FUNCTIONS OF CYTOPLASMIC DYNEIN IN DROSOPHILA EPITHELIAL CELLS LI ZHOUHUA THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY TEMASEK LIFE SCIENCES LABORATORY NATIONAL UNIVERSITY OF SINGAPORE 2008 ACKNOWLEDGEMENT The present work was carried out in Dr Cai Yu’s lab in Temasek Life Sciences Laboratory, National University of Singapore. First of all, I’m extremely grateful to Dr Cai Yu and Prof. William Chia for accepting me as their graduate student, being brilliant supervisors and mentors and giving me greatest freedom, which I treasured most to shape my projects. Their insightful suggestions and critical comments and guidance have been invaluable in shaping this work and thesis to its present form. I would like to thank Prof. Chua Nam Hai and Dr Xie Qi for taking me into their lab in TLL, and the guidance and care they gave me. It is a great treasure to me as I broadened my view of biological sciences, which layed foundation to my later work in Dr Cai Yu’s lab. I also thank all the members of Prof. Chua Nam Hai and Dr Xie Qi lab for their help and suggestions. Thanks also go to Dr Kavita Babu for being a great teacher for my initial days in fly work, Wang Liwei and Joni for the technical assistances. I thank all the members of the Cai Yu lab, Bill Lab and Toshie Kai lab. Thanks to Liu Ming, Joni, Kavita, Martin, Devi, Greg, Sergey, Hongyan, Phing Chian, Kai Chen, Sarada, Simi, Toshie, Ai Kim, Honda for their help and suggestions on my work. I am grateful to my committee members Drs Suresh Jesuthasan, Karuna Sampath, Yang Xiaohang for their suggestions during the yearly meetings. I also thank Drs Tom Hays, Shigeo Hayashi, Pernille Roth, and François Schweisguth for their comments and suggestions on my work. Many thanks to lots of other people in the fly community who generously provided me reagents during this work, especially Drs. Elisabeth Knust, Daniel St Johnston, Mark Fortini and Artavanis-Tsakonas Spyros. They are mentioned in the charts indicating the sources of antibodies or flies. I’m also grateful to all the supporting services provided by TLL, which make my work more efficient. Finally not lastly, I owe much to my family, especially my wife Yanfen, who gives me her total support during my study, sacrifices her time to takes up much of the chores and looks after our lovely daughter, my parents and parents-in-law for their loves, encouragements, understandings, and total supports. Zhouhua II Table of Contents LI ZHOUHUA I Table of Contents III List of Figures and Tables . VIII ABBREVIATIONS . XI SUMMARY XIV Chapter Introduction . 1.1 Drosophila melanogaster as a model organism . 1.2. Epithelial polarity 1.2.1 Overview 1.2.2 Tentative mechanisms of polarity establishment/maintenance 1.2.3 Types of epithelial cells in Drosophila 1.2.4 Functions of protein complexes in epithelial polarity 1.2.5 Hierarchy amongst polarity protein complexes . 15 1.3. Cytoplasmic dynein and dynactin 16 1.3.1Cytoplasmic dynein 16 1.3.2 Dynactin . 19 1.4. Endocytosis 21 1.5. Notch signaling 24 1.5.1 Overview 24 1.5.2 Regulation of Notch signalling 27 1.5.3 Notch signalling during Drosophila oogenesis 31 Chapter Materials and Methods . 35 III 2.1 Molecular work . 35 2.1.1 Recombinant DNA methods 35 2.1.2 Strains and growth conditions 35 2.1.3 Cloning strategies and constructs used in this study 36 2.1.4 Transformation of E. coli cells . 37 2.1.5 Plasmid DNA preparation 39 2.1.6 PCR reactions and primers used in this study 40 2.2 Biochemistry . 40 2.2.1 PAGE and western blotting for protein samples 42 2.2.2. Immunological detection of proteins 42 2.2.3. Immunoprecipitation experiments (IP) . 42 2.2.4. co-IP for Embryos . 43 2.2.5. GST-fuion protein . 44 2.2.6. GST fusion protein purification 45 2.2.7. His-tagged fusion protein purification 46 2.3. Immunohistochemistry and microscopy 47 2.3.1. Fixing of wing imaginal discs . 48 2.3.2. Fixing of Drosophila ovaries 48 2.2.3. Fixing of embryos . 48 2.3.4. Antibody staining of fixed tissues . 49 2.3.5. MT staining in ovaries (preservation of MT) 50 2.3.6. Dhc staining in Drosophila ovaries 50 2.3.7. Antibodies used in this study 50 IV 2.3.8. In situ hybridization of Drosophila ovaries 52 2.3.9. Fluorescent transcript synthesis and microinjection into embryos . 54 2.3.10. Endocytosis assay . 56 2.3.11 Transfection of S2 cells, treatment with dsRNA and co-IP . 57 2.3.12 in vitro de-phosphorylation assay 58 2.3.13 Confocal microscopy analysis and image processing 58 2.4 MT drug treatment 58 2.5. Fly genetics 59 2.5.1. Fly stocks used in this study . 59 2.5.2. Mutant clone generation and flip-out expression 60 2.5.3. Single fly PCR 61 2.5.4. Germline transformation . 61 Chapter Dynein-mediated apical localization of crumbs transcripts is required for effective Crb activity in epithelial polarity . 63 3.1 Introduction . 63 3.2 Results . 66 3.2.1 Cytoplasmic dynein complex is involved in FC polarity . 66 3.2.2 Apical localization of crb transcripts requires dynein activity 78 3.2.3 Apical transcript localization is required for effective Crb activity . 83 3.2.4 Crb and Sdt form a complex on the apical cortex 89 3.3 Discussion . 93 3.4 Future direction . 95 Chapter Endocytic trafficking and activation of the Notch receptor . 97 V 4.1 Introduction . 97 4.2 Results . 100 4.2.1 Cytoplasmic dynein positively regulates Notch signaling . 100 4.2.2 Dynein functions in endocytosis of the Notch receptor . 