Đề tài nấm Beauveria bassiana

62 909 10
vờ_inh xinh

vờ_inh xinh

Tải lên: 17,813 tài liệu

  • Loading...
1/62 trang
Tải xuống 2,000₫

Thông tin tài liệu

Ngày đăng: 19/03/2013, 16:05

Đề tài nấm Beauveria bassiana 1 Phần I. MỞ ĐẦU 1.1. Đặt vấn đề Cuộc cách mạng khoa học kỹ thuật trong nông nghiệp đã mang lại nhiều thành tựu to lớn trong đó quan trọng nhất là giảm tỷ lệ đói nghèo trên thế giới nhờ nâng cao năng suất cây trồng. Mặc dù thuốc bảo vệ thực vật giúp giảm tổn thất do sâu hại (ước tính mức độ tổn thất do sâu hại nếu không sử dụng thuốc trừ sâu là 83 % ở lúa gạo và 84 % ở bông vải (Viện lúa đồng bằng sông Cửu Long, 2004)) song thuốc trừ sâu cũng mang lại những bất lợi khó giải quyết như: ô nhiễm môi trường, độc hại cho sức khỏe con người, mất cân bằng sinh thái và gây tính kháng của côn trùng. Trong những năm gần đây, với sự phát triển mạnh mẽ của công nghệ sinh học, các nhà khoa học tập trung nghiên cứu tạo ra các cây trồng chuyển gen mang tính kháng, xem các giống kháng là thành phần chủ yếu trong hệ thống phòng trừ tổng hợp. Tuy nhiên, những gen dùng trong công nghệ chuyển gen còn ít, chuyển gen tỷ lệ thành công thấp và vẫn còn tồn tại những tranh cãi về tính an toàn của cây chuyển gen nên thuốc trừ sâu vi sinh được coi là giải pháp khả thi, có thể đáp ứng nhanh yêu cầu của con người về một giải pháp phòng trừ sâu hại an toàn môi sinh và hiệu quả, giúp hạn chế sử dụng thuốc trừ sâu hóa học. Thuốc trừ sâu vi sinh gồm các sản phẩm từ các loài thiên địch của sâu như: các loài ăn mồi, ký sinh, nguồn bệnh, trong đó các chế phẩm tạo nên trên cơ sở các loài nấm chiếm vị trí quan trọng, đặc biệt chế phẩm nấm diệt sâu từ nấm Beauveria bassiana đã có hiệu lực cao tiêu diệt nhiều loài côn trùng gây hại. Để nâng cao hiệu quả ứng dụng của nấm này, cần đẩy mạnh các nghiên cứu về sinh học, sinh lý, sinh thái và mối quan hệ giữa nấm Beauveria bassiana với côn trùng vật chủ. Trong đó, nhiệm vụ trung tâm của công nghệ sinh học hiện nay khi nghiên cứu các đối tượng là đọc được chuỗi mã DNA để phân tích bộ genome nhằm tìm hiểu quan hệ di truyền của các đối tượng nghiên cứu và mối liên hệ giữa genome với tính độc của nấm nhằm tạo ra các chế phẩm vi nấm có hiệu quả diệt côn trùng cao. Trong phạm vi nghiên cứu của đề tài, chúng tôi chỉ đọc trình tự vùng ITS1 - 5,8 S - ITS2 của rDNA để so sánh sự biến đổi trong trình tự giữa các chủng nấm Beauveria bassiana. 2 1.2. Mục tiêu đề tài Khuếch đại vùng gen ITS1 - 5,8 S - ITS2 các nguồn nấm Beauveria basiana có tính độc cao và đọc trình tự sản phẩm PCR của nấm làm cơ sở xác định mối liên hệ giữa tính độc của nấm với những biến đổi trong trình tự vùng ITS - rDNA 1.3. Yêu cầu Nắm vững nguyên tắc nuôi cấy và nhân sinh khối nấm. Nắm vững kỹ thuật PCR Nắm vững nguyên tắc đọc trình tự. 1.4. Nội dung thực hiện Phân lập thêm một số dòng nấm Beauveria bassiana ký sinh trên côn trùng. Khuếch đại vùng gen ITS1 - 5,8 S - ITS2 của các dòng nấm có tính độc cao. Đọc trình tự vùng gen ITS1 - 5,8 S - ITS2 trực tiếp từ sản phẩm PCR và tiến hành so sánh với cơ sở dữ liệu của NCBI. 3 Phần 2. TỔNG QUAN TÀI LIỆU 2.1. Giới thiệu về nấm Beauveria bassiana 2.1.1. Vị trí phân loại Lớp: Deuteromycetes. Bộ: Moniliales. Họ: Moniliaceae. Giống: Beauveria. Giống Beauveria thường được chia thành 3 loài: Beauveria bassiana, Beauveria brongniarti, Beauveria alba, trong đó 2 loài đầu là tác nhân gây bệnh côn trùng (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). 2.1.2. Đặc điểm hình thái Theo Nguyễn Ngọc Tú - Nguyễn Cửu Thị Hương Giang (1997), “Nấm Beauveria bassiana có bào tử trần hình cầu (đường kính 1 - 4 m) đến hình trứng (1,5- 5,5 x 1,3 m). Sợi nấm có chiều ngang khoảng 3 - 5 m phát triển dày đặt trên môi trường, mang nhiều cuống sinh bào tử và bào tử. Mặt khuẩn lạc nấm dạng phấn trắng.” Nấm khi mọc trên côn trùng thường có màu trắng hoặc vàng nhạt, đôi khi hơi sẫm, bề mặt trơn và có nhiều bột, hiếm khi tập hợp thành bó sợi. Khi mọc trên môi trường thạch, nấm Beauveria bassiana nhìn chung có màu trắng, viền khuẩn lạc thường có màu kem hoặc vàng nhạt, thỉnh thoảng có màu đỏ nhạt (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). Beauveria bassiana tạo rất nhiều bào tử, bào tử thường có hình cầu, hình trứng, có khi chiều dài lên tới 20 m với 1 m chiều rộng. Các sợi nấm khí sinh mang các giá bào tử trần ngắn, phồng to 3 - 5 x 3 - 6 m. Các giá bào tử này hoặc tạo thành các nhánh ở phần ngọn, hoặc trực tiếp tạo thành các tế bào sinh bào tử trần. Các tế bào sinh bào tử trần thành cụm, được tạo thành từ giá hoặc từ nhánh của giá, hoặc được tạo thành trực tiếp từ sợi nấm khí sinh hay từ nhánh ngang và ngắn của các sợi nấm này. Phần gốc của tế bào sinh bào tử trần hình cầu, hình chai 2,5 - 3,5 x 3 - 6 m, phần ngọn của tế bào dạng cuống hẹp, ngoằn ngoèo hình chữ chi, hoặc ngoằn ngoèo không 4 đều, có răng cưa 1 x 5 - 20 m. Bào tử trần không có vách ngăn, hình cầu hoặc elip, đôi khi có gốc nhọn, nhẵn 2 – 3 x 2 – 4 m, màu trắng hay vàng nhạt (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). 2.1.3. Đặc điểm nuôi cấy Môi trƣờng nuôi cấy Do có hệ enzyme phong phú (lipase, protease, urease, aspatainase, amylase) nên nấm này có khả năng phát triển trên nhiều loại môi trường dinh dưỡng với các thành phần khác nhau. Trong đó môi trường thạch khoai tây hay được sử dụng và khả năng phát triển của nấm trên môi trường này là tốt nhất (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). Điều kiện nhiệt độ Nhiệt độ đóng vai trò quan trọng, hầu như ảnh hưởng tới toàn bộ hoạt động sống của nấm, mỗi loại nấm chỉ có khả năng phát triển trong một giới hạn nhiệt độ nhất định. Nhiệt độ thích hợp nhất cho sự nảy mầm, phát triển và tạo bào tử của nấm Beauveria bassiana là 25 – 30 o C (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). Điều kiện pH Theo Veliska (1967), giá trị pH môi trường từ 3 - 9 không ảnh hưởng tới sự phát triển tạo sinh khối của nấm Beauveria bassiana và theo Goral (1970) nấm Beauveria bassiana thuộc vi sinh vật có khả năng điều chỉnh pH môi trường, pH thuận lợi cho sự phát triển là 5,7 - 6,0. Ngoài ra, có nhiều nghiên cứu cho rằng khả năng phát triển tốt nhất của nấm Beauveria bassiana là 6,2 - 6,3 (trích dẫn bởi Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). 