulation of the Stat3 gene through cooperation with a cAMP-responsive element-binding protein J Biol Chem 273: 6132-8 Lee J, Kim HK, Rho JY, Han YM, Kim J (2006) The human OCT-4 isoforms differ in their ability to confer self-renewal J Biol Chem 3: 281(44):33554-65 Levy DE and Lee CK (2002) What does Stat3 do? J Clin Invest 109: 1143–1148 Ihara S., Nakajima K., Fukada T., Hibi M., Nagata S., Hirano T and Fukui Y (1997) Dual control of neurite outgrowth by STAT3 and MAP kinase in PC12 cells stimulated with interleukin-6 Embo J 16: 5345-52 148 Reference Ilaria RL Jr (2001) STAT isoforms: mediators of STAT specificity or leukemogenesis? Leuk Res 25: 483-4 Imada K and Leonard WJ (2000) The Jak-STAT pathway Mol Immunol 37: 1-11 Iwamatsu, T (1994) Stages of normal development in the medaka Oryzias latipes Zool Sci 11: 825–839 Iwamatsu T., Ohta T., Oshima E and Sakai, N (1988) Oogenesis in the medaka Oryzias latipes: Stages of oocyte development Zool Sci 5: 353-373 Ivanov V.N., Bhoumik A., Krasilnikov M., Raz R., Owen-Schaub L.B., Levy D., Horvath, C.M and Ronai, Z (2001) Cooperation between STAT3 and c-jun suppresses Fas transcription Mol Cell 7: 517–528 Jaenisch R (1997) DNA methylation and imprinting: why bother? Trends Genet 13: 323-9 John S., Vinkemeier C., Soldaini E., Darnell JE Jr., and Leonard WJ (1999) The significance of tetramerization in promoter recruitment by Stat5 Mol Cell Biol.19:1910-8 Johnson A.D., Crother B., White M.E., Patient R., Bachvarova,R.F., Drum M and Masi T (2003) Regulative germ cell specification in axolotl embryos: a primitive trait conserved in the mammalian lineage Phil Trans R Soc Lond B 358: 1371–1397 Kato K., Nomoto M., Izumi H., Ise T., Nakano S., Niho Y and Kohno K (2000) Structure and functional analysis of the human STAT3 gene promoter: alteration of chromatin structure as a possible mechanism for the upregulation in cisplatin-resistant cells.Biochim.Biophys.Acta 1493: 91-100 Kato T., Sakamoto E., Kutsuna H., Kimura-Eto A., Hato F and Kitagawa S (2004) Proteolytic conversion of STAT3alpha to STAT3gamma in human neutrophils: role of granule-derived serine proteases J Biol Chem 279: 31076-80 Kim M., Yuan X., Okumura S and Ishikawa F (2002) Successful inactivation of endogenous Oct-3/4 and c-mos genes in mouse preimplantation embryos and oocytes using short interfering RNAs Bioche Biophy Res Comun 296:1372-1377 Kinoshita K., Ura H., Akagi T., Usuda M., Koide H., Yokota T (2007) GABPalpha regulatesOct-3/4 expression in mouse embryonic stem cells Biochem Biophys Res Commun 16: 353(3):686-91 .Kirchhof N., Carnwath JW., Lemme E., Anastassiadis K, Scholer H and Niemann H (2000) Expression pattern of Oct-4 in preimplantation embryos of different species Biol Reprod 63:1698-1705 Kirito K., Watanabe T., Sawada K., Endo H., Ozawa K and Komatsu N (2002) Thrombopoietin regulates Bcl-xL gene expression through Stat5 and phosphatidylinositol 3-kinase activation pathways J Biol Chem 277: 8329–8337 Klemm JD., Rould MA., Aurora R., Herr W and Pabo CO (1994) Crystal structure of the Oct-1 POU domain bound to an octamer site: DNA recognition with tethered DNA-binding modules Cell 77: 21-32 Kozak M (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes Cell 44: 283 Kuroda T., Tada M., Kubota H., Kimura H., Hatano SY., Suemori H., Nakatsuji N and Tada T (2005) Octamer and Sox elements are required for transcriptional cis regulation of Nanog gene expression Mol Cell Biol 25: 2475-2485 149 Reference Lunde K., Belting H G and Driever, W (2004) Zebrafish pou5f1/pou2, homolog