ENGINEERED POLY(L-LACTIC ACID)-BASED NANOFIBERS FOR OSTEOGENIC DIFFERENTIATION OF HUMAN MESENCHYMAL STEM CELLS NGUYEN THI HIEN LUONG NATIONAL UNIVERSITY OF SINGAPORE 2012 ENGINEERED POLY(L-LACTIC ACID)-BASED NANOFIBERS FOR OSTEOGENIC DIFFERENTIATION OF HUMAN MESENCHYMAL STEM CELLS NGUYEN THI HIEN LUONG (B.Eng., Ho Chi Minh city University of Technology, Vietnam) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY NUS Graduate School for Integrative Sciences and Engineering NATIONAL UNIVERSITY OF SINGAPORE 2012 Acknowledgements First of all, I would like to express my heartfelt thanks to my supervisor, Prof Seeram Ramakrishna, for his tremendous guidance, support and encouragement throughout my Ph.D study His in-depth knowledge in different fields and his foresight of frontier science strongly inspired me during my four-year research life In spite of his busy schedule, I am always amazed how promptly he replies to emails and helps students solve the problems Great appreciation would also be given to Prof Casey Chan, who has given me invaluable advices and unconditional support to develop my Ph.D project I would admire how patient he was in correcting my manuscripts His specialist knowledge in orthopaedics and medical devices as well as his passion in scientific research greatly encouraged me to overcome the difficulties during my study I also deeply thank to Dr Susan Liao, a great mentor who provided patient guidance, constant encouragement and valuable suggestions during the last four years She always encouraged me whenever I felt depressed once certain manuscripts got rejected I am really appreciated how she saw the potential of my research and pointed out its novelty My thanks are extended to all other members in Center for Nanofibers and Nanotechnology: especially to Dr Yixiang Dong who carefully taught me basic electrospinning and cell culture techniques as well as gave me valuable advices when I first came to the lab; to Mr Wee Eong Teo who always helped me with his invaluable suggestions and discussions as well as is my trustful friend throughout my study; to Ms Charlene Wang who helped me with ordering chemicals, doing animal i studies and funding as well as is a very nice friend to me; to Dr Molamma Prabhakaran, Dr Jayarama Reddy Venugopal, Dr Liumin He, Dr Michelle Ngiam, and Dr Kun Ma for their advices and discussions; to Mr Anh Le Viet, Mr Johannes Wolf, Ms Van Do Thi Hai, Mr Stefan Maximilian Grott, Ms E Lingling Tian, Ms Shayanti Mukherjee, Ms Rajeswari Ravichandran, Mr Guorui Jin, Mr Dan Kai, Ms Satinderpal Kaur, Ms Xuan Zhao, Ms Mya Mya Khin, and Mr Shengyuan Yang for the true friendship we have which made me feel much better whenever I was stressed during the Ph.D life I am grateful to NUS Graduate School for Integrative Sciences and Engineering for their funding and support for my Ph.D study at National University of Singapore I also would like to thank to my TAC members, Prof Teoh Swee Hin and A/Prof Li Jun, for their efforts in helping me complete my Ph.D thesis Last, I would like to give a special thank to my husband who is always by my side and gives me significant supports with all his love My profound thanks are also given to my parents, siblings and parents-in-law for their constant love, care and support during my study ii Publications Research papers Luong T H Nguyen, Susan Liao, Seeram Ramakrishna and Casey K Chan Role of Nanofibrous Structure in Osteogenic Differentiation of Human Mesenchymal Stem Cells with Serial Passage Nanomedicine 6(6): 961-974, 2011 Luong T H Nguyen, Susan Liao, Casey K Chan and Seeram Ramakrishna Electrospun Poly(L-lactic acid) Nanofibres Loaded with Dexamethasone to Induce Osteogenic Differentiation of Human Mesenchymal Stem Cells Journal of Biomaterials Science, Polymer Edition 23(14): 1771-91, 2012 Luong T H Nguyen, Susan Liao, Casey