110 4.2.3 Dynein functions between the early (sorting) and the recycling endosomes . 113 4.2.4 Dynein function is required between the S2 and S3 cleavage steps 116 4.2.5 Dynein may be recruited to the early (sorting) endosomes by Rab11 . 119 4.2.6 Rab11 positively regulates Notch signaling . 121 4.2.7 Rab11 functions in the recycling pathway . 125 4.2.8 Rab11 functions between S2 and S3 cleavage of Notch receptor 127 4.3 Discussion . 132 4.3.1 Endocytic trafficking/recycling and Notch signaling activation 132 4.3.2 Dynein: a pivotal link between epithelial polarity and Notch signaling? 135 4.4 Current work and future directions . 137 Chapter Recycling of Crumbs is required for epithelial polarity . 139 5.1 Introduction . 139 5.2 Results . 141 5.2.1 Endocytosis of Crb is required for epithelial polarity 141 5.2.2 Recycling of Crb is necessary for epithelial polarity . 148 5.2.3 De-activation of Crb prior to recycling 154 5.3 Future work . 155 REFERENCE 156 Appendix Primers for dynein mutations . 183 VI Publications . 185 VII List of Figures and Tables Fig. 1. Schematic view of Drosophila epithelial cell structures. . Fig. 1. Overview of Drosophila oogenesis. . Fig. 1. Mutual exclusion of polarity complexes during the establishment of apico-basal polarity in epithelium. . 16 Fig. 1. Dynein EM. 18 Fig. 1. Organization of the outer dynein arm. 18 Fig. 1. Dynactin EM . 20 Fig. 1. Schematic illustration of the location and approximate structural features of dynactin subunits 20 Fig. 1. A simple overview of the endocytic pathway. . 22 Fig. 1. Overview of Notch signalling . 26 Fig. 3. 902 and 1L are required for the follicular A/B polarity. . 68 Fig. 3. 902 and 1L are required for the apical localization of the Crb complex. . 70 Fig. 3. Dynein function is required for the follicular A/B polarity. . 71 Fig. 3. Dynein is required for the apical localization of the Crb complex. 73 Fig. 3. MT and p25 is required for the apical localization of the Crb complex . 76 Fig. 3. 902 is a mutation in the dynein heavy chain at 64C (Dhc64C). . 76 Fig. 3. Schematic drawing of the Dhc and Glued structure and the molecular lesions in 902 and 1L mutants. 77 Fig. 3. The microtubule cytoskeleton is not affected in dynein mutants. 78 Fig. 3. Dynein mediates the apical localization of crb transcripts in FCs. 80 Fig. 3. 10 Schematic structure of the transcripts used in this study. . 82 VIII Fig. 3. 11 Dynein transports crb transcripts to the apical domain in blastoderm embryos. . 82 Fig. 3. 12 The crb 3’UTR is required for apical localization of crb transcripts in vivo. 83 Fig. 3. 13 crb 3’ UTR does not affect the protein level. . 84 Fig. 3. 14 Apical Crb protein localization is largely independent of crb 3’ UTR. . 85 Fig. 3. 15 Endogenous wt crb product is required for the apical localization and function of exogenous Crbintra-myc-wo. . 87 Fig. 3. 16 Apical localization of Crb protein depends on dynein. 88 Fig. 3. 17 Crb and Sdt form a complex on the apical domain. . 90 Fig. 3. 18 Crb/Sdt complex formation depends on dynein function. 92 Fig. 3. 19 SdtA is not required for epithelial polarity in FCs. 93 Fig. 4. Encapsulation defects in cytoplasmic dynein mutants. 103 Fig. 4. Dynein mutant FCs arrest at premature stage. 104 Fig. 4. Dynein genetically interacts with the Notch pathway in encapsulation. 105 Fig. 4. Notch receptor is mis-localized in dynein mutant FCs . 106 Fig. 4. Dynein is required for endoreplication transition mediated by the Notch signaling pathway. 107 Fig. 4. Dynein functions in the Notch pathway during wing and bristle development. . 109 Fig. 4. Dynein functions in the endocytosis of Notch receptor. 113 Fig. 4. Notch receptor localizes to the early/sorting endosomes in dynein mutant. 115 Fig. 4. Dynein functions between S2 and S3 cleavage of Notch (1). 118 Fig. 4. 10 Dynein functions between S2 and S3 cleavage of Notch (2). 119 IX Fig. 4. 11 Dynein is recruited to the early (sorting) endosome by Rab11. . 121 Fig. 4. 12 Rab11 mutant FCs show persistent Cut and FasIII expression. . 123 Fig. 4. 13 Rab11 functions in Notch pathway during wing and bristle development . 124 Fig. 4. 14 Notch receptor localization in Rab11 mutant FCs 126 Fig. 4. 15 Rab11 functions in recycling pathway in FCs. . 127 Fig. 4. 16 Rab11 functions upstream of γ-secretase. 130 Fig. 4. 17 Rab11 functions downstream of S2 cleavage of Notch receptor 131 Fig. 4. 18 Fig. 5. NΔECN functions upstream of Rab11 . 131 Fig.5. Rab5 is required for epithelial polarity. . 143 Fig.5. Membrane apicalization by increased Crb protein. . 143 Fig.5. The polarity defect observed in endocytic mutant is the result of Crb accumulation. 145 Fig.5. Crbextra-TM-GFP can be internalized in FCs. . 146 Fig.5. Crbextra-TM-GFP co-localizes with the early endosomes. 147 Fig.5. Endogenous Crb can be internalized in Drosophila imaginal wing discs. 147 Fig.5. Rab11 is required for proper epithelial polarity. . 150 Fig.5. Rab11 affects the localization of Crb and Arm in epithelial cells. 150 Fig.5. Crb loss occurs prior to defective Arm localization in Rab11 mutants. 152 Fig.5. 10 Crb is more sensitive to Rab11 loss . 153 Fig.5. 11 Rab11 functions in the recycling endosomes. . 153 Fig.5. 12 Crb localizes to intracellular vesicles in Rab11 mutant. . 154 X Martin, M., S.J. Iyadurai, A. Gassman, J.G. Gindhart, Jr., T.S. Hays, and W.M. Saxton. 