2.1.4. Điều kiện phân bố Nấm Beauveria bassiana phân bố rộng khắp. Giống như hầu hết các loại nấm diệt sâu khác, khi rơi vào một nơi nào đó, chúng đều có khả năng trở thành thành viên trong sinh quần nơi đó và tự sinh sôi nảy nở tăng lên. Vì là vật ký sinh chuyên hóa 5 rộng nên nấm này có khả năng tồn tại khi thiếu vật chủ chính. Khả năng nhiễm thành công của nấm với côn trùng là khá lớn vì chúng có nhiều cách xâm nhiễm khác nhau: qua lớp cutin, qua đường tiêu hóa, qua đường hô hấp và qua lỗ của thân. Ngoài ra, nấm Beauveria bassiana còn có khả năng tồn tại trong điều kiện môi trường không thuận lợi dưới dạng giả hạch nấm (các sợi nấm dinh dưỡng kết lại thành một thể rắn chắc). Có thể sử dụng rộng rãi nấm Beauveria bassiana trong thực tiễn nông nghiệp vì: chúng có thể phát triển trên môi trường dinh dưỡng, có thể được chế tạo ở dạng chế phẩm sinh học, và tiêu diệt một lượng không nhiều các côn trùng có ích (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). Nấm Beauveria bassiana có khả năng phát tán rộng trong thiên nhiên thông qua các hoạt động phóng bào tử bằng cơ học (chúng có có khả năng bắn bào tử tới khoảng cách gấp hàng nghìn lần lớn hơn kích thước của chúng), lan truyền nhờ dòng nước, không khí và côn trùng (một số loài của bộ Collembola, như Lepidocyrtus giúp nấm Beauveria bassiana di chuyển khá xa) (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). 2.1.5. Độc tố của nấm Beauveria bassiana Chất diệt côn trùng của nấm Beauveria bassiana là chất chúng tiết ra khi bào tử nảy mầm. Tên thông thường của độc tố là beauverixin, công thức hóa học C 45 H 57 O 9 N 3 - ciclo (N - metyl - L - phenylalanin - D - - hydroxyizovalery) 3 . Đó là một loại depxipeptit vòng có điểm sôi 93 - 94 o C (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). 6 Hình 2.1 Cấu trúc phân tử của beauvericin (F. R. Champlin, 1979) Tiến trình cấy chuyền Beauveria bassiana qua côn trùng vật chủ sống thì nồng độ độc tố tạo thành tăng hơn so với Beauveria bassiana phân lập giữ trên môi trường tổng hợp. Ngoài ra, nồng độ độc tố cao nhất với sâu được tạo thành khi nấm được nuôi cấy trên chính sâu này. Như vậy, nguồn dinh dưỡng của nấm có ý nghĩa đối với sự hình thành độc tố chuyên hóa (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). Ngoài ra, mô côn trùng bị nhiễm nấm thì bền vững dưới tác dụng của vi sinh vật gây thối rữa chứng tỏ nấm này có khả năng tạo ra một số chất trao đổi giống kháng sinh. Evlachova (1970) đã nghiên cứu tính chất kháng khuẩn của một số nòi nấm Beauveria bassiana và kết luận rằng phổ diệt khuẩn của chúng khá rộng. Tính chất này rất có ý nghĩa trong thực tiễn sản xuất (trích dẫn Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). 