NGHIÊN CỨU CHỌN TẠO DÒNG CÀ PHÊ VỐI CÓ KHẢ NĂNG KHÁNG ĐỐI VỚI LOÀI TUYẾN TRÙNG GÂY HẠI CHÍNH DÙNG LÀM GỐC GHÉP CHO CÁC GIỐNG CÀ PHÊ THƯƠNG MẠI

9 248 1
  • Loading ...
1/9 trang

Thông tin tài liệu

Ngày đăng: 18/05/2015, 10:29

VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM NGHIÊN CỨU CHỌN TẠO DÒNG CÀ PHÊ VỐI CÓ KHẢ NĂNG KHÁNG ĐỐI VỚI LOÀI TUYẾN TRÙNG GÂY HẠI CHÍNH DÙNG LÀM GỐC GHÉP CHO CÁC GIỐNG CÀ PHÊ THƯƠNG MẠI Lê Ngọc Báu, Đinh Thị Tiếu Oanh, Lê Đăng Khoa và ctv. Viện KHKT Nông Lâm nghiệp Tây Nguyên SUMMARY Studying on selection of the coffee varieties for resistance and tolerance to coffee parasitic nematodes - implication for those being the rootstocks of the trading coffee varieties With an annual production of 1.3 million tons of Robustageen coffee beans per year, the coffee is now a key exporter of the agricultural products in Vietnam. But a loss of the coffee yields caused by coffee nematodes is extremmely high. It is due to coffee nematodes attack the coffee root system and reducing its mechanical and physiological function. In this study, we have been selecting some coffee varieties for resistance and tolerance to coffee parasitic nematodes since 2009. The findings of our study showed that the P.coffeae was delineated as a key parasite nematode on coffee root system in Central Highland. By taking up the serial buds of the well -gowing coffee trees in some regions really infected by coffee nematodes, there were 148 coffee clones collected and planted in the WASI mother garden. 75 of those clones have been evaluating of their ability in nematode resistance and tolerance in conditions of the net - house. There were 6 clones (34/2, 10/24, N.Tren, R2D1/42, DuocC2 and HienC1)gowing very well in the infectedgound. The clones named 34/2 and 10/24 were defined as P. coffeae tolerance sources because theygew fantastically even if inoculated with 3.000 - 4.000 P.coffeae/pot. Keywords: Coffee nematode, tolerance, Pratylenchus coffeae. I. ĐẶT VẤN ĐỀ * Việt Nam là nước xuất khẩu cà phê đứng thứ hai trên thế giới, với sản lượng cà phê vối hàng năm khoảng 1,3 triệu tấn. Tuy nhiên, bệnh vàng lá thối rễ cà phê hiện nay đang là mối quan tâm của Ngành Cà phê Việt Nam. Đặc biệt ở nước ta hiện nay khi diện tích tái canh cây cà phê ngày càng tăng thì tình hình bệnh vàng lá thối rễ càng trở nên nghiêm trọng hơn và gây những thiệt hại to lớn về kinh tế cho người trồng cà phê. Một số kết quả nghiên cứu cho thấy : Nguyên nhân gây ra bệnh là do có sự phối hợp giữa tuyến trùng ký sinh Pratylenchus coffeae (P. coffeae) và một số loại nấm Fusarium sp. Tuyến trùng tấn công gây tổn thương rễ làm cho nấm xâm nhập gây ra triệu chứng thối rễ (Phan Quốc Sủng và cộng sự, 2001). Có nhiều biện pháp phòng trừ bệnh vàng lá, thối rễ cà phê, tuy nhiên biện pháp phòng trừ tổng hợp (IPM - Integrated Pest Management) vẫn được xem là hiệu quả cao và ít gây ảnh hưởng tới môi trường sống xung quanh. Một trong những biện pháp tác động của IPM là dùng Người phản biện: TS. Đào Thị Lan Hoa. các giống có khả năng chống chịu hoặc kháng được bệnh. Biện pháp này đã được áp dụng ở nhiều nước trên thế giới và cho hiệu quả tốt. Mặc dù cần nhiều thời gian, nguồn lực và kinh phí nhưng là giải pháp mang tính bền vững, có hiệu quả cao về mặt kinh tế, xã hội và môi trường với mục tiêu: - Chọn lọc được một số vật liệu cà phê làm gốc ghép có khả năng khá ng với loài tuyến trùng gây hại chính nhằm phục vụ cho việc tái canh tác cà phê ở Tây Nguyên, góp phần đảm bảo cho Ngành Cà phê Việt Nam phát triển ổn định và bền vững. - Chọn được 1 - 2 vật liệu giống cà phê có khả năng kháng với tuyến trùng gây hại chính dùng làm gốc ghép cho các giống cà phê thương mại. II. