Conditionally immortalized adrenocortical cell lines at undifferentiated states exhibit inducible expression of glucocorticoid-synthesizing genes Kuniaki Mukai 1 , Hideko Nagasawa 1, *, Reiko Agake-Suzuki 1 , Fumiko Mitani 1 , Keiko Totani 1 , Nobuaki Yanai 2 , Masuo Obinata 2 , Makoto Suematsu 1 and Yuzuru Ishimura 1 1 Department of Biochemistry and Integrative Medical Biology, School of Medicine, Keio University, Shinjuku-ku, Tokyo, Japan; 2 Institute of Development, Aging and Cancer, Tohoku University, Sendai, Japan To facilitate studies on dierentiation of adrenocortical cells and regulation of steroidogenic genes, we established cell lines from adrenals of adult transgenic mice harboring a temperature-sensitive large T-antigen gene of s imian virus 40. Adrenal glands of the mice exhibited normal cortical zonation including a functionally undierentiated c ell-layer between the aldosterone-synthesizing zona glomerulosa cells and the corticosterone-synthesizing zona fasciculata cells. At a permissive temperature (33 °C), established cell lines AcA201, AcE60 and A cA101 expressed steroidogenic g enes encoding steroidogenic factor-1, cholesterol side-chain cleavage P 450scc, and s teroidogenic acute regulatory pro- tein, which are expressed throughout adrenal cortices and gonads. Genes encoding 3 b-hydroxysteroid dehydrogenase and s teroid 21-hydroxylase P450c21, which catalyze the intermediate steps for syntheses of both aldosterone and corticosterone, were inducible in the three cell lines in tem- perature- and/or dibutyryl cAMP-dependent manners. Notably, these cell lines displayed distinct expression pat- terns of the steroid 1 1b-hydroxylase P45011b gene respon- sible f or the zone-speci®c s ynthesis of corticosterone. AcA201 cells expressed the P45011b gen e at 33 °C, showing the property of the zona fasciculata cells, while AcE60 cells expressed it upon a shift to a nonpermissive temperature (39 °C). On the other hand, AcA101 expressed the P45011b gene at 39 °C synergistically with exposure to dibutyryl cAMP. N one of these clones express the z ona glomerulosa- speci®c aldosterone synthase P450aldo gene under the con- ditions we tested. These results show that AcE60 and AcA101 cells display a pattern of the steroidogenic gene expression similar to that of the undierentiated cell-layer and are capable of dierentiating into the zona fasciculata- like cells in vitro. Keywords: adrenal cortex; s teroid hormone; i mmor- talization; simian virus 40 large T-antigen. Adrenal cortices in m ammals are composed o f morpho- logically and functionally differentiated cell zones [1,2]. The outer zone, the zona glomerulosa, synthesizes aldos- terone, the most potent mineralocorticoid. The middle zone, t he zona fasciculata p roduces corticosterone in rodents and cortisol in humans and other animals. The inner zone, the zona re ticularis s ecretes adrenal androgens in humans and in some other animals. In rodents, aldosterone and corticosterone are produced from a common substrate, deoxycorticosterone. Deoxycorticoster- one is synthesized from cholesterol by a successive action of cholesterol side-chain cleavage enzyme cytochrome P450scc ( P450scc, or the Cyp11a gene product), 3b- hydroxysteroid dehydrogenase (3bHSD), and 21-hydroxy- lase c ytochrome P 450c21 (P450c21, the Cy p21a ge ne product) [1,3]. These enzymes are present throughout the adrenal cortex [4±6]. On the other h and, two structurally related enzymes, aldosterone synthase cytochrome P450aldo (P450aldo, or the CYP11b-2 gene product) and 11b-hydroxylase cytochrome P45011b (P45011b,orthe Cyp11b-1 gene product), convert deoxycorticosterone into aldosterone in the zona glomerulosa and into corticoster- one in the zona fasciculata, respectively [7±9]. Thus, the zonal differences in the steroid products are attributable to localization of the two enzymes responsible for the last steps in the steroidogenesis [10]. Correspondence to K. Mukai, Department of Biochemistry and Integrative Medical Biology, School of Medicine, Keio University, 35 Shinano- machi, Shinjuku-ku, Tokyo 160-8582, Japan. Fax: + 81 3 3358 8138, Tel.: + 81 3 5363 3752, E-mail: mukaik@sc.itc.keio.ac.jp Abbreviations: StAR, steroid acute regulatory protein; Bt 2 cAMP, dibutyryl cAMP; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; 3bHSD, 3b-hydroxyl steroid dehydrogenase and isomerase; P450, cytochrome