1999. Cytoplasmic Dynein, the Dynactin Complex, and Kinesin Are Interdependent and Essential for Fast Axonal Transport. Mol Biol Cell. 10:3717-3728. Matsuno, K., R.J. Diederich, M.J. Go, C.M. Blaumueller, and S. Artavanis-Tsakonas. 1995. Deltex acts as a positive regulator of Notch signaling through interactions with the Notch ankyrin repeats. Development. 121:2633-2644. McGrail, M., J. Gepner, A. Silvanovich, S. Ludmann, M. Serr, and T.S. Hays. 1995. Regulation of cytoplasmic dynein function in vivo by the Drosophila Glued complex. J. Cell Biol. 131:411-425. McGrail, M., and T.S. Hays. 1997. The microtubule motor cytoplasmic dynein is required for spindle orientation during germline cell divisions and oocyte differentiation in Drosophila. Development. 124:2409-2419. McNeill, H., M. Ozawa, R. Kemler, and W.J. Nelson. 1990. Novel function of the cell adhesion molecule uvomorulin as an inducer of cell surface polarity. Cell. 62:309-316. Medina, E., J. Williams, E. Klipfell, D. Zarnescu, G. Thomas, and A. Le Bivic. 2002. Crumbs interacts with moesin and {beta}Heavy-spectrin in the apical membrane skeleton of Drosophila. J. Cell Biol. 158:941-951. Mehta, S.Q., P.R. Hiesinger, S. Beronja, R.G. Zhai, K.L. Schulze, P. Verstreken, Y. Cao, Y. Zhou, U. Tepass, M.C. Crair, and H.J. Bellen. 2005. Mutations in Drosophila sec15 reveal a function in neuronal targeting for a subset of exocyst components. Neuron. 46:219-232. Mellman, I. 1996. Endocytosis and molecular sorting. Annu Rev Cell Dev Biol. 12:575625. Micchelli, C.A., and N. Perrimon. 2006. Evidence that stem cells reside in the adult Drosophila midgut epithelium. Nature. 439:475-479. Mishra-Gorur, K., M.D. Rand, B. Perez-Villamil, and S. Artavanis-Tsakonas. 2002. Down-regulation of Delta by proteolytic processing. J. Cell Biol. 159:313-324. 170 Moberg, K.H., S. Schelble, S.K. Burdick, and I.K. Hariharan. 2005. Mutations in erupted, the Drosophila ortholog of mammalian tumor susceptibility gene 101, elicit non-cellautonomous overgrowth. Dev. Cell. 9:699-710. Müller, H.-A.J. 2000. Genetic control of epithelial cell polarity: Lessons from Drosophila. Dev Dyn. 218:52-67. Mumm, J.S., E.H. Schroeter, M.T. Saxena, A. Griesemer, X. Tian, D.J. Pan, W.J. Ray, and R. Kopan. 2000. A Ligand-Induced Extracellular Cleavage Regulates [gamma]Secretase-like Proteolytic Activation of Notch1. Mol Cell. 5:197-206. Musch, A., H. Xu, D. Shields, and E. Rodriguez-Boulan. 1996. Transport of vesicular stomatitis virus G protein to the cell surface is signal mediated in polarized and nonpolarized cells. J. Cell Biol. 133:543-558. Muskavitch, M.A.T. 1994. Delta-Notch signaling and Drosophila cell fate choice. Dev Biol. 166:415-430. Nam, Y., P. Sliz, L. Song, J.C. Aster, and S.C. Blacklow. 2006. Structural basis for cooperativity in recruitment of MAML coactivators to Notch transcription complexes. Cell. 124:973-983. Nelson, W. 2003. Adaptation of core mechanisms to generate cell polarity. Nature. 422:766-774. Nelson, W.J., Yeaman C., Grindstaff K.K. 2000. Spatial cues for cellular asymmetry in polaried epithelia. Cell Polarity:106-140. Neuman-Silberberg, F.S., and T. Schupbach. 1993. The Drosophila dorsoventral patterning gene gurken produces a dorsally localized RNA and encodes a TGF[alpha]like protein. Cell. 75:165-174. Niimura, M., N. Isoo, N. Takasugi, M. Tsuruoka, K. Ui-Tei, K. Saigo, Y. Morohashi, T. Tomita, and T. Iwatsubo. 2005. Aph-1 contributes to the stabilization and trafficking of the {gamma}-cecretase complex through mechanisms involving intermolecular and intramolecular interactions. J. Biol. Chem. 280:12967-12975. Oda, T., A.G. Elkahloun, B.L. Pike, K. Okajima, I.D. Krantz, A. Genin, D.A. Piccoli, P.S. Meltzer, N.B. Spinner, F.S. Collins, and S.C. Chandrasekharappa. 1997. Mutations 171 in the human Jagged1 gene are responsible for Alagille syndrome. Nat Genet. 16:235242. Ohlstein, B., and A. Spradling. 2006. The adult Drosophila posterior midgut is maintained by pluripotent stem cells. Nature. 439:470-474. Ohno, S. 2001. Intercellular junctions and cellular polarity: the PAR-aPKC complex, a conserved core cassette playing fundamental roles in cell polarity. Curr. Opin. Cell Biol. 13:641-648. Ohshiro, T., T. Yagami, C. Zhang, and F. Matsuzaki. 2000. Role of cortical tumoursuppressor proteins in asymmetric division of Drosophila neuroblast. Nature. 408:593596. Oiwa, K., and H. Sakakibara. 2005. Recent progress in dynein structure and mechanism. Curr Opin Cell Biol. 17:98-103. Okajima, T., and K.D. Irvine. 2002. Regulation of Notch signaling by O-linked fucose. Cell. 111:893-904. Pan, D., and G.M. Rubin. 1997. Kuzbanian controls proteolytic processing of Notch and mediates lateral inhibition during Drosophila and vertebrate neurogenesis. Cell. 90:271280. Parks, A.L., K.M. Klueg, J.R. Stout, and M.A. Muskavitch. 2000. Ligand endocytosis drives receptor dissociation and activation in the Notch pathway. Development. 127:1373-1385. Parnas, D., A.P. Haghighi, R.D. Fetter, S.W. Kim, and C.S. Goodman. 2001. Regulation of postsynaptic structure and protein localization by the Rho-type guanine nucleotide exchange factor dPix. Neuron. 32:415-424. Patel, N.H., P.M. Snow, and C.S. Goodman. 1987. Characterization and cloning of fasciclin III: A glycoprotein expressed on a subset of neurons and axon pathways in Drosophila. Cell. 48:975-988. Pavlopoulos, E., C. Pitsouli, K.M. Klueg, M.A.T. Muskavitch, N.K. Moschonas, and C. Delidakis. 