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1. Vật liệu - Các vật liệu giống (chồi) được thu thập trên đồng ruộng tại các vùng cà phê bị bệnh, gồm 148 vật liệu, được giâm cành để đánh giá tính kháng tuyến trùng. Hai vật liệu 34/2 và 10/24 được kế 634 Hội thảo Quốc gia về Khoa học Cây trồng lần thứ nhất thừa từ kết quả của đề tài “Điều tra nghiên cứu hội chứng vàng lá cà phê và biện pháp phòng trừ” năm 2001 do Viện KHKT Nông Lâm nghiệp Tây Nguyên thực hiện. - Nguồn đất nhiễm tuyến trùng được thu thập từ các vùng trồng cà phê tại huyện Cư Kuin - Đắk Lắk. Sau đó cho trồng cà phê trên đất bệnh trong nhà lưới. Nguồn tuyến trùng P. coffeae được ly trích từ rễ cây cà phê bị bệnh và được nuôi cấy trên môi trường đĩa cà rốt trong điều kiện phòng thí nghiệm. 2.2. Phương pháp nghiên cứu 2.2.1. Phương pháp định danh tuyến trùng Pratylenchus coffeae gây hại cà phê * Phương pháp định danh tuyến trùng P. coffeae bằng hình thái Những quần thể tuyến trùng ký sinh vùng rễ có tần suất xuất hiện trong các mẫu rễ cà phê nhiều nhất (chiếm khoảng 75 - 82 %) được được phân lập từ 4 tỉnh Tây Nguyên. Các quần thể tuyến trùng này được nhân nuôi trên môi trường mô sẹo cà rốt. Sau đó 20 cá thể đực và cái của mỗi quần thể được cố định và làm tiêu bản (dựa theo phương pháp của De Grisse, 1969) để theo dõi. Các mẫu tuyến trùng được cố định, quan sát dưới kính hiển vi điện tử và được định danh theo khóa phân loại của hai tác giả Castillo và Volvlas (2007). * Phương pháp định danh tuyến trùng bằng sinh học phân tử: Tách chiết DNA của các quần thể tuyến trùng này được thực hiện theo mô tả của tác giả Waeyenberge và cộng sự ( 2000). Trình tự của hai vùng ITS của ribosomal DNA được sử dụng với cặp mồi TW81 (5′ - GTTTCCGTAGGT GAACCTGC - 3′) và cặp mồi AB28 (5′ - ATATGCTTAAGTTCAGCGGGT - 3′). Trình tự của mỗi vùng được hoàn thiện với chương trình Chromas 2.00 và BioEdit 7.0.4.1 (Hall, 1999). Để thiết lập mối quan hệ của các quần thể P. coffeae với vùng ITS các trình tự khác sẵn có trên genbank của các loài gần gũi thuộc giống Pratylenchus, hai loài Belonolaimus euthychilus and Belonolaimus longicaudatus được sử dụng làm outgroup theo Subbotin và cộng sự (2008). Chương trình Clustal X 1.64 được sử dụng cho việc bắt cặp các trình tự. Các trình tự được so sánh theo phương pháp phân tích Bayesian (BI). BI được phân tích bằng chương trình MrBayes 3.1.2. Cây tiến hóa được sử dụng với chương trình Treeview 1.6.6. 2.2.2. Đánh giá nhanh khả năng kháng tuyến trùng của các thực liệu giống trên nền đất bệnh trong điều kiện nhà lưới * Phương pháp đánh giá nhanh khả năng kháng của vật liệu giống trên nền đất nhiễm bệnh Nguồn đất nhiễm tuyến trùng được thu thập từ các vùng trồng cà phê trên địa bàn tỉnh Đắk Lắk. Vật liệu giống được giâm cành đạt 3 - 4 cặp lá và được trồng dày trên đất nhiễm tuyến trùng. Thí nghiệm được bố trí theo kiểu khối ngẫu nhiên, mỗi vật liệu là một công thức, mỗi công thức 7 cây, 5 lần lặp lại. Theo dõi các chỉ tiêu: Sinh trưởng; mật độ tuyến trùng trước và sau khi trồng 3, 6, 9 và 12 tháng; tỷ lệ cây chết. Mức độ nhiễm bệnh: phân cấp