of mammalian Oct4, functions in the endoderm specification cascade.Curr.Biol 14: 48 55 Lee C., Piazza F., Brutsaert S., Valens J., Strehlow I., Jarosinski M., Saris C and Schindler C (1999) Characterization of the Stat5 protease J Biol Chem 274: 2676775 Levy DE and Darnell JE Jr (2002) Stats: transcriptional control and biological impact Nat Rev Mol Cell Biol 3:651-62 Liu P., Wakamiya M., Shea MJ., Albrecht U., Behringer RR and Bradley A (1999) Requirement for Wnt3 in vertebrate axis formation Nature Genet 22: 361–365 Loh YH., Wu Q., Chew JL., Vega VB., Zhang W., Chen X., Bourque G., George J., Leong B., Liu J., Wong KY., Sung KW., Lee CW., Zhao XD., Chiu KP., Lipovich L., Kuznetsov VA., Robson P., Stanton LW., Wei CL., Ruan Y., Lim B and Ng HH (2006) The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells Nat Genet 38: 431-40 Looijenga LHJ, Stoop H, de Leeuw HPJ, de Gouveia Brazao CA, Gillis AJ, van Roozendaal KE, van Zoelen EJ, Weber RF, Wolffenbuttel KP, van Dekken H et al (2003) POU5F1 (OCT3/4) identifies cells with pluripotent potential in human germ cell tumors Cancer Res 63: 2244–2250 Magne S., Caron S., Charon M., Rouyez MC and Dusanter-Fourt I (2003) STAT5 and Oct-1 form a stable complex that modulates cyclin D1 expression Mol Cell Biol 23: 8934–8945 Maritano D., Sugrue ML., Tininini S., Dewilde S., Strobl B., Fu XP., Murray-Tait V., Chiarle R., and Poli V (2004) The STAT3 isoforms α and β have unique and specific functions Nat Immunol 5: 401-409 Martin GR (1981) Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells Proc Natl Acad Sci USA 78: 7634–7638 Matsuda T., Nakamura T., Nakao K., Arai T., Katsuki M., Heike T and Yokota T (1999) STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells Embo J 18: 4261-9 Minucci S., Botquin V., Yeom YI., Dey A., Sylvester I., Zand DJ., Ohbo K., Ozato K and Scholer HR (1996) Retinoic acid mediated down-regulation of Oct3/4 coincides with the loss of promoter occupancy in vivo EMBO J 15: 888–899 Mitalipov S., Kuo H., Hennebold J and Wolf D (2003) Oct-4 expression in pluripotent cells of the Rhesus Monkey Bio Reprod 69: 1785-1792 Mitsui K., Tokuzawa Y., Itoh H., Segawa K., Murakami M., Takahashi K., Maruyama M., Maeda M and Yamanaka S (2003) The homeoprotein nanog is required for maintenance of pluripotency in mouse epiblast and ES cells Cell 113: 631–642 Miyagi C., Yamashita S., Ohba Y., Yoshizaki H., Matsuda M and Hirano T (2004) STAT3 noncell-autonomously controls planar cell polarity during zebrafish convergence and extension J Cell Biol.166: 975-81 Monk M and Holding C (2001) Human embryonic genes re-expressed in cancer cells Oncogene 20: 8085-8091 .Moriggl R., Gouilleux-Gruart V., Jahne R., Berchtold S., Gartmann C., Liu X., Hennighausen L., Sotiropoulos A., Groner B and Gouilleux F (1996) Deletion of the 150 Reference carboxyl-terminal transactivation domain of MGF-Stat5 results in sustained DNA binding and a dominant negative phenotype Mol Cell Biol 16: 5691-700 Moriscot C., de Fraipont F., Richard MJ., Marchand M., Savatier P., Bosco D., Favrot M and Benhamou PY (2005) Human bone marrow mesenchymal stem cells can express insulin and key transcription factors of the endocrine pancreas developmental pathway upon genetic and/or microenvironmental manipulation in vitro Stem Cells 23:594-603 Morrison GM and Brickman JM (2006) Conserved roles for Oct4 homologues in maintaining multipotency during early vertebrate development Development 133: 2011-22 Murphy TL., Geissal ED., Farrar JD and Murphy KM (2000) Role of the Stat4 