2001. neuralized Encodes a Peripheral Membrane Protein Involved in Delta Signaling and Endocytosis. Dev Cell. 1:807-816. 172 Pellikka, M., G. Tanentzapf, M. Pinto, C. Smith, C.J. McGlade, D.F. Ready, and U. Tepass. 2002. Crumbs, the Drosophila homologue of human CRB1/RP12, is essential for photoreceptor morphogenesis. Nature. 416:143-149. Peng, C.-Y., L. Manning, R. Albertson, and C.Q. Doe. 2000. The tumour-suppressor genes lgl and dlg regulate basal protein targeting in Drosophila neuroblasts. Nature. 408:596-600. Petcherski, A.G., and J. Kimble. 2000. Mastermind is a putative activator for Notch. Curr. Biol. 10:R471-R473. Petronczki, M., and J.A. Knoblich. 2001. DmPAR-6 directs epithelial polarity and asymmetric cell division of neuroblasts in Drosophila. Nat Cell Biol. 3:43-49. Pfarr, C., Coue M, Grissom PM, Hays TS, Porter ME, McIntosh JR. 1990. Cytoplasmic dynein is localized to kinetochores during mitosis. Nature. 345:263-265. Plamann, M., P.F. Minke, J.H. Tinsley, and K.S. Bruno. 1994. Cytoplasmic dynein and actin-related protein Arp1 are required for normal nuclear distribution in filamentous fungi. J. Cell Biol. 127:139-149. Plant, P.J., J.P. Fawcett, D.C.C. Lin, A.D. Holdorf, K. Binns, S. Kulkarni, and T. Pawson. 2003. A polarity complex of mPar-6 and atypical PKC binds, phosphorylates and regulates mammalian Lgl. Nat Cell Biol. 5:301-308. Pokrywka, N.J., and E.C. Stephenson. 1995. Microtubules are a general component of mRNA localization systems in Drosophila oocytes. Dev. Biol. 167:363-370. Progida, C., L. Malerod, S. Stuffers, A. Brech, C. Bucci, and H. Stenmark. 2007. RILP is required for the proper morphology and function of late endosomes. J Cell Sci. 120:37293737. Qi, H., M. D. Rand, X. Wu, N. Sestan, W. Wang, P. Rakic, T. Xu, and S. ArtavanisTsakonas. 1999. Processing of the Notch Ligand Delta by the Metalloprotease Kuzbanian. Science. 283:91-94. Radtke, F., and K. Raj. 2003. The role of Notch in tumorigenesis: oncogene or tumour suppressor? Nat Rev. Cancer. 3:756-767. 173 Raiborg, C., T.E. Rusten, and H. Stenmark. 2003. Protein sorting into multivesicular endosomes. Curr Opin Cell Biol. 15:446-455. Ray, R.P., and T. Schupbach. 1996. Intercellular signaling and the polarization of body axes during Drosophila oogenesis. Genes Dev. 10:1711-1723. Richard, M., R. Roepman, W.M. Aartsen, A.G.S.H. van Rossum, A.I. den Hollander, E. Knust, J. Wijnholds, and F.P.M. Cremers. 2006. Towards understanding CRUMBS function in retinal dystrophies. Hum. Mol. Genet. 15:R235-243. Riggleman, B., P. Schedl, and E. Wieschaus. 1990. Spatial expression of the Drosophila segment polarity gene armadillo is posttranscriptionally regulated by wingless. Cell. 63:549-560. Rodriguez-Boulan, E., G. Kreitzer, and A. Musch. 2005. Organization of vesicular trafficking in epithelia. Nat Rev Mol Cell Biol. 6:233-247. Roh, M.H., O. Makarova, C.-J. Liu, Shin, S. Lee, S. Laurinec, M. Goyal, R. Wiggins, and B. Margolis. 2002. The Maguk protein, Pals1, functions as an adapter, linking mammalian homologues of Crumbs and Discs Lost. J. Cell Biol. 157:161-172. Rolls, M.M., R. Albertson, H.-P. Shih, C.-Y. Lee, and C.Q. Doe. 2003. Drosophila aPKC regulates cell polarity and cell proliferation in neuroblasts and epithelia. J. Cell Biol. 163:1089-1098. Rose, L.S., and K.J. Kemphues. 1998. Early patterning of the C.elegans embryo. Annu Rev Genet. 32:521-545. Roth, S., F. Shira Neuman-Silberberg, G. Barcelo, and T. Schupbach. 1995. cornichon and the EGF receptor signaling process are necessary for both anterior-posterior and dorsal-ventral pattern formation in Drosophila. Cell. 81:967-978. Roy, S., B. Wyse, and J.F. Hancock. 2002. H-Ras signaling and K-Ras signaling are differentially dependent on endocytosis. Mol. Cell. Biol. 22:5128-5140. Runnegar, M.T., X. Wei, and S.F. Hamm-Alvarez. 1999 Increased protein phosphorylation of cytoplasmic dynein results in impaired motor function. . Biochem. J. . 342:1-6. 174 Ruohola, H., K.A. Bremer, D. Baker, J.R. Swedlow, L.Y. Jan, and Y.N. Jan. 1991. Role of neurogenic genes in establishment of follicle cell fate and oocyte polarity during oogenesis in Drosophila. Cell. 66:433-449. Sakata, T., H. Sakaguchi, L. Tsuda, A. Higashitani, T. Aigaki, K. Matsuno, and S. Hayashi. 2004. Drosophila Nedd4 Regulates Endocytosis of Notch and Suppresses Its Ligand-Independent Activation. Curr Biol. 14:2228-2236. Sapir, A., E. Assa-Kunik, R. Tsruya, E. Schejter, and B.Z. Shilo. 2005. Unidirectional Notch signaling depends on continuous cleavage of Delta. Development. 132:123-132. Sasamura, T., N. Sasaki, F. Miyashita, S. Nakao, H.O. Ishikawa, M. Ito, M. Kitagawa, K. Harigaya, E. Spana, D. Bilder, N. Perrimon, and K. Matsuno. 2003. neurotic, a novel maternal neurogenic gene, encodes an O-fucosyltransferase that is essential for NotchDelta interactions. Development. 130:4785-4795. Satoh, A.K., J.E. O'Tousa, K. Ozaki, and D.F. Ready. 2005. Rab11 mediates post-Golgi trafficking of rhodopsin to the photosensitive apical membrane of Drosophila photoreceptors. Development. 132:1487-1497. Schaeffer, V., C. Althauser, H.R. Shcherbata, W.-M. Deng, and H. Ruohola-Baker. 2004. Notch-dependent Fizzy-related/Hec1/Cdh1 expression is required for the mitotic-toendocycle transition in Drosophila follicle cells. Curr Biol. 14:630-636. Schnorrer, F., K. Bohmann, and C. Nusslein-Volhard. 2000. The molecular motor dynein is involved in targeting Swallow and bicoid RNA to the anterior pole of Drosophila oocytes. Nat Cell Biol. 2:185-190. Schober, M., M. Schaefer, and J.A. Knoblich. 