bệnh theo Theiler R. (1998): Cấp 1: Cây rất khỏe, sinh trưởng mạnh, lá xanh thẫm; Cấp 2: Cây khỏe, sinh trưởng ít mạnh so với cấp 1, lá xanh vàng; Cấp 3: Cây xấu, sinh trưởng chậm hoặc không sinh trưởng, lá vàng xanh; Cấp 4: Cây đang héo, lá rũ màu vàng; Cấp 5: Cây chết. Mức độ nhiễm bệnh được tính theo công thức: CSB (%) =   ab 100     NT Trong đó: ∑ (a  b): Tổng của tích số cây nhiễm bệnh với cấp bệnh tương ứng. N: Tổng số cây được điều tra. T: Cấp bệnh rụng quả cao nhất. * Phương pháp lây nhiễm tuyến trùng nhân tạo trong điều kiện nhà lưới: Cây cà phê con giâm cành trong bầu đất (15  25cm), khi cây đạt 3 - 4 cặp lá sẽ được lây nhiễm tuyến trùng. Nguồn tuyến trùng được ly trích từ các đĩa cà rốt nuôi cấy. Sau hai tháng lây nhiễm, cây con sẽ được cấy chuyển sang chậu đất sạch bệnh để tiếp tục theo dõi. Thí nghiệm bố trí theo khối ngẫu nhiên, 3 công thức (CT), mỗi công thức 30 cây tương ứng 3 lần lặp lại. CT1: Vật liệu được lây nhiễm tuyến trùng; CT2: Vật liệu không lây nhiễm tuyến trùng; CT3: Cà phê 635 VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM chè mẫn cảm với tuyến trù ng. Mật độ tuyến trùng lây nhiễm/bầu cây con từ 3.000 - 4.000 (con/bầu), lây nhiễm 2, mỗi lần cách nhau 10 ngày. Các chỉ tiêu theo dõi: Sinh trưởng của cây con sau khi lây nhiễm 5, 8, 12 và 14 tuần; trọng lượng rễ tơ; mật độ tuyến trùng P. coffeae trong rễ (con/5g rễ), trong đất (con/100g đất); tỷ lệ cây có biểu hiện triệu chứng vàng lá thối rễ (%). 2.2.3. Đánh giá lại trên đồng ruộng các vật liệu kháng tuyến trùng dùng làm gốc ghép cho các giống cà phê vối thương mại Thí nghiệm được bố trí tại huyện Cư Kuin và huyện Cư M’gar - Đắk Lắk. Hai vật liệu làm gốc ghép là 34/2 và 10/24, ghép cho 2 giống cà phê vối thương mại là TR4 và TR9, giống làm đối chứng TR9 (giâm cành) và giống sản xuất đại trà. Thí nghiệm bố trí theo kiểu khối đầy đủ ngẫu nhiên, 3 lần lặp lại, mỗi công thức 45 cây và mỗi ô cơ sở 15 cây. Theo dõi các chỉ tiêu sinh trưởng; mật độ tuyến trùng trong đất và rễ, tỷ lệ cây vàng lá, chết. III. KẾT QUẢ VÀ THẢO LUẬN 3.1. Định danh tuyến trùng Pratylenchus coffeae gây hại chính trên cà phê Đặc điểm hình thái P. coffeae (Hình 1) của 5 quần thể đã được kiểm tra cho thấy sự phù hợp với mô tả gốc và những nghiên cứu trước đó về loài P. coffeae (Inserra và cộng sự, 2007). Kết quả quan sát và mô tả đặc điểm hình thái của 5 quần thể tuyến trùng Pratylenchus coffeae đã chỉ ra rằng: Hình dạng đuôi và mút đuôi của các quần thể P. c offeae là rất đa dạng. Sự phân tách của các loài về mặt hình thái được dựa chủ yếu trên vùng môi (Inserra và cộng sự 2001). Có một số đặc điểm phân loại rất dễ nhầm lẫn giữa các loài như: Đuôi nửa bán cầu với mút đuôi nhẵn, số lượng vòng đầu, chiều dài thực quản Trên thực tế, có rất ít sự khác nhau về hình thái giữa các loài P. coffeae, P. jaehni và P. pseud ocoffeae. Điều này dễ dẫn đến phân loại nhầm nếu có số lượng ít mẫu được giám định. Để kết quả định danh được chuẩn xác, tiếp tục tiến hành phân tích đặc trưng phân tử và quan hệ di truyền vùng ITS - rDNA của 5 quần thể tuyến trùng P. coffeae. 3.1.1. Hình thái của quần thể Pratylenchus coffeae Hình 1. Cấu trúc hiển vi của loài P. coffeae thuộc 5 quần thể được kiểm tra A: Vùng thực quản của con cái; B, C: Phần đuôi của con cái; D: Phần thực quản của con đực; E, F: Vùng bên ở giữa cơ thể; G, K: Đuôi con đực; H: Hệ sinh sản con cái; L - N: Đuôi con cái (phổ biến). Thước đo = 20 µm (A, H, I, J); Thước đo = 10 µm (B - G; K - N). 