K Chan and Seeram Ramakrishna Enhanced Osteogenic Differentiation with 3D Electrospun Nanofibrous Scaffolds Nanomedicine 7(10): 1561-75, 2012 Anitha Panneerselvan, Luong T H Nguyen, Yan Su, Wee Eong Teo, Susan Liao, Seeram Ramakrishna and Ching Wan Chan Cell viability and angiogenic potential of a bioartificial adipose graft Journal of Tissue Engineering and Regenerative Medicine, published online on 21/11/2012, DOI: 10.1002/term.1633 Review papers Luong T H Nguyen, Shilin Chen, Naveen Kumar Elumalai, Molamma P Prabhakaran, Yun Zong, Chellappan Vijila, Suleyman I Allakhverdiev and Seeram Ramakrishna Biological, chemical and electronic applications of nanofibers Macromolecular Materials and Engineering, published online on 24/09/2012, DOI: 10.1002/mame.201200143 Michelle Ngiam, Luong T.H Nguyen, Susan Liao, Casey K Chan and Seeram Ramakrishna Biomimetic nanostructured materials potential regulators for osteogenesis? Annals Academy of Medicine Singapore 40(5): 213-222, 2011 Book chapter Luong T H Nguyen, Susan Liao, Casey K Chan and Seeram Ramakrishna Stem Cell Response to Biomaterial Topography In: Murugan Ramalingam, Seeram Ramakrishna and Serena Best, editors Biomaterials and Stem Cells in Regenerative Medicine Boca Raton: CRC Press; 2012 p 299-326 iii Conference proceedings Luong T H Nguyen, Susan Liao, Casey K Chan and Seeram Ramakrishna Osteoinductive nanofibrous grafts for bone tissue engineering Proceedings of the 9th World Biomaterials Congress (9th WBC), 01 05/06/2012, China Oral presentation Luong T H Nguyen, Susan Liao, Seeram Ramakrishna and Casey K Chan Recovery of Osteogenic Ability of Human Mesenchymal Stem Cells during Serial Passage Using Nanofibrous Scaffolds Proceedings of International Conference on Materials for Advanced Technologies (ICMAT), 26/06 01/07/2011, Singapore Oral presentation 10 Luong T H Nguyen, Susan Liao, Michelle Ngiam, Wang Charlene, Casey K Chan, and Seeram Ramakrishna Mineralized electrospun nanofibrous scaffolds for directing osteogenic differentiation of human mesenchymal stem cells Proceedings of the 241st ACS Meeting and Exposition, 27-31/03/2011, USA Oral presentation 11 Luong T H Nguyen, Susan Liao, Seeram Ramakrishna and Casey K Chan Electrospun nanofibrous composite for osteogenic differentiation of mesenchymal stem cells Proceedings of the 3rd NGS Student Symposium, 28/02/2011, Singapore Poster presentation 12 Luong T H Nguyen, Susan Liao, Casey K Chan and Seeram Ramakrishna The Fabrication of Dex-loaded PLLA Nanofibers for Bone Tissue Engineering Proceedings of the 3rd East-Asian Pacific Student Workshop on Nano-Biomedical Engineering, 21-22/12/2009, Singapore Oral presentation 13 N T H Luong, S Liao, C K Chan and S Ramakrishna, Electrospun Dexamethasone-loaded Poly-L-lactic acid nanofibers for bone graft materials Proceedings of International Conference for Micro & Nanotechnologies for Biosciences, 16 18/11/2009, Switzerland Poster presentation iv Table of Contents Acknowledgements i Publications iii Table of Contents v Abstract ix Executive Summary x List of Tables xiii List of Figures xiv List of Abbreviations xxi Chapter Introduction 1.1 Background 1.2 Motivation 1.3 Hypothesis and objectives 1.3.1 Hypothesis 1.3.2 Objectives 1.4 Research strategy and rationale 1.4.1 Research strategy 1.4.2 Research rationales 1.5 Work scope 10 Chapter Literature Review 13 2.1 Native bone 13 2.1.1 Bone structure 13 2.1.2 Bone cells 19 2.1.3 Bone formation 24 2.1.4 Bone modeling and remodeling 30 2.1.5 Bone repair 34 2.2 Bone grafts and bone graft substitutes 40 2.2.1 Clinical need 40 2.2.2 Bone grafts 41 2.2.3 Bone graft substitutes 43 2.3 Stem cells 51 2.3.1 Definition and classification 51 2.3.2 Stem cells in tissue engineering 53 2.3.3 Mesenchymal stem cells 54 v 2.4 Stem cell response to biomaterial topography 57 2.4.1 Surface geometry 59 2.4.2 