N domain in receptor proximal tyrosine phosphorylation Mol Cell Biol 20: 7121-31 Nichols J., Zevnik B., Anastassiadis K., Niwa H., Klewe-Nebenius D., Chambers I., Scholer H and Smith A (1998) Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4 Cell 95: 379–391 Nishimoto, M., Fukushima A., Okuda A and Muramatsu M (1999) The gene for the embryonic stem cell coactivator UTF1 carries a regulatory element which selectively interacts with a complex composed of Oct-3/4 and Sox-2 Mol Cell Biol 19: 54535465 Niwa H (2001) Molecular mechanism to maintain stem cell renewal of ES cells Cell Struct Funct 26:137-148 Niwa H., Masui S., Chambers I., Smith AG and Miyazaki J (2002) Phenotypic complementation establishes requirements for Specific POU domain and generic transactivation function of Oct-3/4 in embryonic stem cells Mol Cell Biol 22: 15261536 Niwa H., Miyazaki J and Smith AG (2000) Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells Nat Genet 24: 372–376 Niwa H., Burdon T., Chambers I and Smith A (1998) Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3 Genes Dev 12: 2048-60 Nordhoff V., Hubner K., Bauer A., Orlova I., Malapetsa A and Scholer HR (2001) Comparative analysis of human, bovine, and murine Oct-4 upstream promoter sequences Mamm Genome 12: 309-317 Oates AC., Wollberg P., Pratt SJ., Paw BH., Johnson SL., Ho RK., Postlethwait JH., Zon LI and Wilks AF (1999) Zebrafish stat3 is expressed in restricted tissues during embryogenesis and stat1 rescues cytokine signaling in a STAT1-deficient human cell line Dev Dyn 215: 352-70 Okamoto K., Okazawa H., Okuda A., Sakai M., Muramatsu M and Hamada H (1990) A novel octamer-binding transcription factor is differentially expressed in mouse embryonic cells Cell 60: 461-472 Okazawa H., Okamoto K., Ishino F., Ishino-Kaneko T., Takeda S., Toyoda Y., Muramatsu M and Hamada H (1991) The oct3 gene, a gene for an embryonic transcription factor, is ontrolled by a retinoic acid repressible enhancer EMBO J 10: 2997-3005 Okita K and Yamanaka S (2006) Intracellular Signaling Pathways Regulating Pluripotency of Embryonic Stem Cells Current Stem Cell Research & Therapy 103: 103-111 151 Reference Okumura-Nakanishi S., Saito M., Niwa H and Ishikawa F (2005) Oct-3/4 and Sox2 regulate Oct-3/4 gene in embryonic stem cells J Biol Chem 280: 5307-17 Onyango P., Jiang S., Uejima H., Shamblott MJ., Gearhart JD., Cui H and Feinberg AP (2002) Monoallelic expression and methylation of imprinted genes in human and mouse embryonic germ cell lineages Pro.c Natl Acad Sci 99:10599-10604 Orkin SH (2005) Chipping away at the embryonic stem cell network Cell 122: 828-30 O'Shea JJ., Gadina M and Schreiber RD ( 2002) Cytokine signaling in 2002: new surprises in the Jak/Stat pathway Cell 109 Suppl: S121-31 Palmieri SL., Peter W., Hess H and Scholer HR (1994) Oct-4 transcription factor is differentially expressed in the mouse embryo during establishment of the first two extraembryonic cell lineages involved in implantation Dev Biol 166: 259-267 Pan G., Li J., Zhou Y., Zheng H and Pei D (2006) A negative feedback loop of transcription factors that controls stem cell pluripotency and self-renewal FASEB J 20:1730-2 Pan G., Qin B., Liu N., Scholer HR and Pei D (2004) Identification of a nuclear localization signal in OCT4 and generation of a dominant negative mutant by its ablation J Biol Chem 279: 37013-37020 Pan GJ., Chang ZY., Scholer HR and Pei D (2002) Stem cell pluripotency and transcription factor Oct4 Cell Res 12: 321-329 Park OK., Schaefer LK., Wang W and Schaefer TS (2000) Dimer stability as a determinant of differential DNA binding activity Stat3 isoforms J Biol Chem 275: 32244–32249 Pera MF and Herszfeld D (1998) Differentiation of human pluripotent teratocarcinoma stem cells induced by bone morphogenetic protein-2 Reprod Fertil Dev 10: 551555 Pesce M., Gross MK and Schöler HR (1998) In line with our ancestors: Oct-4 and the mammalian germ Bioessays 20: 722–732 Pesce M., Marin Gomez M., Philipsen S and Scholer HR (1999) Binding of Sp1 and Sp3 transcription factors to the Oct-4 gene promoter Cell Mol Biol 45: 709-716 Pesce M and Schöler HR (2001) Oct-4: Gatekeeper in the Beginnings of Mammalian Development Stem Cells 19: 271-278 Pesce M., Wang X., Wolgemuth DJ and Scholer HR (1998) Differential expression of the Oct-4 transcription factor during mouse germ cell differentiation Mech Dev 71: 89-98 Phillips K and Luisi B (2000) The virtuoso of versatility: POU proteins that flex to fit J Mol Biol 302:1023-1039 Qu CK (2002) Role of the SHP-2 tyrosine phosphatase in cytokine-induced signaling and cellular response Biochim Biophys Acta 1592: 297-301 Rajpert-De-Meyts E., Hanstein R., Jorgensen N., Graem N., Vogt P H and E.Skakkebaek N (2004) Developmental expression of POU5F1 (OCT-3/4) in normal and dysgenetic human gonads Hum Reprod 19: 1338 - 1344 Rao M (2004) Conserved and divergent paths that regulate self-renewal in mouse and human embryonic stem cells Dev Biol 275: 269-286 Rathjen J and Rathjen PD (2001) Mouse ES cells: experimental exploitation of pluripotent differentiation potential Curr Opin Genet Dev 11: 587-594 Raz R., Lee CK., Cannizzaro LA., d'Eustachio P and Levy DE (1999) Essential role 152 Reference recognition conferred by the STAT amino-terminal domain Science 273: 794-7 Reim G and Brand M (2006) Maternal control of vertebrate dorsoventral axis formation and epiboly by the POU domain protein Spg/Pou2/Oct4 Development 133: 2757-70 Reim G., Mizoguchi T., Stainier DY., Kikuchi Y and Brand M (2004) The POU domain protein spg (pou2/Oct4) is essential for endoderm formation in cooperation with the HMG domain protein casanova Dev Cell 6: 91-101 Remenyi A., Lins K., Nissen LJ., Reinbold R., Scholer HR and Wilmanns M (2003) Crystal structure of a POU/HMG/DNA ternary complex suggests differential assembly of Oct4 and Sox2 on two enhancers Genes Dev 17: 2048-2059 Rodda DJ., Chew JL., Lim LH., Loh YH., Wang B., Ng HH and Robson P (2005) Transcriptional regulation of nanog by OCT4 and SOX2 J Biol Chem 280: 24731-7 Rosner MH., Vigano MA., Ozato K., Timmons PM., Poirier F., Rigby PW and Staudt LM (1990) A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo Nature 345: 686-692 Sambrook J., Fritsch E.F and Maniatis T., (1989) Molecular Cloning: A Laboratory Manual (3rd Edition ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Sasse J., Hemmann U., Schwartz C., Schniertshauer U., Heesel B., Landgraf C., Schneider-Mergener J., Heinrich PC and Horn F (1997) Mutational analysis of acute-phase response factor/Stat3 activation and dimerization Mol Cell Biol.17: 4677-86 Sato N., Sanjuan IM., Heke M., Uchida M., Naef F and Brivanlou AH (2003) Molecular signature of human embryonic stem cells and its comparison with the mouse Dev Biol 260: 404–413 Schaefer TS., Sanders LK., Park OK and Nathans D (1997) Functional differences between Stat3alpha and Stat3beta Mol Cell Biol 17: 5307-16 Schindler C., Shuai K., Prezioso VR and Darnell JE Jr (1992) Interferon-dependent tyrosine phosphorylation of a latent cytoplasmic transcription factor Science 257: 809-13 