1999. Bazooka recruits Inscuteable to orient asymmetric cell divisions in Drosophila neuroblasts. Nature. 402:548-551. Schroer, T. 2004. Dynactin. Annu Rev Cell Dev Biol. 20:759-79. Schweisguth, F. 2004. Notch signaling activity. Curr. Biol. 14:R129-R138. Seto, E.S., and H.J. Bellen. 2006. Internalization is required for proper Wingless signaling in Drosophila melanogaster. J. Cell Biol. 173:95-106. 175 Shcherbata, H.R., C. Althauser, S.D. Findley, and H. Ruohola-Baker. 2004. The mitoticto-endocycle switch in Drosophila follicle cells is executed by Notch-dependent regulation of G1/S, G2/M and M/G1 cell-cycle transitions. Development. 131:3169-3181. Sheetz, M. 1996. Microtubule motor complexes moving membranous organelles. Cell Struct Funct. 21:369-373. Shi, S., and P. Stanley. 2003. Protein O-fucosyltransferase is an essential component of Notch signaling pathways. Proc. Natl Acad. Sci. USA. 100:5234-5239. Shin, K., V.C. Fogg, and B. Margolis. 2006. Tight junctions and cell polarity. Annu Rev Cell and Dev Biol. 22:207-235. Simmonds, A.J., G. dosSantos, I. Livne-Bar, and H.M. Krause. 2001. Apical localization of wingless transcripts is required for Wingless signaling. Cell. 105:197-207. Simons, K., and A. Wandinger-Ness. 1990. Polarized sorting in epithelia. Cell. 62:207210. Sisson, J.C., C. Field, R. Ventura, A. Royou, and W. Sullivan. 2000. Lava Lamp, a novel peripheral Golgi protein, is required for Drosophila melanogaster cellularization. J. Cell Biol. 151:905-918. Slack, C., W. Somers, R. Sousa-Nunes, W. Chia, and P. Overton. 2006. A mosaic genetic screen for novel mutations affecting Drosophila neuroblast divisions. BMC Genetics. 7:33. Song, X., G.B. Call, D. Kirilly, and T. Xie. 2007a. Notch signaling controls germline stem cell niche formation in the Drosophila ovary. Development. 134:1071-1080. Song, X., C.-H. Zhu, C. Doan, and T. Xie. 2002. Germline stem cells anchored by adherens junctions in the Drosophila ovary niches. Science. 296:1855-1857. Song, Y., G. Benison, A. Nyarko, T.S. Hays, and E. Barbar. 2007b. Potential role for phosphorylation in differential regulation of the assembly of dynein light chains. J. Biol. Chem. 282:17272-17279. 176 Sotillos, S., M.T. Diaz-Meco, E. Caminero, J. Moscat, and S. Campuzano. 2004. DaPKCdependent phosphorylation of Crumbs is required for epithelial cell polarity in Drosophila. J. Cell Biol. 166:549-557. Spradling, A. 1993. Developmental stages of oogenesis. In: Arias M, editor. The development of Drosophila melanogaster. New York: Cold Spring Harbor Laboratory Press.:1-70. St Johnston, D. 2005. Moving messages: the intracellular localization of mRNAs. Nat Rev Mol Cell Biol. 6:363-375. Steuer, E.R., L. Wordeman, T.A. Schroer, and M.P. Sheetz. 1990. Localization of cytoplasmic dynein to mitotic spindles and kinetochores. Nature. 345:266-268. Strand, D., R. Jakobs, G. Merdes, B. Neumann, A. Kalmes, H. Heid, I. Husmann, and B. Mechler. 1994. The Drosophila lethal(2)giant larvae tumor suppressor protein forms homo-oligomers and is associated with nonmuscle myosin II heavy chain. J. Cell Biol. 127:1361-1373. Strand, D., Unger S, Corvi R, Hartenstein K, Schenkel H, Kalmes A, Merdes G, Neumann B, Krieg-Schneider F, Coy JF, et al. 1995. A human homologue of the Drosophila tumour suppressor gene l(2)gl maps to 17p11.2-12 and codes for a cytoskeletal protein that associates with nonmuscle myosin II heavy chain. Oncogene. 11:291-301. Struhl, G., and A. Adachi. 1998. Nuclear access and action of Notch in vivo. Cell. 93:649-660. Struhl, G., and A. Adachi. 2000. Requirements for presenilin-dependent cleavage of Notch and other transmembrane proteins. Mol. Cell. 6:625-636. Struhl, G., and I. Greenwald. 1999. Presenilin is required for activity and nuclear access of Notch in Drosophila. Nature. 398:522-525. Suikkanen, S., T. Aaltonen, M. Nevalainen, O. Valilehto, L. Lindholm, M. Vuento, and M. Vihinen-Ranta. 2003. Exploitation of microtubule ccytoskeleton and dynein during parvoviral traffic toward the nucleus. J. Virol. 77:10270-10279. 177 Sun, J., and W.-M. Deng. 2005. Notch-dependent downregulation of the homeodomain gene cut is required for the mitotic cycle/endocycle switch and cell differentiation in Drosophila follicle cells. Development. 132:4299-4308. Suzuki, A., M. Hirata, K. Kamimura, R. Maniwa, T. Yamanaka, K. Mizuno, M. Kishikawa, H. Hirose, Y. Amano, N. Izumi, Y. Miwa, and S. Ohno. 2004. aPKC Acts Upstream of PAR-1b in Both the Establishment and Maintenance of Mammalian Epithelial Polarity. Curr Biol. 14:1425-1435. Suzuki, A., C. Ishiyama, K. Hashiba, M. Shimizu, K. Ebnet, and S. Ohno. 2002. aPKC kinase activity is required for the asymmetric differentiation of the premature junctional complex during epithelial cell polarization. J Cell Sci. 115:3565-3573. Suzuki, A., T. Yamanaka, T. Hirose, N. Manabe, K. Mizuno, M. Shimizu, K. Akimoto, Y. Izumi, T. Ohnishi, and S. Ohno. 2001. Atypical Protein Kinase C Is Involved in the Evolutionarily Conserved PAR Protein Complex and Plays a Critical Role in Establishing Epithelia-specific Junctional Structures. J. Cell Biol. 152:1183-1196. Swan, A., T. Nguyen, and B. Suter. 1999. Drosophila Lissencephaly-1 functions with Bic-D and dynein in oocyte determination and nuclear positioning. Nat Cell Biol. 1:444449. Tai, A.W., J.-Z. Chuang, and C.