P450; P450scc, cholesterol side-chain cleavage P450; P450c21, steroid 21-hydrogenase P450; P45011b,steroid11b-hydroxylase P450; P450aldo, aldosterone synthase P450; PDL, population doubling levels; SF-1, steroidogenic factor-1; SV40, simian virus 40; ts, temperature-sensitive; HBSS, Hank's balanced salt solution. Enzymes: glyceraldehyde 3-phosphate dehydrogenase (EC 1.2.1.9); 3b-hydroxyl steroid dehydroxylase and isomerase (EC 1.1.1.145); cytochrome P450 side-chain cleavage (EC 1.14.15.6); cytochrome P450 steroid 21-hydroxylase (EC 1.14.99.10); c ytochrome P450 steroid 11b-hydroxylase (EC 1.14.15.4); cytochrome P450 aldosterone synthase (EC 1.14.15.4). *Present address: Faculty of Engineering, The University of Tokushima, Tokushima, Japan. (Received 23 July 2001, revised 22 October 2001, accepted 22 October 2001) Eur. J. Biochem. 269, 69±81 (2002) Ó FEBS 2002 Recent studies on regulation of adrenocortical s teroi- dogenesis have focused on mechanisms o f cell-speci®c transcription of genes encoding the steroid hydroxylases (reviewed in [ 11]) and ste roid ac ute regulatory p rotein (StAR) [12]. A mong transcription factors that have been found to regulate the s teroidogenic genes, it has been demonstrated that steroidogenic factor-1 (SF-1, also referred to as Ad4BP) [13,14] is essential for development of steroidogenic organs such as adrenal cortex and gonad s [15,16]. However, molecular mechanisms for development of the adrenocor- tical zonation and its maintenance have not been clarified. We previously showed the presence of a functionally undifferentiated cell layer between the aldosterone-produc- ing zona glomerulosa c ells and the corticosterone-producing zona fasciculata cells in rats [17±20]. It was immunohisto- chemically recognized as the region devoid of both P450aldo and P45011b [17±21]. We also showed that the cell layer is c omposed of the inner half of the zona glomerulosa and the transitional zone (also referred t o as zona intermedia) the latter of which has been described by previous investigators [22±29]. We have provided further evidence that the layer locates in the middle o f the region containing proliferating cells, s uggesting the presence o f precursor or progenitor cells that could differentiate into the glomerulosa and/or fasciculata cells [17,30±33]. This view is consistent with recent observation that adrenocortical cells radially arranging from the zona glomerulosa to the zona reticularis share the same clonal origin [34]. However, such processes for development and differentiation of the adrenal cortices have not fully been investigated because p recursor or progenitor cell lines remain ambiguous. A conditionally immortalizing gene such a s a temperature- sensitive (ts) large T-antigen gene of simian virus 40 (SV40) has been utilized for generation of cell lines [35,36]. We have previously generated transgenic mice [37] carrying a ts SV40 large T-antigen gene tsA58 [38] th at is driven by its own promoter. These transgenic mice have been used to establish various cell lines from different tissues [39,40]. In this s tudy, we have attempted t o establish conditionally immortalized adrenocortical cell lines suitable for in vitro analyses of cell differentiation by using the transgenic mice [37]. MATERIALS AND METHODS Mice and adrenal glands Adrenal glands used in this study were excised from the transgenic mice [37] carrying a ts mutant of SV40 large T-antigen g ene tsA58 [38]. They were maintained on a standard diet containing 0.3% (w/w) Na and with water ad libitum in accordance with the institutional animal care guidelines of Keio University School of Medicine. T he adrenal g lands apparently developed no t umor and had normal histology based on examination with hematoxylin/ eosin staining until at least 10 w eeks old. Immunohistochemistry Immunohistochemical localization of P45011b and P450aldo was performed on 6-lm sections of fresh-frozen adrenal glands from the transgenic mice as previously described [17,41]. The antibodies used were raised in rabbits against rat P45011b and P450aldo [21]. Cell culture Ten adrenal glands from 8-week-old male mice and eight adrenal glands from 10-week-old female mice were used in separate experiments. The adrenals were minced and treated with 1.5 mL of Hank's balanced salt solution (HBSS) containing 2 m gámL )1 collagenase type V (Sigma, St