3.1.2. Đặc trưng phân tử và quan hệ di truyền vùng ITS - rDNA Kết quả phân tích DNA cho thấy: Sản phẩm chuỗi đơn DNA của 5 quần thể dài từ 750 - 780 bp. Kết quả giải trình tự đoạn gen 28SrDNA cho thấy: Mức độ khác nhau giữa các quần thể Pratylenchus coffeae được kiểm tra là rất thấp từ 0 đến 1,1%. Hình 2. Sản phẩm PCR vùng 28S rDNA của 5 quần thể tuyến trùng P. coffeae 636 Hội thảo Quốc gia về Khoa học Cây trồng lần thứ nhất Bảng 1. Mức độ tương đồng của 5 quần thể Pratylenchus coffeae dựa trên trình tự của đoạn gene 28S rDNA Quần thể Đắk Lắk 1 Đắk Lắk 2 Gia Lai Đắk Nông Lâm Đồng Đắk Lắk 1 100 Đắk Lắk 2 100 100 Gia Lai 99.7 99.7 100 Đắk Nông 99.7 99.7 99.4 100 Lâm Đồng 99.2 99.2 98.9 98.9 100 Mối liên quan của 5 quần thể tuyến trùng P. coffeae với các loài tuyến trùng khác được đánh giá thông qua việc phân tích BI (Hình 3). Có thể thấy rằng: P. coffeae được phân tách rõ rệt với quần thể của các loài P. hippeastri, P. loosi, P. gutierrezi và P. pseudocoffeae. Nhánh của P. coffeae được phân ra với 3 nhánh phụ. Năm quần thể tuyến trùng P. coffeae được kiểm tra là cùng nhóm với các quần thể P. coffeae đã được công bố bởi Duncan và cộng sự (1999) và một quần thể (EU130844) được công bố bởi Subbotin và cộng sự (2008). Hình 3. Tính đồng nhất (50 %) của cây phả hệ được dựa trên trình tự đoạn gen 28S rDNA của các quần thể P. coffeae với một vài loài tuyến trùng Pratylenchus với là Belonolaimusgacilis and B. longicaudatus. Phân tích Bayesian dựa trên mô hình GTR + I + G. Xác suất của mỗi nhánh được đưa ra trên mỗi nhánh. Chữ được in đậm là các mẫu được kiểm tra Bên cạnh đó, cây phả hệ dựa trên vùng 28S-rDNA chỉ ra rằng các loài P. coffeae là paraphyletic bởi lẽ những loài P. coffeae có 3 vòng đầu cùng nằm trong nhánh của những loài P. coffeae có 2 vòng đầu. Dựa trên c ác đặc điểm hình thái và đặc trưng phân tử của các mẫu được kiểm tra, có thể kết luận rằng các quần thể tuyến trùng Pratylenchus được phân lập từ Tây Nguyên (bao gồm Đắk Lắk 1, Đắk Lắk 2, Gia Lai, Lâm Đồng và Đắk Nông) là loài P. coffeae. 637 VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM 3.2. Đánh giá nhanh khả năng kháng tuyến trùng của các thực liệu giống trên nền đất bệnh trong điều kiện nhà lưới 3.2.1. Kết quả đánh giá nhanh khả năng kháng của các ký hiệu giống trên nền đất nhiễm tuyến trùng trong nhà lưới 3.2.1.1. Thí nghiệm đánh giá 3 vật liệu trồng năm 2010 Kết quả định danh tuyến trùng cho thấy rằng: Quần thể tuyến trùng tại vùng Tây Nguyên chiếm hầu hết là loài P. coffeae, do đó việc đánh giá tính khán g tuyến trùng của các vật liệu thu thập đều tập trung chủ yếu vào loài P. coffeae. Kết quả đánh giá mức độ nhiễm bệnh của 3 vật liệu trên nền đất bệnh trong nhà lưới (bảng 2) cho thấy: Vật liệu 34/2 và 10/24 có mức nhiễm bệnh khá thấp, rõ nhất sau 12 tháng trồng ở 2 vật liệu này có tỷ lệ nhiễm từ 13,3 - 16,5% và không tăng hơn so với thời điểm sau 9 tháng trồng. Trong khi đó, vật liệu LK29/6 bị nhiễm nặng và tỷ lệ nhiễm bệnh sau 12 tháng tăng 62,3%. Bảng 2. Mức độ nhiễm bệnh (%) của các vật liệu giống (trồng tháng 3/2010) Vật liệu giống Sau 3 tháng Sau 6 tháng Sau 9 tháng Sau 12 tháng H34/2 3,0 10,1 12,0 13,3 S10/24 5,1 9,5 16,0 16,5 LK29/6 19,0 34,2 45,0 62,3 Bảng 3. Mật độ tuyến trùng và tỷ lệ cây chết của các vật liệu giống (trồng 3/2010) Sau 3 tháng Sau 6 tháng Sau 9 