-H. Sung. 2001. Cytoplasmic dynein regulation by subunit heterogeneity and its role in apical transport. J. Cell Biol. 153:1499-1510. Takizawa, P.A., J.L. DeRisi, J.E. Wilhelm, and R.D. Vale. 2000. Plasma Membrane Compartmentalization in Yeast by Messenger RNA Transport and a Septin Diffusion Barrier. Science. 290:341-344. Tanentzapf, G., C. Smith, J. McGlade, and U. Tepass. 2000. Apical, lateral, and basal polarization cues contribute to the development of the follicular epithelium during Drosophila oogenesis. J. Cell Biol. 151:891-904. Tanentzapf, G., and U. Tepass. 2003. Interactions between the crumbs, lethal giant larvae and bazooka pathways in epithelial polarization. Nat Cell Biol. 5:46-52. Tekotte, H., and I. Davis. 2002. Intracellular mRNA localization: motors move messages. Trends Genet. 18:636-642. 178 Tepass, U. 1996. Crumbs, a component of the apical membrane, is required for zonula adherens formation in primary epithelia of Drosophila. Dev. Biol. 177:217-225. Tepass, U. 1997. Epithelial differentiation in Drosophila. Bioessays. 19:673-682. Tepass, U., and V. Hartenstein. 1994. The Development of Cellular Junctions in the Drosophila Embryo. Dev Biol. 161:563-596. Tepass, U., and E. Knust. 1990. Phenotypic and developmental analysis of mutations at the crumbs locus, a gene required for the development of epithelia in Drosophila melanogaster. Roux Arch. Dev. Biol. 199:189-206. Tepass, U., and E. Knust. 1993. Crumbs and stardust function in a genetic pathway that controls the organization of epithelia in Drosophila melanogaster. Dev. Biol. 158:311326. Tepass, U., G. Tanentzapf, R. Ward, and R. Fehon. 2001. Epithelial cell polarity and cell junctions in Drosophila. Annu Rev Genet. 35:747-784. Tepass, U., C. Theres, and E. Knust. 1990. crumbs encodes an EGF-like protein expressed on apical membranes of Drosophila epithelial cells and required for organization of epithelia. Cell. 61:787-799. Thompson, B.J., J. Mathieu, H.-H. Sung, E. Loeser, P. Rorth, and S.M. Cohen. 2005. Tumor suppressor properties of the ESCRT-II complex component Vps25 in Drosophila. Dev Cell. 9:711-720. Torres, I.L., H. Lopez-Schier, and D.S. Johnston. 2003. A Notch/Delta-dependent relay mechanism establishes anterior-posterior polarity in Drosophila. Dev Cell. 5:547-558. Traer, C.J., A.C. Rutherford, K.J. Palmer, T. Wassmer, J. Oakley, N. Attar, J.G. Carlton, J. Kremerskothen, D.J. Stephens, and P.J. Cullen. 2007. SNX4 coordinates endosomal sorting of TfnR with dynein-mediated transport into the endocytic recycling compartment. Nat Cell Biol. 9:1370-1380. Tsruya, R., A. Schlesinger, A. Reich, L. Gabay, A. Sapir, and B.-Z. Shilo. 2002. Intracellular trafficking by Star regulates cleavage of the Drosophila EGF receptor ligand Spitz. Genes Dev. 16:222-234. 179 Urban, S., and M. Freeman. 2002. Intramembrane proteolysis controls diverse signalling pathways throughout evolution. Curr Opin Genet Dev. 12:512-518. Vaccari, T., and D. Bilder. 2005. The Drosophila tumor suppressor vps25 prevents nonautonomous overproliferation by regulating notch trafficking. Dev. Cell. 9:687-698. Vaccari, T., H. Lu, R. Kanwar, M.E. Fortini, and D. Bilder. 2008. Endosomal entry regulates Notch receptor activation in Drosophila melanogaster. J. Cell Biol. 180:755762. Vaisberg, E.A., M.P. Koonce, and J.R. McIntosh. 1993. Cytoplasmic dynein plays a role in mammalian mitotic spindle formation. J. Cell Biol. 123:849-858. Vale, R.D. 2003. The molecular motor toolbox for intracellular transport. Cell. 112:467480. Vale, R.D., B.J. Schnapp, T.S. Reese, and M.P. Sheetz. 1985. Movement of organelles along filaments dissociated from the axoplasm of the squid giant axon. Cell. 40:449-454. Vallee, R.B., John C. Williams, Dileep Varma, Lora E. Barnhart,. 2004. Dynein: An ancient motor protein involved in multiple modes of transport. J Neurobiol. 58:189-200. Vallee, R.B., and M.P. Sheetz. 1996. Targeting of motor proteins. Science. 271:15391544. van de Pavert, S.A., A. Kantardzhieva, A. Malysheva, J. Meuleman, I. Versteeg, C. Levelt, J. Klooster, S. Geiger, M.W. Seeliger, P. Rashbass, A. Le Bivic, and J. Wijnholds. 2004. Crumbs homologue is required for maintenance of photoreceptor cell polarization and adhesion during light exposure. J Cell Sci. 117:4169-4177. van Eeden, F., and D. St Johnston. 1999. The polarisation of the anterior-posterior and dorsal-ventral axes during Drosophila oogenesis. Curr Opin Genet Dev. 9:396-404. van Es, J.H., M.E. van Gijn, O. Riccio, M. van den Born, M. Vooijs, H. Begthel, M. Cozijnsen, S. Robine, D.J. Winton, F. Radtke, and H. Clevers. 2005. Notch/[gamma]secretase inhibition turns proliferative cells in intestinal crypts and adenomas into goblet cells. Nature. 435:959-963. 180 Varnum-Finney, B., L. Wu, M. Yu, C. Brashem-Stein, S. Staats, D. Flowers, J.D. Griffin, and I.D. Bernstein. 2000. Immobilization of Notch ligand, Delta-1, is required for induction of notch signaling. J Cell Sci. 113:4313-4318. Walker, R.A., and M.P. Sheetz. 1993. Cytoplasmic Microtubule-Associated Motors. Annu Rev Biochem. 62:429-451. Wang, W., and G. Struhl. 2004. Drosophila Epsin mediates a select endocytic pathway that DSL ligands must enter to activate Notch. Development. 131:5367-5380. Wang, W., and G. Struhl. 2005. Distinct roles for Mind bomb, Neuralized and Epsin in mediating DSL endocytosis and signaling in Drosophila. Development. 132:2883-2894. Ward, E.J., H.R. Shcherbata, S.H. Reynolds, K.A. Fischer, S.D. Hatfield, and H. Ruohola-Baker. 