Louis, MO, USA), 0.05 mgámL )1 DNase I (Sigma), and 5mgámL )1 bovine serum albumin (Sigma) at 3 7 °Cfor1 h with gentle shaking. After pipetting to disperse cells, they were collected by centrifugation, and were resuspended with HBSS. The suspension contained 1.0 ´ 10 6 and 7 ´ 10 5 cells from 10 and eight adren als, respectively. The cells were collected by cen trifugation and resuspended at 5 ´ 10 5 cells per mL with one of two cell culture media: medium A, a 1 : 1 mixture of Dulbecco's modi®ed E agle's medium and Ham's F12 medium with 15% heat-inactivated horse serum (Life Technologies, Rockville, MD, USA), 2.5% heat- inactivated fetal bovine serum (Hyclone, Logan, UT, USA), 200 UámL )1 penicillin, and 200 lgámL )1 streptomycin (Life Technologies); medium E, RITC80-7 medium ([42]; Kyo- kuto Pharmaceutical I ndustrial, Tokyo, Japan) with the same additives included in m edium A. The cell suspension (5 ´ 10 4 cells) was placed on the center of a 9.2-cm 2 well. The d ishes had been coated with bovine ®bronectin (Life Technologies) by incubation of multiwell plates o vernight at 37 °C with serum-free medium containing 1 lgámL )1 ®bronectin. After incubation of the cells at 37 °Cfor4h, 2mLofmediumwasaddedgentlyintoeachwell.Gas- phase used was humidi®ed atmosphere containing 5% CO 2 . The next day, the temperature was shifted to 33 °Candthe medium was changed at 3- to 4-day intervals. The cells were transferred to ®bronectin-coated p lates every week u sing 0.05% trypsin-0.53 m M EDTA (Life Technologies). At a third transfer, 25±100 cells were plated in ®bronectin-coated 60-mm dishes in the same media. Visual inspectio n of the plates veri®ed the absence of pairs or groups of cells. After 4 w eeks, colonies (3±4 mm in diameter) were isolated using cloning rings and trypsin-EDTA. Each clone was grown successively in 1.8-cm 2 wells, 9.2-cm 2 wells, and then larger dishes by subculturing. So me cells were used for RNA extraction and others were frozen for subsequent experi- ments. The cell lines obtained at the permissive temperature for the T-antigen were examined for expression of mRNAs for SF-1, P450scc , P45011b,andP450aldo by RT-PCR anal- ysis as described below. SF-1 and P450scc mRNAs were used as ad renocortical cell markers. The reason that w e adopted SF-1 and P450scc as criteria for adrenocortical cells was that they w ere detected in the adrenogenital primordi- um and throughout the c ortex i n a dults [43±46]. P450aldo and P45011b mRNAs w ere used as the zonal differentiation markers that were responsible for production of aldosterone and corticosterone, respectively [21]. We chose three cell lines AcA101, AcA201 (obtained with medium A), a nd AcE60 (obtained with medium E ). They showed differ ent expression patterns of SF-1, P450scc,andP45011b genes (see Results). Their expression patterns of the steroidogenic genes, morphological appearance, and growth rates were unchanged over population doubling levels (PDL) of 200. To further characterize the cell-lines, cells were treated with porcine corticotropin (23 mUámL )1 ), human angio- tensin II (50 n M ), dibutyryl cAMP (Bt 2 cAMP) (1 m M ), KCl 70 K. Mukai et al. (Eur. J. Biochem. 269) Ó FEBS 2002 (medium + 15 m M ), BAY K 6844 (1 l M ), A23187 (1 l M ), ionomycin (1 l M ), or 12-O-tetredecanoylphorbol 13 acetate (TPA; 160 n M ) for 24 h or 4 days under the standard culture media described above. These reagents were products of Sigma. During the treatments, the cells were cultured at 33 or 39 °C. Total RNA was extracted and analysed as described below. Northern blot analysis Total RNA was extracted with a modi®ed single-step isolation method using Trizol reagent (Life T echnologies). Northern blot analysis was performed as described previ- ously [47] except that probes were 32 P-labeled DNA. Before transfer to positively charged nylon membranes (Roche Diagnostics, Mannheim, Germany) rRNAs were visualized by ethidium bromide. Densitometric analysis of 28S rRNA bands veri®ed t hat amounts of RNA loaded were similar (<  10%) and that degradation of the RNA prepara- tions was undetectable under the experimental conditions. DNA fragments were labeled w ith [a- 32 P]dCTP (3000 Ciámmol )1 , Amersham-Pharmacia Biotech, P iscataway, NJ, USA) a nd High Prime (Roche Diagnostics) according to the manufacturer's instructions. H ybridization signals were dete cted with