tháng Sau 12 tháng KHG TLC (%) MĐTT (con/5g rễ) TLC (%) MĐTT (con/5g rễ) TLC (%) MĐTT (con/5g rễ) TLC (%) MĐTT (con/5g rễ) H34/2 0,0 32 8,0 64 13,3 64 13,3 96 S10/24 0,0 56 6,7 24 13,3 72 20,0 112 LK29/6 0,0 104 20,0 400 53,3 1.072 80,0 686 Ghi chú: TLC: Tỷ lệ cây chết; MĐTT: Mật độ tuyến trùng. Theo dõi mật độ tuyến trùng trong rễ của các vật liệu qua các tháng cho thấy: Khi mức độ nhiễm bệnh gia tăng thì mật độ tuyến trùng trong rễ cũng gia tăng và làm cho tỷ lệ cây chết cao hơn. Ghi nhận qua các tháng theo dõi đều cho kết luận về vật liệu LK29/6 là khá mẫn cảm với tuyến trùng, tỷ lệ cây chết sau 12 tháng chiếm 80,0 %. Trong khi đó 2 vật liệu 34/2 và 10/24 có tỷ lệ cây chết thấp hơn nhiều và chỉ chiếm 13,3 - 20 ,0 % trong cùng điều kiện thí nghiệm. Hình 4. Đánh giá các vật liệu giống trên nền đất bệnh trong điều kiện nhà lưới 3.2.1.2. Thí nghiệm đánh giá các vật liệu trồng năm 2011 Bảng 4. Mức độ nhiễm bệnh (%) của 4/19 vật liệu giống (trồng 6/2011) Vật liệu giống Sau 3 tháng Sau 6 tháng Sau 9 tháng Sau 12 tháng N.trên 10,3 14,5 26,0 28,0 R2D1/42 12,0 19,5 23,1 26,0 Được C2 7,1 22,0 27,0 29,1 Hiên C1 18,2 20,3 24,1 28,2 638 Hội thảo Quốc gia về Khoa học Cây trồng lần thứ nhất Tiếp tục đán h giá tính kháng của các vật liệu thu thập từ vùng đất bệnh ngoài đồng ruộng. Năm 2011 đã triển khai đánh giá nhanh 19 vật liệu và 53 vật liệu được tiếp tục đánh giá năm 2012 (hiện 53 vật liệu chưa có kết quả). Thí nghiệm trên 19 vật liệu giống trồng trên nền đất bệnh năm 2011 cho thấy: Mức độ nhiễm bệnh biến thiên khá lớn giữa cá c vật liệu, tỷ lệ nhiễm tăng cao từ tháng thứ 6 sau trồng và đạt từ 14,5 - 59,0%. Đến thời điểm sau 12 tháng trồng, có 15/19 vật liệu có tỷ lệ nhiễm > 70% và biến thiên từ 70,4 - 94,0%. Riêng có 4 vật liệu có tỷ lệ nhiễm thấp < 30% là N.Trên, R2D1/42, Được C2 và Hiên C1 (bảng 5) với mức nhiễm từ 26,0 - 29,1%. Kết quả này cho thấy 4 vật liệu trên bước đầu có sự khác biệt về mức độ chống chịu tuyến trùng so với c ác vật liệu cùng thí nghiệm. Bảng 5. Mật độ tuyến trùng và tỷ lệ cây chết của 4/19 vật liệu triển vọng (trồng 6/2011) Sau 3 tháng Sau 6 tháng Sau 9 tháng Sau 12 tháng Vật liệu giống TLC (%) MĐTT (con/5g rễ) TLC (%) MĐTT (con/5g rễ) TLC (%) MĐTT (con/5g rễ) TLC (%) MĐTT (con/5g rễ) N. Trên 0,0 72 6,7 174 20,0 320 26,7 1.120 R2D1/42 0,0 56 13,3 120 20,0 168 20,0 1.752 Được C2 0,0 72 6,7 104 20,0 320 26,4 264 Hiên C1 0,0 112 20,0 96 26,7 424 26,7 960 Theo dõi mật độ tuyến trùng và tỷ lệ cây chết sau 3 đến 12 tháng trồng (bảng 5) cho thấy, mật độ tuyến trùng từ tháng thứ 9 - 12 có chiều hướng tăng cao. Tuy nhiên 4 vật liệu trên có tỷ lệ cây vàng lá, chết ổn định và thấp hơn rất nhiều so với 15 vật liệu còn lại. Bốn vật liệu có tỷ lệ cây chết sau 12 tháng trồng dao động từ 20,0 - 26,7%, trong khi đó các vật liệu khác có tỷ lệ cây chết l ên đến 73,3 - 86,7%. Ngoài ra, vật liệu N. Trên và R2D1/42 còn tỏ ra chống chịu tốt và chịu được áp lực bệnh cao trên nền đất có mật độ tuyến trùng từ 1.120 - 1.752 con/5g rễ sau 12 tháng trồng. 