2.1.6. Quá trình nhiễm nấm vào côn trùng Sự xâm nhập Các nấm diệt sâu xâm nhập vào cơ thể côn trùng qua toàn bộ vỏ cutincun ngoài nhờ enzyme phân hủy lớp chitin của cutincun (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). Theo Robinson R.K. (1996), sự xâm nhập của nấm diệt sâu qua lớp cutincun ngoài được thực hiện bằng lực cơ học, còn sự tiến sâu vào lớp cutincun trong thì được thực hiện nhờ họat động của enzyme do chính nấm tiết ra. Ngoài ra, Robinson R.K. 7 cũng xác nhận rằng các nấm diệt sâu chuyên hóa cao tạo nên trên bề mặt cutincun một kiểu giác bám phồng lên dạng kim xuyên vào bên trong cuticun của côn trùng. Sự xâm nhập vào xoang thân côn trùng xảy ra khá nhanh chóng, qua 32 - 48 giờ đã làm đầy cơ thể côn trùng với những đoạn sợi nấm đơn bào tự do bơi trong huyết tương dẫn đến sự phá hủy tiếp theo mô thân côn trùng (trích dẫn Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). Sự phát triển của nấm tới khi côn trùng chết Theo Sekhurina J. A. (1964), khi các bào tử chồi của nấm Beauveria bassiana bắt đầu sinh sôi nảy nở trong huyết tương của bọ rùa thì bọ rùa bắt đầu tê liệt, và sau khi vật chủ chết thì nấm mọc thành sợi nấm chui vào trong các bắp cơ và khí quản của côn trùng; các chế phẩm mô bệnh lý nhuộm cho thấy hạch thần kinh bị biến đổi màu do ảnh hưởng của độc tố (ở giai đoạn đầu của bệnh tê liệt các hạch thần kinh có màu xanh tím, khi bị nấm ký sinh có màu xanh đỏ đậm trong khi đó màu của hạch thần kinh ở côn trùng khỏe có màu xanh lá cây) (trích dẫn Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). Hình 2.2 Quá trình nhiễm nấm vào côn trùng (Scholte E-J, 2004) 2.1.7. Triệu chứng của côn trùng nhiễm nấm A: sự xâm nhập. B: lớp cutin. C: sợi nấm phát triển. D: sợi nấm hình thành vách ngăn. E: túi bào tử hình thành. F: bào tử động. G: bào tử noãn. 8 Nhiều công trình nghiên cứu ảnh hưởng của nấm có lợi lên các đối tượng côn trùng khác nhau đã đưa ra các kết quả mô tả triệu chứng khác nhau: Làm biến đổi thành phần, hình dạng các nguyên tố enzyme và phản ứng huyết tương, làm giảm khả năng sinh sản, làm giảm trọng lượng, phá hủy sự hô hấp và phá hủy chức năng hệ thống nội tiết của côn trùng. Khi nghiên cứu về ảnh hưởng của nấm Beauveria bassiana lên độ mắn đẻ của bướm Torticidae hại táo, Kondria V.S (1966) đã đưa ra kết luận rằng việc xử lý nhộng bởi nấm này làm giảm độ mắn đẻ của bướm rất nhiều. Trong các thí nghiệm nhiễm 5000, 15000, 45000 bào tử nấm Beauveria bassiana lên các con cái thì số lượng trứng trung bình còn lại không bị hư lần lượt là 59, 47 và 29 so với đối chứng là 71 trứng. Zagae (1963) cho biết độ mắn đẻ của các con cái bọ cánh cứng nhiễm Beauveria bassiana đã giảm tới 48 % so với đối chứng và nếu kết hợp với DDT sẽ giảm tới 83 % (trích dẫn bởi Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang). Phá hủy chức năng sinh lý của côn trùng. Theo Ferron P. (1967) thì sự nhiễm nấm trắng và nấm xanh trên sâu Melolontha melolontha sẽ gây ra hiện