Size 64 2.4.3 Dimensionality 68 2.5 Fabrication techniques of nanofibers 72 2.5.1 Electrospinning 73 2.5.2 Self assembly 76 2.5.3 Phase separation 77 2.6 The importance of nanofibers in tissue engineering 79 2.6.1 Current challenges in tissue engineering 79 2.6.2 Novel characteristics of nanofibers in medical applications 80 2.6.3 In vivo response to nanofibers 83 2.6.4 Clinical trials 87 2.7 Nanofiber-based scaffolds as bone graft substitutes 89 2.8 Summary 92 Chapter The Importance of Nanofibrous Structures 94 3.1 Introduction 94 3.2 Materials and methods 96 3.3 Results 101 3.3.1 Nanofibrous morphology 101 3.3.2 Cell morphology 102 3.3.3 Cell proliferation 103 3.3.4 Alkaline phosphatase activity 104 3.3.5 Matrix mineralization 105 3.3.6 Osteoblastic gene expression 108 3.4 Discussion 109 3.4.1 The effects of serial passage 110 3.4.2 The role of electrospun nanofibers 111 3.5 Conclusion 118 Chapter Dexamethasone-loaded Nanofibers as Osteoinductive Bone Graft Substitutes 120 4.1 Introduction 120 4.2 Materials and methods 121 4.3 Results 124 4.3.1 Characterization of nanofibers 124 vi 4.3.2 In vitro release study of Dex from PLLA scaffolds 126 4.3.3 Cell morphology 126 4.3.4 Cell proliferation 127 4.3.5 Alkaline phosphatase activity 128 4.3.6 Osteoblastic gene expression 129 4.3.7 Matrix mineralization 131 4.4 Discussion 133 4.4.1 Physical properties of nanofibrous scaffolds 134 4.4.2 In vitro release study of Dex from PLLA scaffolds 135 4.4.3 Dex-loaded PLLA nanofibers as osteoinductive scaffolds 139 4.5 Conclusion 143 Chapter Osteoinductive Biomimetic Nanocomposites 145 5.1 Introduction 145 5.2 Materials and methods 147 5.3 Results and discussion 153 5.3.1 Material characterization 153 5.3.2 Cell proliferation 155 5.3.3 Alkaline phosphatase activity 157 5.3.4 Osteoblastic gene expression 158 5.3.5 Matrix mineralization 161 5.3.6 Animal study 166 5.3.7 The importance of nanotopography and HA as osteoinductive factors 172 5.3.8 The efficacy of the biomimetic nanocomposite when compared to BMP176 5.4 Conclusion 178 Chapter Three-Dimensional Nanofibrous Scaffolds 180 6.1 Introduction 180 6.2 Materials and methods 183 6.3 Results 187 6.3.1 Scaffold morphology 187 6.3.2 Cell morphology 187 6.3.3 Cell proliferation 188 6.3.4 Osteoblastic gene expression 189 6.3.5 Matrix mineralization 190 6.4 Discussion 195 vii References 357 Thomsen P, Gretzer C Macrophageinteractions with modifiedmaterialsurfaces Curr Opin Solid State Mater Sci 2001;5:163-176 358 Refai A, Textor M, Brunette D, Waterfield J Effect of titanium surface topography on macrophage activation and secretion of proinflammatory cytokines and chemokines J Biomed Mater Res A 2004;70(2):194-205 359 Bruijn J, Shankar K, Yuan H, et al Bioceramics and Their Clinical Applications In: Kokubo, Tadashi, editor Osteoinduction and Its Evaluation Woodhead Pub and Maney Pub.; 2008 p 760 360 Chastain SR, Kundu AK, Dhar S, Calvert JW, Putnam AJ Adhesion of mesenchymal stem cells to polymer scaffolds occurs via distinct ECM ligands and controls their osteogenic differentiation J Biomed Mater Res A 2006;78(1):73-85 361 Niemeyer P, Krause U, Fellenberg J, Kasten P, Seckinger A, Ho AD, et al Evaluation of mineralized collagen and alpha-tricalcium phosphate as scaffolds for tissue engineering of bone using human mesenchymal stem cells Cells Tissues Organs 2004;177(2):68-78 362 Kretlow JD, Mikos AG Review: mineralization of synthetic polymer scaffolds for bone tissue engineering Tissue Eng 2007;13(5):927-938 363 Kim H, Kim U, Kim H, Li C, Wada M, Leisk G, et al Bone tissue engineering with premineralized silk scaffolds Bone 2008;42(6):1226-1234 364 Ravichandranab R, Venugopala JR, Sundarrajanab S, Mukherjeea S, Ramakrishnaab S Precipitation of nanohydroxyapatite on PLLA/PBLG/Collagennanofibrous structures for the differentiation of adipose derived stem cells