3.2.2. Kết quả lây nhiễm tuyến trùng trên 2 vật liệu giống trong điều kiện nhà lưới Từ kết quả đánh giá tính kháng trên nền đất bệnh năm 2010, 2 vật liệu có khả năng chống chịu tuyến trùng là 34/2 và 10/24 tiếp tục được đưa vào thí nghiệm lây nhiễm tuyến trùng nhân tạo trong điều kiện nhà lưới để đánh giá mức độ kháng tuyến trùng. Đây là thí nghiệm đánh giá khả năng chống chịu của vật liệu giống trong điều kiện đất trồng có mật độ tuyến trùng P. coffeae cao. Bảng 6. Mật độ tuyến trùng P. coffeae trong đất và trong rễ sau khi lây nhiễm Mật độ tuyến trùng trong rễ (con/5g rễ) Mật độ tuyến trùng trong đất (con/100g đất) Vật liệu giống Công thức 4 tuần 8 tuần 12 tuần 14 tuần 4 tuần 8 tuần 12 tuần 14 tuần CT1 32 16 8 56 720 328 994 752 CT2 0 0 0 0 0 0 0 0 34/2 CT3 896 104 56 1.008 976 792 1.016 912 CT1 112 96 853 1.147 232 104 120 214 CT2 0 0 0 0 0 0 0 0 10/24 CT3 440 568 1.024 * 456 120 96 0 Ghi chú: CT1: Được lây nhiễm tuyến trùng; CT2: Không lây nhiễm tuyến trùng; CT3: Cà phê chè mẫn cảm với tuyến trùng gây hại; dấu * thể hiện không có dữ liệu). Kết quả kiểm tra sau khi lây nhiễm (bảng 6) thấy rằng tuyến trùng trong đất và trong rễ cây cà phê được lây nhiễm luôn biến động ở mật độ khá cao qua các thời điểm theo dõi. Số lượng tuyến trùng P. coffeae trong rễ cà phê 34/2, 10/24 và rễ cà phê chè được ghi nhận khá lớn trong các thời điểm theo dõi thí nghiệm. Dấu hiệu này cho thấy khả năng tấn công gây hại của tuyến trùng 639 VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM P. coffeae là rõ rệt. Mật độ tuyến trù ng P. coffeae ghi nhận trong rễ cà phê 34/2 và 10/24 luôn thấp hơn so với rễ cà phê chè mẫn cảm ở các thời điểm đánh giá khác nhau. Ở thí nghiệm trên vật liệu 34/2, sau 14 tuần lây nhiễm mật độ tuyến trùng trên rễ cà phê chè đạt rất cao (1.008 con/5g rễ); Thí nghiệm trên vật liệu 10/24 thì chỉ sau 12 tuần lây nhiễm mật độ tuyến trùng trong rễ cà phê chè đã được ghi nhật rất cao (1.024 con/5g rễ). Điều nà y là nguyên nhân gây thối rễ, vàng lá hàng loạt toàn bộ số cây cà phê chè trong thí nghiệm (tỷ lệ vàng lá từ 86,7 - 100,0%). Đối với vật liệu 10/24 được lây nhiễm tuyến trùng P. coffeae cũng nhận thấy có mật độ tuyến trùng rất cao trong rễ (1.147 con/5g rễ), tuy nhiên không thấy sự khác biệt rõ rệt về hiện tượng vàng lá thối rễ so với công thức không được lây nhiễm tuyến trùng. Tỷ lệ vàng lá do nhiễm bệnh ở vật liệu 34/2 và 10/24 có lây nhiễm tuyến trùng là khá thấp (13,3 - 16,7%) sau 14 tuần theo dõi. Cùng thời điểm này, số cây cà phê chè trong thí nghiệm hầu hết đã bị chết hoàn toàn. Bảng 7. Tỷ lệ cây bị vàng lá sau khi lây nhiễm tuyến trùng của các vật liệu cà phê Tỷ lệ vàng lá (%) tại các thời điểm theo dõi Vật liệu giống Công thức 4 tuần 8 tuần 12 tuần 14 tuần CT1 0,0 0,0 7,4 13,3 CT2 0,0 0,0 0,0 0,0 34/2 CT3 8,9 13,9 62,9 86,7 CT1 0,0 0,0 11,1 16,7 CT2 0,0 0,0 0,0 0,0 10/24 CT3 6,7 16,7 100,0 * Ghi chú: CT1: Được lây nhiễm tuyến trùng; CT2: Không lây nhiễm tuyến trùng; CT3: Cà phê chè mẫn cảm với tuyến trùng gây hại, dấu * thể hiện không có dữ liệu. 3.3. Đánh giá lại trên đồng ruộng các vật liệu có khả năng kháng tuyến trùng dùng làm gốc ghép cho các giống cà phê vối thương mại Bảng 8. Mật độ tuyến trùng trong đất, rễ thí nghiệm (trước trồng) tại Cư M’gar, Cư Kuin (năm 2012) Mật độ tuyến trùng trong đất (con/100g đất) Mật độ tuyến trùng trong rễ (con/5g rễ) Địa điểm Pra. Mel. Hoại sinh Pra. Mel. Hoại sinh Cư M’gar 24 504 96 616 3.184 16 Cư Kuin 336 280 72 264 112 120 Hình 5. Đánh giá lại các vật liệu giống làm gốc ghép trên đồng ruộng 640 Hội thảo Quốc gia về Khoa học Cây trồng lần thứ nhất Kết quả khảo sát mật độ tuyến trùng trong đất, rễ trước khi trồng bảng 8 cho thấy: vùng đất tại Cư M’gar và Cư Kuin trước khi bố trí thí nghiệm có mật độ tuyến trùng trong đất và rễ cà phê