a Kodak BioMax ®lm with an intensi- fying screen. DNAs used for labeling each contained a fragment as follows: SV40 large T-antigen gene, 1.7-kb PvuII±EcoRI fragment of pMT-1ODtsA [48]; SF -1, AccI±EcoRI fragment corresponding to the 3¢ untransla- tedregionofamousecDNA[13];P450scc, a mouse cDNA fragment corresponding to the rat cDNA nucleotides 1 018±1361 [ 49]; P45011b, a mouse cDNA nucleotides 761±950 [8,47]; P450aldo, a mouse cDNA nucleotides 761±953 [8]. T he plasmids carrying SV40 large T -antigen gene and mouse SF-1 were generous gifts from H. Ariga (Hokkaido University) and K. L. Parker (University o f Texas South-Western Medical Center, TX, USA), respectively. cDNAs clones encoding P450scc, P45011b, and P450aldo were obtained by PCR with the primer pairs described below. Mouse adrenocortical Y-1 and ®broblast NIH3T3 cells were culture d with Dulbecco's modi®ed Eagle's medium containing penicillin (100 IUámL )1 ), streptomycin sulfate (100 lgámL )1 )and 10% heat-inactivated fetal bovine serum at 37 °C under a humidi®ed atmosphere containing 5% CO 2 . RT-PCR Expression of mRNA was a nalyzed with RT-PCR. cDNA was synthesized from total RNA (2 lg) with an oligo dT 18 primer and Moloney murine leukemia virus reverse transcriptase using a ® rst-strand cDNA synthesis kit (Amersham-Pharmacia Biotech) according to the manufac- turer's instructions. Aliquots (1 lL) of the reaction solution were used as template for PCR. PCR mixture contained 10 m M Tris/HCl, pH 8.3, 50 m M KCl, 1.5 m M MgCl 2 , 0.2 m M each deoxynucleotide triphosphate, 0.5 l M deoxy- oligonucleotide primers, and Taq DNA polymerase (1.25 U , Takara Shuzo, Shiga, Japan) in a total volume of 25 lL. Ampli®cation conditions were 45 s at 94 °C, 45 s at the annealing t emperature for each primer pair as described below, and 2 min at 72 °C f or 35 cycles or appropriate cycle numbers as indicated f ollowed by 7 min at 72 °C. The annealing temperatures for each primer pair were: 56 °Cfor P450scc, P45011b, P450aldo,and3bHSD ;69°Cfor P450c21;50 °CforStAR;54°C for glyceraldehyde 3-phos- phate dehydrogenase (GAPDH). PCR products (5 lL) were analyzed by agarose gel electorphoresis followed by visualization with ethidium bromide. Nucleotide sequences of primer pairs used for PCR were a s follows (numbers in parenthesis were nucleotide positions of the cDNA sequences): SCC-F, 5¢-G CACACAACTTGAAGGTACAGGAG-3¢ (1018±1041); SCC-R, 5¢-CAGCC AAAGCCCAAG TACC GGAAG-3¢ (1348±1361) [50]. m11b-F, 5 ¢-AAGAAAACTTAGAGTCCTGGGATT-3¢ (761±784); m11b-R, 5¢-GTGTCAGTGCTTCCAGCAAT GAGT-3¢ (927±950) [8]. mAldo-F, 5¢-AAGAACATTTCGATGCCTGGG ATG-3¢ (761±784); mAldo-R, 5¢-GTGTCAACGCTCC C AGCGGTGAGC-3¢ (930±953) [8]. mStAR-F, 5¢-AAGAGCTCAACTGGAGAGCAC-3¢ (170±190); mStAR-R, 5¢-TACTTAGCACTTCGTCCC CGT-3¢ (380±400) [51]. 3bHSD-F, 5¢-GC AGACCATCCTAGATGTCAAT CTG-3¢ (412±436); 3bHSD-R, 5¢-CAAGTGGCTCATAG CCCAGATCTC-3¢ (1160±1137) [50]. m21-F, 5¢-CTTCACGACTGTGTCCAGGACTTG-3¢ (553±576); m21-R, 5¢-CAGCAGAGTGAAGGCCTGCA GCAG-3¢ (1309±1332) [52]. GAPDH-F, 5¢-TGAAGGTCGGTGTGAACGGATT TGGC-3¢ (51±76); GAPDH-R, 5 ¢-CATGTAGGCCATGA GGTCCACCAC-3¢ (1010±1033) [53]. The forward and reverse primers reside in different exons of the genes. The PCR p roducts were digested with appropriate restriction enzymes to ensure the speci®city of the PCR reactions by comparing of sizes of digests with those expected f rom published DNA sequences. Total RNA from Y-1 cells was used as a positive c ontrol for detection of the mRNAs except that a drenal total RNA from C57BL/6 mice was used as a positive control for detection of P450c21 mRNA. To estimate relative amounts of mRNA among the cells cultured under d ifferent conditions (33 or 39 °Cinthe presence or absence of Bt 2 cAMP), intensities of PCR products stained with e thidium bromide (see below) were determined by densitometric analysis. All experiments for the determination were performed within t he exponential phase of the ampli®cation reactions to obtain the linear response concerning the i nitial RNA a mounts. Each experiment was performed at least twice to assure the reproducibility. The intensities were normalized with GAPDH cDNA, and the relative a mounts of mRNA were expressed in Table 1 as the values of the mRNA level in Y-1 cells or mouse adrenal glands were taken as 1.0. Analysis of steroids Cells (1±2 ´ 10 6 cells per 21-cm 2 dish) were cultured at 33 or 39 °C in the presence or absence of 1 m M Bt 2 cAMP for 4 days. Water-soluble cholesterol (20 l M ;Sigma)was added at 24 h before removal of the mediu m. Steroids in the medium (2 m L) were extracted with 8 mL of dichlo- romethane. The extracts were treated with 2 mL of 0.1 M NaOH and then washed with 2 mL of water. The resulting extracts were evaporated to dryness and redissolved with Ó FEBS 2002 Immortalized adrenocortical cell lines (Eur. J. Biochem. 