Schöler H R., Dressler G R., Balling R., Rohdewohld H and Gruss P (1990) Oct-4: a germline-specific transcription factor mapping to the mouse t-complex EMBO J 9: 2185-2195 Schöler HR., Ruppert S., Suzuki,N., Chowdhury K and Gruss P (1990) New type of POU domain in germ line-specific protein Oct-4 Nature 344: 435–439 Scholz S., Domaschke H., Kanamori A., Ostermann k., Rodel G and Gutzeit H (2004) Germ cell-less expression in medaka (Oryzias laptis) Mol Rep Dev 67: 15-18 Schoorlemmer J., Van-Puijenbroek A., Van Den Eijnden M., Jonk L., Pals C and Kruijer W (1994) Characterization of a negative retinoic acid response element in the murine Oct4 promoter Mol Cell Biol 14:1122-1136 Shao H., Quintero A and Tweardy DJ (2001) Identification and characterization of cis elements in the STAT3 gene regulating STAT3a and STAT3b messenger RNAsplicing Blood 98: 3853-3856 Shinomiya A., Tanaka M., Kobayashi T., Nagahama Y and Hamaguchi S (2000) The vasa-like gene, olvas, identifies the migration path of primordial germ cells during embryonic body formation stage in the medaka, Oryzias latipes Dev Growth Differ 42: 317-26 153 Reference Schaefer TS., Sanders LK., Park OK and Nathans D (1997) Functional differences between Stat3α and Stat3β Mol Cell Biol 17: 5307–5316 Shuai K., Horvath CM., Huang LH., Qureshi SA., Cowburn D and Darnell JE Jr (1994) Interferon activation of the transcription factor Stat91 involves dimerization through SH2-phosphotyrosyl peptide interactions Cell 76: 821-8 Smukler SR.,Runciman SB., Xu S And van der Kooy D (2006) Embryonic stem cells assume a primitive neural stem cell fate in the absence of extrinsic influences J Cell Biol 172:79-90 Soodeen-Karamath S and Verrinder Gibbins AM (2001) Apparent absence of oct 3/4 from the chicken genome Mol Rep and Dev 58: 137-48 Stetefeld J and Ruegg M (2005) Structural and functional diversity generated by alternative mRNA splicing Trends Biochem Sci 30: 515–521 Strehlow I and Schindler C (1998) Amino-terminal signal transducer and activator of transcription (STAT) domains regulate nuclear translocation and STAT deactivation J Biol Chem 273:28049-56 Sturm R and Herr, W (1988) The POU domain is a bipartite DNA-binding structure Nature 336: 601-604 Suo G., Han J., Wang X., Zhang J., Zhao Y., Zhao Y and Dai J (2005) Oct4 pseudogenes are transcribed incancers Biochem Biophys Res Commun 337:1047-51 Suzuki A., Raya A., Kawakami Y., Morita M., Matsui T., Nakashima K., Gage FH., Rodriguez-Esteban C and Izpisua Belmonte JC (2006) Nanog binds to Smad1 and blocks bone morphogenetic protein-induced differentiation of embryonic stem cells Proc Natl Acad Sci U S A 103:10294-9 Tai MH., Chang CC., Kiupel M., Webster JD., Olson LK and Trosko JE (2005) Oct4 expression in adult human stem cells: evidence in support of the stem cell theory of carcinogenesis Carcinogenesis 26: 495-502 Takeda H., Matsuzaki T., Oki T., Miyagawa T and Amanuma H (1994) A novel POU domain gene, zebrafish pou2: expression and roles of two alternatively spliced twin products in early development Genes Dev 8: 45-49 Takeda J., Seino S and Bell GI (1992) Human Oct3 gene family: cDNA sequences, alternative splicing, gene organization, chromosomal location, and expression at low levels in adult tissues Nucleic Acids Res 20: 4613-4620 Takeda K and Akira S (2000) STAT family of transcription factors in cytokinemediated biological responses Cytokine Growth Factor Rev.11: 199–207 Takeda K., Noguchi K., Shi W., Tanaka T., Matsumoto M, Yoshida N., Kishimoto T and Akira S (1997) Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality Proc Natl Acad Sci USA 94: 3801-4 Tanaka TS., Kunath T., Kimber WL., Jaradat SA., Stagg CA., Usuda M., Yokota T., Niwa H., Rossant J and Ko MS (2002) Gene expression profiling of embryo-derived stem cells reveals candidate genes associated with pluripotency and lineage specificity Genome Res 12: 1921-1928 Thomson JA., Itskovitz-Eldor J., Shapiro SS., Waknitz MA., Swiergiel JJ., Marshall VS and Jones JM (1998) Embryonic stem cell lines derived from human blastocysts Science 282: 1145–1147 Tokuzawa Y., Kaiho E., Maruyama M., Takahashi K., Mitsui K., Maeda M., Niwa H and Yamanaka S (2003) Fbx15 is a novel target of Oct3/4 but is dispensable for 154 Reference embryonic stem cell self-renewal and mouse development Mol Cell Biol 23: 26992708 Tomioka M., Nishimoto M., Miyagi S., Katayanagi T., Fukui N., Niwa H., Muramatsu M and Okuda A (2002) Identification of Sox-2 regulatory region which is under the control of Oct-3/4-Sox-2 complex Nucleic Acids Res 30: 3202-3213 Strehlow I and Schindler C (1998) Amino-terminal signal transducer and activator of transcription (STAT) domains regulate nuclear translocation and STAT deactivation J Biol Chem 273: 28049-56 Suji-Takayama K., Inoue T., Ijiri Y., Otani T., Motoda R., Nakamura S and Orita K (2004) Demethylating agent, 5-azacytidine, reverses differentiation of embryonic stem cells Biochem Biophys Res Commun 323: 86-90 Van Eijk MJ., van Rooijen MA., Modina S., Scesi L., Folkers G., van Tol HT., Bevers MM., Fisher SR., Lewin HA., Rakacolli D., Galli C., de Vaureix C., Trounson AO., Mummery CL and Gandolfi F (1999) Molecular cloning, genetic mapping, and developmental expression of bovine POU5F1 Biol Reprod 60:1093-1103 Vinkemeier U., Cohen SL., Moarefi I., Chait BT., Kuriyan J and Darnell JE Jr (1996) DNA binding of in vitro activated Stat1 alpha, Stat1 beta and truncated Stat1: interaction between NH2-terminal domains stabilizes binding of two dimers to tandem DNA sites Embo J 15: 5616-26 Volff JN and Schartl M (2003) Evolution of signal transduction by gene and genome duplication in fish J Struct Funct Genomics 3:139–150 Wang D., Stravopodis D., Teglund S., Kitazawa J and Ihle JN (1996) Naturally occurring dominant negative variants of Stat5 Mol Cell Biol 16: 6141-8 Wegenka U.M., Buschmann J., Lutticken C., Heinrich PC and Horn F (1993) Acutephase response factor, a nuclear factor binding to acute-phase response elements, is rapidly activated by interleukin-6 at the posttranslational level Mol Cell Biol 13: 276-88 Wegner M., Drolet DW and Rosenfeld MG (1993) POU-domain proteins: structure and function of developmental regulators Curr Opin Cell Biol 5: 488-498 Williams RL., Hilton DJ., Pease S., Willson TA., Stewart CL., Gearing DP., Wagner EF., Metcalf D., Nicola NA and Gough NM (1988) Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells Nature 336: 684–687 Wittbrodt J., Shima A and Schartl M (2002) Medaka—a model organism from the Far East Nature Rev Genet 3: 53–64 Wobus AM and Boheler KR (2005) Embryonic stem cells: prospects for developmental biology and cell therapy Physiol Rev 85: 635-78 Xie X., Chan RJ and Yoder MC (2002) Thrombopoietin acts synergistically with LIF to maintain an undifferentiated state of embryonic stem cells homozygous for a Shp-2 deletion mutation FEBS Lett 529: 361–364 Xu X., Sun YL and Hoey T (1996) Cooperative DNA binding and sequence-selective recognition conferred by the STAT amino-terminal domain Science 273: 794-7 Xu C., Police S., Rao N and Carpenter MK (2002) Characterization