tượng biến đổi sinh hóa và giảm lực oxy hóa khử dẫn tới tình trạng hóa melanin trong huyết tương. Ngoài ra, công trình nghiên cứu của Codaira (1967) cho thấy sự nhiễm nấm vào côn trùng còn làm thay đổi độ nhớt của huyết tương. Một số các nhà nghiên cứu khác (Dieuzeide R. 1926, Cordon T.C và Schwartz J.H. 1962) còn thấy các tinh thể được tạo thành trong huyết tương khi côn trùng bị nhiễm nấm (trích dẫn bởi Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang). Phá hủy quá trình biến thái và phát triển của côn trùng, cụ thể là các ấu trùng bị nhiễm nấm không lột xác được (Benz G., 1963). Theo Gosswald K. (1938), nấm Beauveria bassiana có thể nhiễm tất cả các pha phát triển của Bombyx mori. Theo Prasertphon (1967), khi nấm B. bassiana nhiễm vào ấu trùng tuổi 4 và 5 của bọ rùa gây hại thì biểu hiện của ấu trùng bị phá hủy như sau: ấu trùng và rệp non không thể thoát ra khỏi tầng cutincun cứng và ở mức độ cao hơn thì côn trùng có dạng gù quái dị (trích dẫn Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). 2.1.8. Các chể phẩm sinh học từ nấm Beauveria bassiana 9 Theo danh mục thuốc bảo vệ thực vật được phép sử dụng ở Việt Nam (quyết định số 15/2004/QD – BNN ngày 14 tháng 4 năm 2004, các loại chế phẩm nấm Beauveria bassiana được phép sử dụng gồm có: Boverit 5,0 x 10 8 bào tử/g (Viện Bảo vệ Thực vật) trừ rầy nâu hại lúa, sâu đo xanh hại đay, sâu róm hại thông, sâu kèn hại tai tượng. Biovip 1,5 x 10 9 bào tử/g (Viện lúa đồng bằng sông Cửu Long) trừ rầy và bọ xít hại lúa. Beauverine (Công ty Thanh Sơn Hóa Nông) trừ sâu tơ hại bắp cải, sâu đục quả hại xoài. Muskardin (Công ty cổ phần thuốc trừ sâu Cần Thơ) trừ sâu đục thân hại lúa và ngô. Bermetent (Công ty hợp danh sinh học nông nghiệp Sinh Thành, Thành phố Hồ Chí Minh), trừ bọ cánh cứng hại dừa, sâu đục thân, rệp sáp, rầy đen hại mía. 2.2. Tổng quan về ITS - rDNA 2.2.1. Giới thiệu về rDNA và vùng ITS rDNA là nhóm gen mã hóa rRNA của ribosom, đóng vai trò quan trọng trong các nghiên cứu quan hệ phát sinh loài. rDNA được quan tâm nghiên cứu vì nó là một gen có nhiều bản sao và đặc biệt không mã hóa cho protein nào. Các bản sao của gen nằm liên tiếp trên một locus và liên quan mật thiết tới quá trình tiến hóa. Hơn nữa, ribosom hầu như tồn tại trong mọi sinh vật và có cùng nguồn gốc tiến hóa. Phần lớn phân tử rDNA tương đối bảo tồn nên được xem là cơ sở để tìm ra sự tương đồng và các khác biệt khi so sánh các sinh vật khác nhau. Các primer thiết kế dựa trên những oligonucleotide có tính bảo tồn cao được sử dụng cho tất cả sinh vật nhằm khuếch đại các vùng tương đương dùng trong so sánh. Ngoài ra, nhiều primer và probe cũng được thiết kế dựa trên các vùng không bảo tồn dùng trong phát hiện và định danh vi sinh vật (Van de Peer và cộng sự, 1996). Các rDNA 5,8 S, 18 S, và 25 S phiên mã thành các tiền rRNA riêng rẽ, nằm xen kẽ với các vùng phiên mã bên trong (ITS) và các vùng phiên mã bên ngoài (ETS). Giữa các nhóm gen gồm nhiều bản sao lập lại là vùng không phiên mã. Có một rDNA 5 S thường không có vị trí cố định và có chiều sao mã ngược với các gen còn lại, rDNA 5 S thường chỉ có ở nhân, không có ở ty thể của một số loài nấm. Kích thước của mỗi vùng lập lại nằm trong khoảng 7,7 – 24 kbp (Guarro, 1999). 