2006. Stem cells signal to the niche through the Notch pathway in the Drosophila ovary. Curr Biol. 16:2352-2358. Wilkie, G.S., and I. Davis. 2001. Drosophila wingless and pair-rule transcripts localize apically by dynein-mediated transport of RNA particles. Cell. 105:209-219. Wilkin, M.B., A.-M. Carbery, M. Fostier, H. Aslam, S.L. Mazaleyrat, J. Higgs, A. Myat, D.A.P. Evans, M. Cornell, and M. Baron. 2004. Regulation of Notch Endosomal Sorting and Signaling by Drosophila Nedd4 Family Proteins. Curr Biol. 14:2237-2244. Wilson, J.J., and R.A. Kovall. 2006. Crystal structure of the CSL-Notch-Mastermind ternary complex bound to DNA. Cell. 124:985-996. Wodarz, A., F. Grawe, and E. Knust. 1993. Crumbs is involved in the control of apical protein targeting during Drosophila epithelial development. Mech. Dev. 44:175-187. Wodarz, A., U. Hinz, M. Engelbert, and E. Knust. 1995. Expression of Crumbs confers apical character on plasma membrane domains of ectodermal epithelia of Drosophila. Cell. 82:67-76. Wodarz, A., A. Ramrath, A. Grimm, and E. Knust. 2000. Drosophila atypical protein kinase C associates with Bazooka and controls polarity of epithelia and neuroblasts. J. Cell Biol. 150:1361-1374. 181 Wodarz, A., A. Ramrath, U. Kuchinke, and E. Knust. 1999. Bazooka provides an apical cue for Inscuteable localization in Drosophila neuroblasts. Nature. 402:544-547. Woods, D.F., and P.J. Bryant. 1991. The discs-large tumor suppressor gene of Drosophila encodes a guanylate kinase homolog localized at septate junctions. Cell. 66:451-464. Wucherpfennig, T., M. Wilsch-Brauninger, and M. Gonzalez-Gaitan. 2003. Role of Drosophila Rab5 during endosomal trafficking at the synapse and evoked neurotransmitter release. J. Cell Biol. 161:609-624. Xie, T., and A.C. Spradling. 1998. decapentaplegic is essential for the maintenance and division of germline stem cells in the Drosophila ovary. Cell. 94:251-260. Yamanaka, T., Y. Horikoshi, Y. Sugiyama, C. Ishiyama, A. Suzuki, T. Hirose, A. Iwamatsu, A. Shinohara, and S. Ohno. 2003. Mammalian Lgl Forms a Protein Complex with PAR-6 and aPKC Independently of PAR-3 to Regulate Epithelial Cell Polarity. Curr Biol. 13:734-743. Ye, Y., N. Lukinova, and M.E. Fortini. 1999. Neurogenic phenotypes and altered Notch processing in Drosophila Presenilin mutants. Nature. 398:525-529. Yeaman, C., K.K. Grindstaff, and W.J. Nelson. 1999. New perspectives on mechanisms involved in generating epithelial cell polarity. Physi Rev. 79:73-98. Yoshimori, T., P. Keller, M.G. Roth, and K. Simons. 1996. Different biosynthetic transport routes to the plasma membrane in BHK and CHO cells. J. Cell Biol. 133:247256. Zerial, M., and H. McBride. 2001. Rab proteins as membrane organizers. Nat Rev Mol Cell Biol. 2:107-117. Zhang, M., A. Haapasalo, D.Y. Kim, L.A.M. Ingano, W.H. Pettingell, and D.M. Kovacs. 2006. Presenilin/{gamma}-secretase activity regulates protein clearance from the endocytic recycling compartment. FASEB J. 20:1176-1178. Zhou, S., H. Zhou, P.J. Walian, and B.K. Jap. 2007. Regulation of gamma-secretase activity in Alzheimer's disease. Biochem. 46:2553-2563. 182 Appendix Primers for dynein mutations Amplification Primers: Dhc64C902: 475F: CACTGGTTAGCTCTGGATTCTGG 2833R: GATCACATTGTTGACGGTCTGG 2655F: CAAGTCGTACGTCAAGGAGTCG 5345R: CACAATGCTAGCACGATCTTCG 4903F:ATCACACTTGCCACTTCACACC 7426R: CAAGTCCAGCTCGTAGTTCTGC 7229F:CATTGGAAGCAATTGACCAAGC 9410R: CGCACACCGACTGGATTAGG 9212F: GAGCAACTGTCCAACCAGAGC 11369R: ATCGCAGAACAGCACCAACC 10995F: AACGCACAAGGTAGCGTCTCC 13251R:CATCAATGACAGCCGGTTCC 12887F: GGTGACTCCACGTCACTATCTGG 15128R: CCACACGCTTCAACATATCAGC 14954F: TGAGCAATCCGGACTATAACTTCG 17073R: GCTGCCAAGTCATCCACTCG 16973F: TTCACTTCTGTGGTGGACAAGC 19374R:CCTCATCCACCAGAACCAAGG glued1L: g102F-1: TATTCGCACGGCCACTTTATCTCG g2063R-1: GCTTGCTGCTGGGGCTCCTTCT g1862F-2: CACGGCTGCCCAACCCACAA g3821R-2: GATCCTGCAACGACTCCTTTTC g3571F-3: GAGGAAATTGCCCAATTGGAGG g5681R-3: TGCAGCAGCGACAATACCCAGG g5320F-4: GATGCGCTGGAGAGCGAGAAG g7153R-4: GCTCGAGAGGTCAAGCCACAG Sequencing Primers: Dhc64C902: 503 AACAAAAGGTCTTATTGCG 827 TCTGTATTCTGATATCTGC 1225 TGCAGGCGCTTTACGTC 1646 GCTAAAAAGTGCATTCAG 2047 GCGGGAGCAATGACATCG 2455 CGAGGACGAGAAGGAGC 2822 AACAATGTGATCCGGAAG 3221 TAGCTACAGTAGCCGAC 3642 GCGCAAGTTCCGACG 4051 TTCAATGCGCTCTTCGTG 4441 TTTACCATCGAGTCAACG 4835 TGATAATTTATCCAATAGCAG 5241 GTTCAACTCCCGCATGC 5640 TCTCGAAGATTCAGCATG 6015 GCTACCAGGTGGGATTG 6413 ACAAGCTTCCACAGCAAG 6823 CCTACAACAGCTGCAGA 183 7227 7628 8009 8415 8813 9213 9632 10030 10433 10829 11231 11631 12026 12405 12818 13220 13614 14009 14411 14812 15213 15612 16013 16403 16808 17201 17613 18022 18438 18803 18981 GCCATTGGAAGCAATTGAC GTCTACTTGGAGGGAATC GTTATTCTGGGTATTTCATCG TCGAGCACCTTATAAACG ATGGGCCGAATCTTTGTC ACGAACTGTCCAACCAG TTTGATGAGGAACCCAAG ACTCTTCTTAAGGCACTG CGACCGAGATGATATTCG CCGGCGATGCAAAGTTG AGGCCTGAATTTCTCATC TCGCGTGCCATGCTAAGA GGTGAATCGCGAGGAGC ACACTGTTGGCCAACGGA CGTGTATGTCCACCAGAC TTTGGCCCAGGTGGAAC CGACTGGAAGGCCATTAG AAGTGGATTTTAGCTTAGG TTGAATCGATCTGTCTGC CGCTGTTTCATAGTAATCC AGCAACTGGAGCGCAG ACTTGTGCACCGAGAACG CGTAGCTCTCTGCAGTC ATCTTCTCCACGGTGCTG CAGCTGTGGGACGAATCC CCCAATGGCTTGTGCAGC GGGATGCCCTGGTCA GGATGGACGTCCATCATG TCTGGCTCGGTGGTTTGC TGAACTCCACGCGTACAG CCTTTACCTAAGGTATCTAA glued1L: g102F-1: TATTCGCACGGCCACTTTATCTCG g1862F-2: CACGGCTGCCCAACCCACAA g3571F-3: GAGGAAATTGCCCAATTGGAGG g5320F-4: GATGCGCTGGAGAGCGAGAAG gF2: AAGGCTGGCAGCGGAGTTCC gF3: CTGACCATTGCAATCACGGC gF4: GTGATTATTGGCCCGAAAGC gF5: TGTGCGACCCACGCAGCTGC gF6: AACGAGCGCCGAGCTGCAGG gF7: CTGGAGCTCTTACGCTCGGA gF8: TTCACGGCTTTTCCAGCACC gF9: GTCCCAGGAACAAGTCGATG gF10: CATGTCCAGATGCTTACCGC gF11: GTGGCCTTCTTCAATGCCAT gF12: GGAGCACACTCTGCCCCAGG gF13: GTACGAGGAAACCTCCTTGC gF14: ATCGTGTATCGTGGCAATGG gF15: TCTATAGCAGGGGAGAACTA gF16: TTCCTTGCTAAGCAGAATGA 184 Publications 1. Li Zhouhua, Wang Liwei, Hays Tomas, Cai Yu. 2008. Dynein-mediated apical localization of crumbs transcripts is required for Crumbs activity in epithelial polarity. J Cell Biol. 180(1): 31-38. 