269)71 50 lL of methan ol, and then 50 lL of water was added. An aliquot (25 lL) of each sample was subjected to HPLC using a C 18 column (4.6 mm ´ 150 mm; Cosmosil 5C18- AR, Nacalai Tesque, Kyoto, Japan). Steroids were sepa- rated by isocratic elution w ith 65% methanol in water a t 0.8 m Lámin )1 and detected at 254 nm. For detectio n of corticosterone, 55% methanol was used as the eluent. Authentic s teroid standards were used for identi®cation of steroid products by comparing elution times. To convert pregnenolone, which is hardly detectable at 254 nm, into progesterone, the steroid products were treated with 0.53 U of cholesterol oxidase (26.8 Uámg )1 ; Toyo Jozo Co., Ltd, Shizuoka, Japan) [54] in a reaction mixture of 100 lL consisting of 20 m M potassium phosphate buffer, pH 7.4, and 0.3% ( v/v) Tween 20. The reaction mixture was incubated at 37 °C f or 20 min, and extracted with dichlo- methane. The extracts were analyzed by HPLC un der the same conditions. RESULTS Histology of adrenal glands of transgenic mice carrying a temperature-sensitive oncogene Adrenal glands of the transgenic mice harboring SV40 large T-antigen tsA58 gene appeared quite normal in size and shape as compared with those of nontransgenic animals, suggesting that the ts oncogene developed no tumor in the adrenal g lands at body temperature. As judged by the haematoxylin/eosin staining, zonation of their cortices including the zonae glomerulosa, fasciculata, and reticularis were indistinguishable from those of the normal animals (data not shown). The medullary tissues also appeared to be normal. We then examined imminohistochemically expression of steroidogenic enzymes that occur in a zone-speci®c manner, namely, P450 11b and P450aldo.AsshowninFig.1, Table 1. Expression of genes involved in adrenocortical steroidogenesis in cell lines AcA101, AcA201, and AcE60. Based on the results from RT-PCR, relative levels of mRNA were normalized using the results of GAPDH mRNA as described in Materials and methods, and are expressed as the mRNA levels in Y-1 cells or mouse adrenal glands were taken as 1.0. Value 0 indicates that the level was < 0.01 of that of Y-1 cells or mouse adrenal glands. ND, not determined. Bt 2 cAMP presence or absence is indicated by + and ±, respectively. mRNA AcA101 AcA201 AcE60 33 °C39°C33°C39°C33°C39°C Adrenal ± + ± + ± + ± + ± + ± + Y-1 glands P450scc 0.04 0.12 0.04 0.30 0.25 0.42 0.71 1.1 0.01 0.06 0.02 0.09 1.0 ND StAR 0.11 0.55 0.35 1.7 0.16 1.25 0.85 1.5 0.33 0.65 0.31 1.9 1.0 ND 3bHSD 0 0 0 1.4 0 0 0 0.31 0.02 0.13 0.01 0.07 1.0 ND P450c21 0 0.18 0 0.34 0 0.06 0 0.12 0 0.14 0 0 ND 1.0 P45011b 0 0 0 1.4 0.10 0.15 0.62 1.85 0 0 0.16 0.19 1.0 ND P450aldo 0000000000001.0ND Fig. 1. Adrenocortical zonation of transgenic mice harboring a temperature-sensitive SV40 large T-antigen gene. Fresh-frozen sections (6 lm) from adrenal glands of the transgenic mice harboring a temperature-sensitive (ts) SV40 large T-antigen gene were analyzed immunohistochemically with an an tibody speci®c to cortico sterone-synth esizing 11b-hydroxylase cytochrome P450 (P45011b)(A)andwithanantibodytoaldosteronesynthase cytochrome P450 (P450aldo) (B) as described in Materials and methods. Localization of P45011b is shown with a brown color and that of P 450aldo is shown with a blue color. These i mmunohistochemical re sults obtained with the transgenic mice were indistinguishable from those with nontransgenic normal mice. Sizes, sh apes and cytology of the adrenal glands (including medulla) of t he transgenic mice also seemed to be normal. Note that the thickness (marked with a) where P45011b is absent is larger t han the thickness (marked with b) where signals of P450aldo are present, indicating that there is a cell-layer which neither has P45011b nor P450aldo. Bar  50 lm. 72 K. Mukai et al. (Eur. J. Biochem. 