10 Hình 2.3 Sơ đồ nhóm gen rDNA nhân và rDNA ty thể (White và cộng sự, 1989) rDNA 18 S thường được quan tâm nghiên cứu; rDNA 5,8 S có kích thước rất nhỏ và ít có sự biến đổi song rRNA 5 S là thành phần không thể thiếu của nu - LSU- rRNA, có vai trò ổn định cấu trúc ribosom và thúc đẩy quá trình tổng hợp protein (Szymanski và cộng sự, 2001); rDNA 25 S mặc dù ít có sự biến đổi song lại rất có ý nghĩa trong phân loại (Guarro, 1999). Vùng ITS là vùng có rất nhiều sự biến đổi, mặc dù vùng ITS thường được sử dụng trong nghiên cứu tiến hóa của vi sinh tuy nhiên phần lớn các so sánh trên vùng này chỉ thường sử dụng ở mức độ xác định các biệt hóa trong cùng loài (Guarro, 1999). 2.2.2. Phân nhóm rDNA Theo White và cộng sự (1989), rDNA có thể chia thành 2 nhóm: rDNA nhân và rDNA ty thể. rDNA nhân rDNA nhân (nu - rDNA) gồm có nu - SSU - rDNA (17 - 18 S) mã hóa rRNA tiểu đơn vị nhỏ (small subunit rDNA) và nu - LSU - rDNA (26 - 28 S) mã hóa rRNA tiểu đơn vị lớn (large subunit rDNA). Nu - SSU - rDNA tiến hóa tương đối chậm, thường được sử dụng trong nghiên cứu các sinh vật có ít quan hệ về mặt di truyền. Nu - LSU - rDNA mặc dù có ít vùng [...]... Mt – LSU – rDNA ML1 GTACTTTTGCATAATGGGTCAGC 68 3 Phần 2. TỔNG QUAN TÀI LIỆU 2.1. Giới thiệu về nấm Beauveria bassiana 2.1.1. Vị trí phân loại Lớp: Deuteromycetes. Bộ: Moniliales. Họ: Moniliaceae. Giống: Beauveria. Giống Beauveria thường được chia thành 3 loài: Beauveria bassiana, Beauveria brongniarti, Beauveria alba, trong đó 2 loài đầu là tác nhân gây bệnh côn trùng (Nguyễn... chúng), lan truyền nhờ dòng nước, không khí và côn trùng (một số loài của bộ Collembola, như Lepidocyrtus giúp nấm Beauveria bassiana di chuyển khá xa) (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). 2.1.5. Độc tố của nấm Beauveria bassiana Chất diệt côn trùng của nấm Beauveria bassiana là chất chúng tiết ra khi bào tử nảy mầm. Tên thông thường của độc tố là beauverixin, công thức hóa... 0,30 1,32 Nhận xét: Qua bảng 4.1 cho thấy tất cả các nguồn nấm thí nghiệm đều có khả năng tạo sợi nấm trong môi trường lỏng CZA. Nguồn nấm BH-BD-13 cho khối lượng cao nhất với khối lượng là 2,23 g. Nguồn nấm RN-LA-10 cho khối lượng thấp nhất với khối lượng là 0,3 g. 4.2. Kết quả li trích DNA tổng số các nguồn nấm Beauveria bassiana Tiến hành ly trích DNA của 22 nguồn đã được nhân sinh... 5.8S 5 rộng nên nấm này có khả năng tồn tại khi thiếu vật chủ chính. Khả năng nhiễm thành công của nấm với côn trùng là khá lớn vì chúng có nhiều cách xâm nhiễm khác nhau: qua lớp cutin, qua đường tiêu hóa, qua đường hô hấp và qua lỗ của thân. Ngoài ra, nấm Beauveria bassiana còn có khả năng tồn tại trong điều kiện môi trường không thuận lợi dưới dạng giả hạch nấm (các sợi nấm dinh dưỡng