to osteogenic lineage Biomaterials 2012;33(3):846-855 365 Yuan H, Fernandes H, Habibovic P, de Boer J, Barradas AMC, de Ruiter A, et al Osteoinductive ceramics as a synthetic alternative to autologous bone grafting Proc Natl Acad Sci U S A 2010;107(31):13614-13619 366 Liu Y, de G, Hunziker E BMP-2 liberated from biomimetic implant coatings induces and sustains direct ossification in an ectopic rat model Bone 2005;36(5):745-757 367 Yang Z, Yuan H, Tong W, Zou P, Chen W, Zhang X, et al Osteogenesis in extraskeletally implanted porous calcium phosphate ceramics: variability among different kinds of animals Biomaterials 1996;17(22):2131-2137 368 Kan L, Liu Y, McGuire T, Berger D, Awatramani R, Dymecki S, et al Dysregulation of local stem/progenitor cells as a common cellular mechanism for heterotopic ossification Stem Cells 2009;27(1):150-156 369 Griffith LG, Swartz MA Capturing complex 3D tissue physiology in vitro Nat Rev Mol Cell Biol 2006;7(3):211-224 370 Teo W, Gopal R, Ramaseshan R, Fujihara K, Ramakrishna S A dynamic liquid support system for continuous electrospun yarn fabrication Polymer 2007;48:34003405 371 Teo W, Liao S, Chan C, Ramakrishna S Remodeling of Three-dimensional Hierarchically Organized Nanofibrous Assemblies Current Nanoscience 2008;4(4):361-361 233 References 372 Shih YRV, Chen CN, Tsai SW, Wang YJ, Lee OK Growth of mesenchymal stem cells on electrospun type I collagen nanofibers Stem Cells 2006;24(11):23912397 373 Li C, Vepari C, Jin HJ, Kim HJ, Kaplan DL Electrospun silk-BMP-2 scaffolds for bone tissue engineering Biomaterials 2006;27(16):3115-3124 374 Ngiam M, Liao S, Patil AJ, Cheng Z, Chan CK, Ramakrishna S, et al The fabrication of nano-hydroxyapatite on PLGA and PLGA/collagen nanofibrous composite scaffolds and their effects in osteoblastic behavior for bone tissue engineering Bone 2009;45(1):4-16 375 Santos A, Bakker AD, De Blieck-Hogervorst JMA, Klein-Nulend J WNT5A induces osteogenic differentiation of human adipose stem cells via rho-associated kinase ROCK Cytotherapy 2010;12(7):924-932 376 Stevens B, Yang Y, Mohandas A, Stucker B, Nguyen K A review of materials, fabrication methods, and strategies used to enhance bone regeneration in engineered bone tissues J Biomed Mater Res B Appl Biomater 2008;85(2):573-582 377 Wiria FE, Chua CK, Leong KF, Quah ZY, Chandrasekaran M, Lee MW, et al Improved biocomposite development of poly(vinyl alcohol) and hydroxyapatite for tissue engineering scaffold fabrication using selective laser sintering J Mater Sci Mater Med 2008;19(3):989-996 378 Simpson RL, Wiria FE, Amis AA, Chua CK, Leong KF, Hansen UN, et al Development of a 95/5 poly(L-lactide-co-tricalcium phosphate scaffold as bone replacement material via selective laser sintering Journal of Biomedical Materials Research Part B: Applied Biomaterials 2008;84B(1):17-25 379 Chew S, Wen Y, Dzenis Y, Leong K The role of electrospinning in the emerging field of nanomedicine Curr Pharm Des 2006;12(36):4751-4770 380 Smith LA, Liu X, Hu J, Ma PX The influence of three-dimensional nanofibrous scaffolds on the osteogenic differentiation of embryonic stem cells Biomaterials 2009;30(13):2516-2522 381 Smith LA, Liu X, Hu J, Ma PX The enhancement of human embryonic stem cell osteogenic differentiation with nano-fibrous scaffolding Biomaterials 2010;31(21):5526-5535 382 Galler KM, Cavender A, Yuwono V, Dong H, Shi S, Schmalz G, et al Selfassembling peptide amphiphile nanofibers as a scaffold for dental stem cells Tissue engineering Part A 2008;14(12):2051-2058 383 Fabrication of biomimetic poly(propylene carbonate) scaffolds by using carbon dioxide as a solvent, monomer and foaming agent 384 Thorwarth M, Schultze-Mosgau S, Kessler P, Wiltfang J, Schlegel KA Bone regeneration in osseous defects using a resorbable nanoparticular hydroxyapatite J Oral Maxillofac Surg 2005;63(11):1626-1633 