cũ khá cao. Tại Cư M’gar, mật độ trung bình trong đất thấp chỉ 24 con/100g đất nhưng trong rễ rất cao, trung bình 616 con/5g rễ. Cho thấy cây cà phê cũ trồng trên vùng đất này đã bị nhiễm tuyến trùng P. coffeae. Vùng đất tại Cư Kuin có mật độ tuyến trùng P. coffeae trong rễ thấp hơn chỉ 264 con/5g rễ, tuy nhiên mật độ tuyến trùng trong đất lại cao hơn so với vùng Cư M’gar, như vậy tính tổng mật độ tuyến trùng ban đầu trên vùng đất bệnh tại Cư Kuin cũng khá cao (tổng số tuyến trùng trên 600 con). Bảng 9. Mật độ tuyến trùng trong đất và rễ thí nghiệm trồng tại Cư M’gar và Cư Kuin (sau 12 tháng trồng, n = 5) Mật độ tuyến trùng trong đất (con/100g đất) Mật độ tuyến trùng trong rễ (con/5g rễ) Địa điểm Vật liệu giống Pra. Mel. Hoại sinh Pra. Mel. Hoại sinh 10/24 58 88 0,0 33 210 0 34/2 20 122 0,0 14 214 0 Đối chứng (TR9) 24 501 0,0 232 51 0 Huyện Cư M’gar Cà phê cũ 28 12 0,0 1.400 48 0 10/24 3 94 50 86 226 0 34/2 0 43 48 87 333 0 Đối chứng (TR9) 0 64 120 137 245 0 Huyện Cư Kuin Cà phê cũ 45 16 533 245 104 0 Bảng 10. Tỷ lệ cây vàng lá và chết của vật liệu thí nghiệm trồng tại Cư M’gar và Cư Kuin (sau 12 tháng trồng) Địa điểm Vật liệu giống Tỷ lệ cây vàng lá và chết (%) 10/24 11,1 34/2 12,5 Huyện Cư M’gar Đối chứng 38,6 10/24 14,8 34/2 6,6 Huyện Cư Kuin Đối chứng 22,7 Mật độ tuyến trùng ban đầu trên nền đất bệnh tại Cư M’gar khá cao, mật độ tuyến trùng này vẫn duy trì trong rễ cà phê cũ lên đến 1.400 con/5g rễ sau 12 tháng trồng. Thí nghiệm tại Cư Kuin có mật độ tuyến trùng trong rễ cà phê cũ thấp hơn ở Cư M’gar nhưng vẫn cao hơn khá nhiều so với các vật liệu trong thí nghiệm. Hai vật liệu làm gốc ghép ở cả 2 vùng thí nghiệm cho thấy có mật độ tuyến tr ùng trong rễ thấp (trung bình 14 - 87 con/5g rễ), trong khi đó giống đối chứng đều có mật độ tuyến trùng cao hơn ở cả 2 vùng thí nghiệm (trung bình 137 - 232 con/5g rễ). Tỷ lệ cây vàng lá, chết ở giống đối chứng cũng được ghi nhận cao hơn 2 vật liệu 34/2 và 10/24 sau 12 tháng trồng. Như vậy, bước đầu cho thấy rằng 2 vật liệu 34/2 và 10/24 làm gốc ghép có nhiều triển vọng hơn so với giống đối chứng trong cù ng điều kiện thí nghiệm. IV. KẾT LUẬN VÀ ĐỀ NGHỊ 4.1. Kết luận - Kết quả định danh các mẫu tuyến trùng gây hại trên cà phê bằng biện pháp sinh học phân tử chỉ ra rằng các quần thể tuyến trùng Pratylenchus gây hại chính được phân lập từ vùng Tây Nguyên là loài Pratylenchus coffeae. - Bốn vật liệu giống (N. Trên, R2D 1/42, Được C2 và Hiên C1) có khả năng chống chịu khá tốt trên nền đất nhiễm tuyến trùng so với các vật liệu khác trong cùng điều kiện thí nghiệm, tỷ 641 VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM lệ cây chết sau 12 tháng trồng ổn định từ 20,0 - 26,7%. Trong khi các vật liệu khác có tủ lệ cây chết trên 70%. - Hai vật liệu giống 34/2 và 10/24 sau 14 tuần lây nhiễm tuyến trùng (3.000 - 4.000 con P. coffeae/bầu) có khả năng chống chịu tốt, sinh trưởng không khác biệt so với đối chứng không lây nhiễm trong điều kiện nhà lưới. - Đánh giá 2 vật liệu giống 34/2 và 10/24 dùng làm gốc ghép trên đồng ruộng bước đầu cho thấy có sự sai khác về tỷ lệ cây vàng lá và chết so với giống đối chứng. 