kết... dưỡng kết lại thành một thể rắn chắc). Có thể sử dụng rộng rãi nấm Beauveria bassiana trong thực tiễn nông nghiệp vì: chúng có thể phát triển trên môi trường dinh dưỡng, có thể được chế tạo ở dạng chế phẩm sinh học, và tiêu diệt một lượng không nhiều các côn trùng có ích (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). Nấm Beauveria bassiana có khả năng phát tán rộng trong thiên nhiên thông qua... điểm hình thái Theo Nguyễn Ngọc Tú - Nguyễn Cửu Thị Hương Giang (1997), Nấm Beauveria bassiana có bào tử trần hình cầu (đường kính 1 - 4 m) đến hình trứng (1,5-5,5 x 1,3 m). Sợi nấm có chiều ngang khoảng 3 - 5 m phát triển dày đặt trên môi trường, mang nhiều cuống sinh bào tử và bào tử. Mặt khuẩn lạc nấm dạng phấn trắng.” Nấm khi mọc trên côn trùng thường có màu trắng hoặc vàng nhạt, đôi khi hơi... bó sợi. Khi mọc trên môi trường thạch, nấm Beauveria bassiana nhìn chung có màu trắng, viền khuẩn lạc thường có màu kem hoặc vàng nhạt, thỉnh thoảng có màu đỏ nhạt (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hương Giang, 1997). Beauveria bassiana tạo rất nhiều bào tử, bào tử thường có hình cầu, hình trứng, có khi chiều dài lên tới 20 m với 1 m chiều rộng. Các sợi nấm khí sinh mang các giá bào tử trần ngắn,... 15 phút. Nhận xét: Tất cả 7 nguồn nấm thí nghiệm đều có sản phẩm khuếch đại kích thước 580 bp (gần vị trí band thấp của loading dye) giống với đối chứng dương. Nấm Corynespora cũng cho sản phẩm khuếch đại với kích thước tương tự chứng tỏ 2 primer ITS4 và ITS5 có thể sử dụng để khuếch đại vùng tương ứng trên nấm Corynespora. Tất cả 9 nguồn nấm thí nghiệm đều có sản phẩm phụ tương tự thí nghiệm... Khuếch đại vùng ITS1 - 5,8 S - ITS2 của các nguồn nấm Beauveria bassiana có tính độc cao 3.3.1. Hóa chất và dụng cụ thí nghiệm dùng trong phản ứng PCR Hóa chất Master mix 2X (Sapphire) Các primer: 2 primer sử dụng trong nghiên cứu là ITS 4 và ITS 5 (Biorad), được thiết kế để khuếch đại vùng ITS1 - 5,8 S - ITS2 của các dòng nấm Beauveria bassiana. Trình tự của các primer: Primer Trình... sợi nấm khí sinh hay từ nhánh ngang và ngắn của các sợi nấm này. Phần gốc của tế bào sinh bào tử trần hình cầu, hình chai 2,5 - 3,5 x 3 - 6 m, phần ngọn của tế bào dạng cuống hẹp, ngoằn ngoèo hình chữ chi, hoặc ngoằn ngoèo không 9 Theo danh mục thuốc bảo vệ thực vật được phép sử dụng ở Việt Nam (quyết định số 15/2004/QD – BNN ngày 14 tháng 4 năm 2004, các loại chế phẩm nấm Beauveria bassiana . tự giữa các chủng nấm Beauveria bassiana. 2 1.2. Mục tiêu đề tài Khuếch đại vùng gen ITS1 - 5,8 S - ITS2 các nguồn nấm Beauveria basiana. Moniliaceae. Giống: Beauveria. Giống Beauveria thường được chia thành 3 loài: Beauveria bassiana, Beauveria brongniarti, Beauveria alba, trong
- Xem thêm -

Xem thêm: Đề tài nấm Beauveria bassiana, Đề tài nấm Beauveria bassiana, Đề tài nấm Beauveria bassiana

Bình luận về tài liệu de-tai-nam-beauveria-bassiana

Gợi ý tài liệu liên quan cho bạn

Nạp tiền Tải lên
Đăng ký
Đăng nhập
× Nạp tiền Đã