385 Busenlechner D, Tangl S, Fitzl C, Bernhart T, Gruber R, Watzek G, et al Pastelike inorganic bone matrix: preclinical testing of a prototype preparation in the porcine calvaria Clin Oral Implants Res 2009;20(10):1099-1104 386 López-López J, Chimenos-Küstner E, Manzanares-Cespedes C, Muñoz-Sánchez J, Castañeda-Vega P, Jané-Salas E, et al Histomorphological study of the bone 234 References regeneration capacity of platelet-rich plasma, bone marrow and tricalcium phosphate: Experimental study on pigs Med Oral Patol Oral Cir Bucal 2009;14(12):e620-e627 387 Huang Z, Tian J, Yu B, Xu Y, Feng Q A bone-like nanohydroxyapatite/collagen loaded injectable scaffold Biomedical materials (Bristol, England) 2009;4(5):055005 235 Appendices Appendix A Supplementary Information for Chapter A1 Early cell attachment The early attachment of MSCs to all of the scaffolds was studied at 10 and hr after seeding (Figure A1) The result showed that the presence of Col, as well as HA, considerably increased the initial cell attachment (10 min) However, after hr, almost 100% of the cells were attached to all of the scaffolds Figure A1 The percentage of cell attachment within 10 and hr after cell seeding Statistically significant differences between groups are marked with an asterisk (*; p < 0.05) Each vertical error bar represents the standard deviation of three independent measurements A2 Gene expression of ALP The gene expression levels of ALP showed consistent results (Figure A2) with the ALP activities (Figure 5.3) Lower ALP expression levels were observed in the mineralized scaffolds compared with the non-mineralized scaffolds and for the cells treated with growth medium compared to cells treated with Ost medium 236 Appendices Figure A2 Normalized ALP expression of the MSCs cultured on mineralized and non-mineralized scaffolds in both media types on day 10, 16 and 22 Statistically significant differences between the groups are marked with an asterisk (*; p < 0.05) Each vertical error bar represents the standard deviation of three independent measurements A3 The expression of BSP, WNT5A, Figures A3- A6, provided more information on the gene expression profile of the MCSs grown on the nanocomposites The expression of BSP was extremely low in the growth medium compared to Ost medium for all of the scaffolds, and it was difficult to conclude the effects of local Ca/P supply on the BSP expression (Figure A3) In the growth medium, the expression of WNT5A was increased for cells on the PLLA/Col/HA scaffold when compared with those on the corresponding non-mineralized scaffold (Figure A4) The cells on the PLLA/Col compared with the cells on the PLLA/Col/HA scaffolds in both media (Figure A5) In general, COL1A1 expression on mineralized scaffolds was lower when compared with the non-mineralized scaffolds (Figure A6), which might be related to lower proliferation of the cells on the HA scaffolds (Figure 5.2) 237 Appendices Figure A3 Normalized BSP expression of the MSCs cultured on mineralized and non-mineralized scaffolds in both media types on days 10, 16 and 22 Statistically significant differences between the groups are marked with an asterisk (p < 0.05) Each vertical error bar represents the standard deviation of three independent measurements Figure A4 Normalized WNT5A expression of the MSCs cultured on mineralized and non-mineralized scaffolds in both media types on days 10, 16 and 22 Statistically significant differences between the groups are marked with an asterisk (*; p < 0.05) Each vertical error bar represents the standard deviation of three independent measurements 238 Appendices Figure A5 Normalize ized and non-mineralized scaffolds in both media types on days 10, 16 and 22 Statistically significant differences between the groups are marked with an asterisk (*, p < 0.05) Each vertical error bar