269) Ó FEBS 2002 P45011b was detected in the entire regions of the zonae fasculata-reticularis (Fig. 1A), while P450aldo was detected in the outermost cells of the zona glomerulosa (Fig. 1B). Such distribution was indistinguishable from that observed with nontransgenic animals (data not shown). Thus, the distribution of the t wo enzymes was not affected by introduction of SV40 large T-antigen gene tsA58.These observations suggest that the transgenic manipulation does not interfere with development of the adrenal zonation in the mice. As indicated in Fig. 1, the region of P45011b-negative cells (p arenthesis in Fig. 1A) was thicker than the region of P450aldo-positive cells (parenthesis in Fig. 1B). Evidently, there was a cell-layer where neither P45011b nor P450aldo were detectable, suggesting that the cells in this layer w ere unable to produce either corticosterone or aldosterone. It was also noted that P450aldo was only detectable in the outermost area of the zona glomerulosa under dietary conditions with normal Na contents. Together with our previous results [17], these results i ndicate that mice exhibit a functionally undifferentiated cell layer analogous to that observedinrats. Establishment of immortalized adrenocortical cell lines A number of cell lines were derived from primary cells prepared from whole adrenal glands of the t ransgenic mice. Thepermissivetemperature(33°C) for the T-antigen mutant was used t o establish cell lines in which t he oncoprotein was kept active. To select cell lines exhibiting properties of adrenocortical cells, RNAs from the cells were examined by RT-PCR analysis to detect SF-1 and P450scc mRNAs. The cell lines were further examined for detection of P45011b and P450aldo mRNAs, the functional markers for the zone-speci®c differentiation of t he cells. The results of RT-PCR analyses indicated that the cell lines were categorized into t hree different groups. The ®rst group constituted cell lines expressing SF-1, P450scc,andP45011b mRNAs but not P450aldo mRNA. These cell lines had the property of the zona fasciculata cells. The second group was composed of a small number of the cell lines that expressed SF-1 and P450scc mRNAs but not P45011b or P450aldo mRNAs, showing the gene expression pattern observed in the undifferentiated cell layer. The last cell lines were those that expressed none of the SF-1, P450scc, P45011b,and P450aldo mRNAs and were characterized by their ®bro- blast-like appearance. There were no cell lines that expressed P450aldo mRNA regardless of expression of SF-1, P450scc, or P45011b mR NAs . Among these cell lines, AcA101, AcA20 1, and AcE60 were chosen for further detailed c haracterization. When cultured at 33 °C, AcA201 was one of cell lines that displayed mRNAs for SF-1, P450scc,andP45011b but not P450aldo mRNA. On the other hand, AcA101 and AcE60 were two different cell lines that displayed e xpression of SF-1 and P450scc mRNAs but not P45011b and P450aldo mRNAs at 33 °C; the latter two exhibited d istinct expres- sion patterns of steroidogenic genes t hat were different to each other (see below). Their phenotypes and growth rates of the t hree cell lines were unchanged over a PDL of 200 at 33 °C. Morphologies of these cells cultured at 33 °Care shown in Fig. 2. AcA101 and AcA201 cells displayed retracted appearances. AcE60 cells showed a larger a nd ¯atter appearance and were less retracted than AcA101 and AcA201 cells. The doubling time of these cells was 24±30 h at 33 °C. Fig. 2. Morphology of adrenocortical cell-lines. Phase contrast Photomicrographs depict morphologies of adrenocortical cell-lines AcA101 (A), AcA201 (B), and AcE60 (C) wh ich were cultured under the permissive temperature (33 °C) for the ts SV40 large T-antigen. The cells were cultured at subcon¯uent stages under the conditions as describedinMaterialsandmethods.Bar 50 lm. Ó FEBS 2002 Immortalized adrenocortical cell lines (Eur. J. Biochem. 