4.2. Đề nghị - Tiếp tục thực hiện các thí nghiệm lây nhiễm tuyến trùng nhân tạo cho 4 vật liệu giống đã đánh giá nhanh trên nền đất bệnh trong điều kiện nhà lưới (N. Trên, R2D1/42, Được C2 và Hiên C1). Đồng thời tiếp tục đánh giá nhanh các vật liệu hiện đang được trồng trên nền đất bệnh trong điều kiện nhà lưới. - Tiếp tục th eo dõi thí nghiệm đánh giá lại vật liệu có khả năng kháng tuyến trùng dùng làm gốc ghép trên đồng ruộng để có kết luận chính xác về tính chống chịu của hai vật liệu 34/2 và 10/24. TÀI LIỆU THAM KHẢO 1. Phan Quốc Sủng và cộng sự (2001). Điều tra nghiên cứu hội chứng vàng lá cà phê và biện pháp phòng trừ. Báo cáo tổng kết - Đề tài độc lập cấp Nhà nước (1997 - 2001) Bộ Khoa học Công nghệ và Môi trường. 2. Castillo P. & Volvlas N. (2007). Pratylenchus (Nematoda, Pratylenchidea): Diagnosis, biology, phathogenicity and management. Nematology Monogaphs and Perspective 6. 3. De Grisse A. T. (1969). Rédescription ou modification de quelques techniques utilisées dans l’étude des nématodes phytoparasitaires. Mededelingen - Rijksfakulteit Landbouwetens- chappen Gent 34: 351 - 369. 4. Duncan, L. W., Inserra, R. N., Thomas, W. K., Dunn, D., Mustika, I., Frisse, L. M., Mendes, M. L., Morris, K. and Kaplan, D. T. (1999). Molecular and morphological analysis of isolates of Pratylenchus coffeae and closely related species. Nematropica 29: 61 - 80. 5. Hall, T. A. (1999). BioEdit: a user - friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Serial 41, 95 - 98. 6. Inserra, R. N., Trocoli, A., Gozel, U., Bernard, E. C., Dunn, D. and Duncan, L. W. (2007). Pratylenchus hippeastri n. sp. (Nematoda: Pratylenchidae) from amaryllis in Florida with notes on P. scribneri and P. hexincisus. Ne matology 9, 25 - 42. 7. Inserra, R. N., Duncan, L. W., Troccoli A., Dunn, D., Maia dos Santos J., Kaplan, D. and Vovlas, N. (2001). Pratylenchus jaehni sp. n. from citrus in Brazil and its relationship with P. coffeae and P. loosi (Nematode: Pratylenchidae). Nematology 3: 653 - 665. 8. Subbotin, S. A., Ragsdale, E. J., Mullens, T., Roberts, P. A., Mundo - Ocampo, M., and Baldwin, J. G. (2008). A phylogenetic framework for root lesion nematodes of the genus Pratylenchus (Nematoda): Evidence from 18S and D2 - D3 expansion segments of 28S ribosomal RNA genes and morphological characters. Molecular Phylogenetics and Evolution 48, 491 - 505. 9. Waeyenberge, L., Ryss A. Y., and Moens M. (2000). Molecular characterisation of 18 Pratylenchus species using rDNA Restriction Fragment Length Polymorphism. Nematology 2, 135 - 142. 642 . HỌC NÔNG NGHIỆP VIỆT NAM NGHIÊN CỨU CHỌN TẠO DÒNG CÀ PHÊ VỐI CÓ KHẢ NĂNG KHÁNG ĐỐI VỚI LOÀI TUYẾN TRÙNG GÂY HẠI CHÍNH DÙNG LÀM GỐC GHÉP CHO CÁC GIỐNG CÀ PHÊ THƯƠNG MẠI Lê Ngọc Báu, Đinh Thị. khả năng kháng với tuyến trùng gây hại chính dùng làm gốc ghép cho các giống cà phê thương mại. II. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1. Vật liệu - Các vật liệu giống (chồi) được thu thập. bền vững, có hiệu quả cao về mặt kinh tế, xã hội và môi trường với mục tiêu: - Chọn lọc được một số vật liệu cà phê làm gốc ghép có khả năng khá ng với loài tuyến trùng gây hại chính nhằm
- Xem thêm -

Xem thêm: NGHIÊN CỨU CHỌN TẠO DÒNG CÀ PHÊ VỐI CÓ KHẢ NĂNG KHÁNG ĐỐI VỚI LOÀI TUYẾN TRÙNG GÂY HẠI CHÍNH DÙNG LÀM GỐC GHÉP CHO CÁC GIỐNG CÀ PHÊ THƯƠNG MẠI, NGHIÊN CỨU CHỌN TẠO DÒNG CÀ PHÊ VỐI CÓ KHẢ NĂNG KHÁNG ĐỐI VỚI LOÀI TUYẾN TRÙNG GÂY HẠI CHÍNH DÙNG LÀM GỐC GHÉP CHO CÁC GIỐNG CÀ PHÊ THƯƠNG MẠI, NGHIÊN CỨU CHỌN TẠO DÒNG CÀ PHÊ VỐI CÓ KHẢ NĂNG KHÁNG ĐỐI VỚI LOÀI TUYẾN TRÙNG GÂY HẠI CHÍNH DÙNG LÀM GỐC GHÉP CHO CÁC GIỐNG CÀ PHÊ THƯƠNG MẠI

Từ khóa liên quan

Gợi ý tài liệu liên quan cho bạn