represents the standard deviation of three independent measurements Figure A6 Normalized COL1A1 expression of MSCs cultured on mineralized and non-mineralized scaffolds in both media types on day 10, 16 and 22 Statistically significant differences between the groups are marked with an asterisk (*; p < 0.05) Each vertical error bar represents the standard deviation of three independent measurements A4 Cell morphology and bone minerals on the nanoscaffolds (SEM micrographs) 239 Appendices Additional SEM micrographs of the MSCs on different scaffolds in the growth medium are shown On day 16, the bone formation of cells on the PLLA/Col/HA scaffold followed the trend observed on day 10 (Figure A7) More minerals were found on the PLLA/HA scaffold on day 16 compared with day 10 (Figure A8) There was no mineral formation on the PLLA/Col scaffold on either day 10 or day 16 (Figure A9) Figure A7 SEM micrographs of the MSCs on the PLLA/Col/HA scaffolds in growth medium on day 16: (A) Overall mineralization with cells, (B) Single cell with minerals, and (C) Enlarged minerals Figure A8 SEM micrographs of the MSCs on the PLLA/HA scaffolds in growth medium on day 16 240 Appendices Figure A9 SEM micrographs of the MSCs on the PLLA/Col scaffolds in growth medium on (A) day 10 and (B) day 16 A5 In vivo study: subcutaneous implantation in nude mice Figure A10 Photos of the PLLA/Col, the PLLA/Col/HA and the Col membrane before implantation and when harvested together with skin layers on week 12 The arrows indicate the presence of the implants 241 Appendices Figure A11 PLLA/Col and the PLLA/Col+MSCs implants as well as the blank control extracted after a 12-week study under both 10-fold and 40fold magnifications There was no bone-matrix formation observed in these cases 242 Appendices A6 Table A1 Gene ALP TATGAGAGTGACGAGAAAGC GTGCGGTTCCAGATGAAG BSP CGAGCCTATGAAGATGAG GTGGTGGTAGTAATTCTGA WNT5A ATATTAAGCCCAGGAGTTG TAGCGACCACCAAGAATT TGF R1 GTTTCTGCCACCTCTGTA ACATACAAACGGCCTATCT COL1A1 CAGAAACATCGGATTTGG AGTTACACAAGGAACAGAA 243 Appendices Appendix B Supplementary Information for Chapter Figure B1 The SEM images at 2000X magnification of 2D (A) and 3D (B) electrospun PLLA/Col nanofibrous scaffolds Figure B2 The SEM images of 3D electrospun PLLA/Col nanofibrous scaffolds cultured with human MSCs in the Ost medium on day 14 Figures A showed the formation of large bone aggregates at 20000X magnification Figures B and C showed the deposition of minerals along nanofibers at 5000X and 20000X magnifications, respectively 244 Appendices Figure B3 The EDX spectrum of the minerals formed on 2D electrospun PLLA/Col nanofibrous scaffolds on day 28 Figure B4 The SEM images (A and B) and EDX spectrum (C) of the minerals formed at the outer surface of 3D electrospun PLLA/Col nanofibrous scaffolds on day 28 Figures A-B showed the formation of large bone aggregates at 5000X magnification 245 Appendices Figure B5 The SEM images (A and B) and EDX spectrum (C) of the minerals formed at the center of 3D electrospun PLLA/Col nanofibrous scaffolds on day 28 Figure A showed the deposition of minerals along nanofibers at 5000X magnification Figure B showed the formation of large bone aggregates at 20000X magnification 246 Appendices Appendix C Standard Curves 247 ... ENGINEERED POLY(L- LACTIC ACID)- BASED NANOFIBERS FOR OSTEOGENIC DIFFERENTIATION OF HUMAN MESENCHYMAL STEM CELLS NGUYEN THI HIEN LUONG (B.Eng., Ho Chi Minh city University of Technology,... Seeram Ramakrishna Electrospun Poly(L- lactic acid) Nanofibres Loaded with Dexamethasone to Induce Osteogenic Differentiation of Human Mesenchymal Stem Cells Journal of Biomaterials Science, Polymer... release profile of Dex from the nanofibers was investigated 3) The efficacy of the Dex-loaded PLLA nanofibers in the osteogenic differentiation of MSCs was evaluated 1) PLLA/Col nanofibers were