and enrichment of cardiomyocytes derived from human embryonic stem cells Circ Res 91: 501–508 Xu H., Liao B., Zhang Q., Wang B., Li H., Zhong X., Sheng H., Zhao Y and Jin Y (2004) Wwp2, an E3 ubiquitin ligase that targets transcription factor Oct4 for ubiquitination J Biol Chem 279: 23495-23503 155 Reference Xu RH., Chen X., Li DS., Li R., Addicks GC., Glennon C., Zwaka TP and Thomson JA (2002) BMP4 initiates human embryonic stem cell differentiation to trophoblast Nat Biotechnol 20: 1261–1264 Xu RH., Peck RM., Li DS., Feng X., Ludwig T and Thomson JA (2005) Basic FGF and suppression of BMP signaling sustain undifferentiated proliferation of human ES cells Nat Methods 2: 185-90 Yamashita S., Miyagi C., Carmany-Rampey A., Shimizu T., Fujii R., Schier AF and Hirano T (2002) Stat3 Controls Cell Movements during Zebrafish Gastrulation Dev Cell 2: 363-75 Yang E., Henriksen MA., Schaefer O., Zakharova N and Darnell JE Jr (2002) Dissociation time from DNA determines transcriptional function in a STAT1 linker mutant J Biol Chem 277: 13455-62 Yang E., Wen Z., Haspel RL., Zhang JJ and Darnell JE Jr (1999) The linker domain of Stat1 is required for gamma interferon-driven transcription Mol Cell Biol 19: 510612 Yang HM., Do HJ., Oh JH., Kim JH., Choi SY., Cha, KY., Chung HM and Kim JH (2005) Characterization of putative cis-regulatory elements that control the transcriptional activity of the human Oct4 promoter J Cel Biochem 96: 821–830 Yeom YI., Fuhrmann G., Ovitt CE., Brehm A., Ohbo K., Gross M., Hubner K and Scholer HR (1996) Germline regulatory element of Oct-4 specific for the totipotent cycle of embryonal cells Development 122: 881-894 Ying QL., Nichols J., Chambers I., and Smith A (2003) BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3 Cell 115: 281–292 Yoo JY., Huso DL., Nathans D and Desiderio S (2002) Specific ablation of STAT3β distorts the pattern of STAT3-responsive gene expression and impairs the recovery from endotoxic shock Cell 108: 331-344 Yoshimizu T., Sugiyama N., De Felice M., Yeom YI., Ohbo K., Masuko K., Obinata M., Abe K., Scholer H R and Matsui Y (1999) Germline-specific expression of the Oct4/green fluorescent protein (GFP) transgene in mice Dev Growth Differ 41: 675684 Yuan H., Corbi N., Basilico C and Dailey L (1995) Developmental-specific activity of the FGF-4 enhancer requires the synergistic action of Sox2 and Oct-3 Genes Dev 9: 2635-2645 Zhang JJ., Vinkemeier U., Gu W., Chakravarti D., Horvath CM and Darnell JE Jr (1996) Two contact regions between Stat1 and CBP/p300 in interferon gamma signaling Proc Natl Acad Sci USA 93: 15092-6 Zhang X and Darnell JE Jr (2001) Functional importance of Stat3 tetramerization in activation of the alpha 2-macroglobulin gene J Biol Chem 276: 33576-81 Zhong Z., Wen Z and Darnell-JE J (1994) Stat3 and Stat4: members of the family of signal transducers and activators of transcription Proc Natl Acad Sci USA 91: 48064810 156 .. .Isolation and characterization of stem cell regulatory genes oct4 and stat3 from the model fish medaka LIU RONG (Master of Biological Sciences) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF. .. Because of the essential roles of Oct4 and Stat3 in maintenance of stem cell pluripotency in mammals, and the unique features of the medaka, it seems equally important to understand the roles of Oct4. .. by Oct4 and Sox2 97 3.1.9.2.3 OSE alone is sufficient for regulated expression 3.2 Cloning and characterization of two isoforms of the medaka stat3 104 109 3.2.1 Isolation of stat3 cDNAs from the