2. Wang Liwei, Li Zhouhua, Cai Yu. 2008. The JAK/STAT pathway positively regulates DPP signaling in the Drosophila germline stem cell niche. J Cell Biol. 180(4): 721-728. 185 [...]... apical domain of the epithelial cells Chapter 4 addresses a different function of dynein in the epithelial cells I will present evidence to show that dynein functions in the endocytic pathway to regulate the trafficking and activation of the Notch (N) receptor Notch signaling is blocked in dynein mutant follicle cells (FCs), suggesting that dynein positively regulates Notch signaling Dynein function... Notch signaling during imaginal disc development, indicating the generality of dynein function in Notch signaling Notch receptor is accumulated in the early (sorting) endosomes in dynein mutant, suggesting that the endocytic trafficking of Notch receptor is disrupted Genetic and biochemical data suggest that the Notch receptor trapped in dynein mutant is the S2 product, indicating that dynein regulates... cargo-binding domain) (Fig1.4) Dyneins are categorized into two major classes, axonemal dynein (not discussed here) and cytoplasmic dynein (for simplicity, referred as dynein below) Cytoplasmic dynein drives a variety of fundamental cellular processes, including nuclear migration, organization of the mitotic spindle, chromosome separation during mitosis, positioning and function of many intracellular... functions These results are subdivided into three chapters Chapter 3 reveals the previously unperceived function of cytoplasmic dynein in epithelial polarity Dynein mutant epithelial cells lose apical/basal (A/B) polarity, which is reminiscent of mutations in genes controlling epithelial polarity Examination of the polarity complexes showed that dynein primarily functions through the localization of. .. that of vertebrates This thesis studies the functions of cytoplasmic dynein in epithelial polarity, endocytic trafficking and activation of Notch receptor in ovarian follicle cells In the next few sections of this chapter, I will give an overview of epithelial polarity and the Notch signaling pathway, as well as the molecules involved in epithelial polarity, Notch trafficking and activation 1.2 Epithelial... and Davis, 2001) Dynein is thought to be a homodimer with two heavy chains, each of which comprises a head domain joined to a tail Dynein also contains several accessory subunits, termed intermediate, light intermediate and light chains (Fig 1.5) (Asai and Wilkes, 2004) The fine structure of cytoplasmic dynein, the force generation and the regulation of dynein are not within the scope of this study,... development and epithelial polarity, this thesis focuses on the dissection of some of these developmental processes The work described in this thesis studies the functions of the microtubule minusend directed motor cytoplasmic dynein in follicular epithelial cells Two aspects of its function are addressed: cellular polarity and Notch signaling In the epithelial cells, cytoplasmic dynein appears to encompass... stalk domain that protrudes from the motor unit of each heavy chain The basal IC/LC complex is required for structural binding (ATP-independent) This subcomplex binds to α–tubulin and probably also the adaptor or docking complex B Model of a dynein heavy chain illustrating the proposed arrangement of subdomains within this motor unit The Nterminal stem domain interacts with the analogous region of other... EM, dynactin shows a characteristic structure (Fig 1.6), a conspicuous Arp1 rod (actin-related protein 1), consisting of Arp1, Arp11 (another actin-related protein), actin, CapZ (actin-capping protein), p62, p27, and p25, which binds to various cargos; a projecting arm, made up by p150/Glued, dynamitin/p50, p24/p22, which binds to microtubule and dynein complex (Fig 1.7) Dynactin binds dynein directly... domain at the expense of the basolateral domain (Wodarz et al., 1995) Crb overexpression also leads to the redistribution of β-heavy spectrin, a membrane cytoskeleton protein, consistent with a study suggesting that Crb stabilizes the apical spectrin-based membrane skeleton by interacting with β-heavy spectrin as well as Dmoesin, a 4.1/ezrin/radixin/moesin (FERM)-domain containing protein (Medina et . 2.3.2. Fixing of Drosophila ovaries 48 2.2.3. Fixing of embryos 48 2.3.4. Antibody staining of fixed tissues 49 2.3.5. MT staining in ovaries (preservation of MT) 50 2.3.6. Dhc staining in Drosophila. unperceived function of cytoplasmic dynein in epithelial polarity. Dynein mutant epithelial cells lose apical/basal (A/B) polarity, which is reminiscent of mutations in genes controlling epithelial polarity indicating the generality of dynein function in Notch signaling. Notch receptor is accumulated in the early (sorting) endosomes in dynein mutant, suggesting that the endocytic trafficking of