269)73 Growth of AcA101, AcA201, and AcE60 cells under a nonpermissive temperature for the T-antigen (39 °C) w as examined upon shifting the temperature from 33 to 39 °C. Their rates of growth were re duced within 2 days a fter the start of the temperature shift. At one week, AcA101 and AcA201 cells were mostly detached from the culture dish surface, and completely lost adhesivity until 4 weeks. In contrast, AcE60 cells were able to attach onto the dishes even after t he disappearance of cell division (data not shown). The t hree cell lines cultured at 33 °C were characterized by Northern blot analysis. As shown in Fig. 3A, Northern blotting for SV40 T-antigen mRNA indicated that AcA101 (lane 1), AcA201 (lane 2), and AcE60 (lane 3) cells expressed the transgene mRNA with different signal intensities. As expected, Y-1 adrenocortical cells (lane 4) and ®broblast NIH3T3 cells (lane 5) gave no hybridization signal. SF -1 mRNA (Fig. 3B) was detectable in the established cell lines (lanes 1±3). The electrophoretic mobility of the hybridiza- tion signal was the same as that of Y-1 cells (lane 4). Signal intensities of P450scc mRNA varied markedly among the three cell lines (Fig. 3C). T he P450scc mRNA level in AcA201 cells was evident, while only a faint signal was detectable in AcA101 cells. P450scc mRNA in AcE60 cells was undetectable under the current experimental conditions. As shown i n Fig. 3B,C, Y-1 cells (lanes 4) produced hybridization signals of SF-1 and P450scc mRNA, whereas NIH3T3 cells (lanes 5) did not, indicating that the hybrid- ization was speci®c. As seen in Fig. 3D, electrophoretic patterns of ribosomal RNAs indicated t hat amounts of total RNA s ubjected to the Northern analyses were equivalent and its degradation was undetectab le. Although attempting to detect P45011b and P450aldo mRNAs using the same RNA blot, we could not detect these mRNAs u nder the current experimental conditions (data not shown). Figure 4 shows the results from RT-PCR analysis with greater sensitivity for the detection of P450scc, P45011b, and P450aldo mRNAs in the three cell lines cultured at 33 °C. In addition to AcA101 (Fig. 4A, lane 1) and AcA201 (lane 2), AcE60 cells (lane 3) exhibited a detectable level of P450scc mRNA. Differences in intensities of t he ampli®ed DNA fragments among the three were consistent with the results from Northern blotting (Fig. 3C). On the other hand, P45011b mRNA (Fig. 4B) was detectable in AcA201 cells (lane 2), but not in AcA101 (lane 1) or in AcE60 (lane 3) cells. P450aldo mRNA (Fig. 4C) was not detectable in the three cell lines (lanes 1±3), although it was detected in Y- 1 cells (lane 4). Digestion of the ampli®ed DNA fragments with restriction enzymes veri®ed s peci®city o f P CR (right panels of Fig. 4A±C). As judged from the results for GAPDH mRNA, the ef®ciency o f RT-PCR was compara- ble among the cell lines (Fig. 4D). These results suggest that, under conditions wh ere the T-antigen is active, AcA201 cells have the p roperty of the zona fascicu lata cells, while AcA101 and AcE60 cells do not display the zone-speci®c markers of steroidogenesis. Cyclic AMP-dependent alterations in steroidogenic gene expression upon inactivation of the T-antigen To examine effects of inactivation of the T-antigen o n expression of the genes for steroidogenesis, we cultured AcA101, AcA201, and AcE60 cells at 39 °C for up to 4 d ays and analyzed levels of mRNAs for P450scc, StAR, 3bHSD, P450c21, P45011b,andP450aldo by RT-PCR. At the same time, the cells were cultured in the presence of regulators of the steroidogenic gene expression such as Bt 2 cAMP, ACTH, or angiotensin II, in combination with the temper- ature shift. As described below, a simple s hift of temperature for 4 days affected the mRNA levels of some of these steroidogenic genes. Treatments with either corticotropin or angiotgensin II did not alter the mRNA levels signi®cantly at both 33 and 39 °C under the current experimental conditions (data not shown). On the other hand, treatment with Bt 2 cAMP for 4 days turned out to alter the mRNA Fig. 3. Northern analysis for expression of SV40 large T-antigen, steroidogenic factor-1 (SF-1, or Ad4BP), cholesterol side-chain cleavage cytochrome P450 (P450scc, or Cyp11a) in cell lines AcA101, AcA201, and AcE60 at a permissive temperature for the ts T-antigen. Total RNA was prepared from AcA101, AcA201, and AcE60 cells which were cultured at 33 °C with standard media as described in Materials and methods. RNA from mouse adrenoco rtical Y-1 and ®broblast NIH3T3 cells, neither of which express the T-antigen gene, were used as positive and negative controls, respectively, for detection of adrenoco rtic al cell marker mRNAs. Total RNA (10 lgperlane)was analyzed by Northern blotting with 32 P-labeled cDNA probes enco- ding (A) SV40 T-antigen (B) SF-1 and (C) P450scc genes as described in Materials a nd me thods. Riboso mal R NAs (D) v isualized by ethi- dium bromide show that amounts of total RNAs were comparable to each other and that d egradatio n of RNA were undetectable under the experimental conditions. 74 K. Mukai et al. (Eur. J. Biochem. 269) Ó FEBS 2002 levels at both temperatures as described below. These results were summa rized in T able 1. P450scc and StAR genes Figure 5 A shows effects of a temperat ure s hift in the presence or absence of Bt 2 cAMP on P450scc mRNA levels in AcA101, AcA201, and AcE60 cells. P450scc mRNA levels upon a simple shift to 39 °C were almost unchanged in AcA101 (lanes 1 and 3) and AcE60 (lanes 11 and 13) cells, while in AcA201 ce lls (lanes 6 and 8), mRNA levels increased signi®cantly. Responsiveness of AcA101 (lanes 2 and 4) and AcE60 (lanes 12 and 14) cells to Bt 2 cAMP was evident at both 33 and 39 °C, while in AcA201 cells (lanes 7 and 9) responsiveness was much less. Synergistic effects of a temperature shift and Bt 2 cAMP were also shown in these cell lines (lanes 4, 9, and 14). We next examined the ability of AcA101, AcA201 and AcE60 cells to express StAR mRNA, a key factor for the acute induction of adrenocortical steroidogenesis (Fig. 5B). In the a bsence of the c AMP a nalog at 33 °C, the mRNA levels were detectable but with only faint bands in the three Fig. 4. RT-PCR analysis for expression of P450scc, P45011b,andP450aldo genes in the cell lines AcA101, AcA201, and AcE60 cells cultured at 33 °C. cDN A was synthesized with oligo dT primer u sing total RNA (2 lg) from AcA101 (lanes 1 and 5), A cA20 1 (lanes 2 and 6), Ac E6 0 (lanes 3 and 7), or Y-1 (lanes 4 and 8) cells, and the resulting cDNAs were amp li®ed by PCR using speci®c primer pairs for (A) P450scc,(B)P45011b,(C) P450aldo an d (D) glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as described i n Materials and methods. C ycle numbers in PCR w ere 35 in (A), (B), and (C), and 25 in (D). Left, PCR products (5 lL) were analyzed through 1% agarose ge ls. Right, P CR products (5 lLexceptforlane7of panel A where 10 lL was used) were digested with BstXI (A,B) and with SacI (C). The digests were separated on 8% polyacrylamide gels. DNA fragments were visualized by ethidium bromide. Size marker (lanes M) is HaeIII-digested /X1 74 DNA. Numbers with arrowhea ds indicate sizes o f PCR products or their digests. ns (C) ind icates a nonspeci®c band. Amplifying conditions except for lanes 2 and 4 o f (A) were within the exponential phase of the reactions to obtain the linear dose±response concerning the initial RNA amounts. Ó FEBS 2002 Immortalized adrenocortical cell lines (Eur. J. Biochem. 269)75 cell lines ( lanes 1, 6, and 11). When AcA101 a nd AcA201 cells were cultured either in the presence of Bt 2 cAMP (lanes 2 and 7) or at 39 °C (lanes 3 and 8), the mRNA levels were increased markedly. In contrast, AcE60 cells displayed only a small induction of the mRNA level in the presence of Bt 2 cAMP (lane 12), while showing no notable change upon a temperature shift (lane 13). Interestingly, however, AcE60 cells exhibited the greatest synergy between the temperature shift an d Bt 2 cAMP among the three cell lines tested (lanes 4, 9, and 14). On t he other hand, the r esults obtained w ith GAPDH primers showed similar intensities of the PCR products among the groups, indicating that ef®ciencies of reverse transcription and PCR were comparable to one another (Fig. 5C). These results indicated that P450scc and StAR genes responsible for the initial steps for synthesis of both adrenocortical and sex steroid hormones were expressed c onstitutively and inducible through a cAMP- dependent pathway in the established cell lines. 3 b HSD and P450c21 genes 3bHSD and P450c21 catalyze the reactions in the middle of the synthetic pathways for both corticosterone and aldos- terone. Figure 6A shows mRNA levels of 3bHSD in the same sets of RNA preparations used for analysis of P450scc and StAR mRNA levels in Fig. 5. 3bHSD mR NA in AcA101 cells was detected only in the presence of Bt 2 cAMP at 39 °C (lanes 1±4). AcA201 cells also expressed 3bHSD mRNA in a similar manner to that seen in AcA101 cells, although the level after the treatment was lower (lanes 6±9). Thus, synergies of inactivation of the T-antigen and treatment with the cAMP analog were evident in the induction o f 3bHSD mRNA in AcA101 and AcA201 cells. The mRNA level in AcE60 cells in the absence of Bt 2 cAMP at 33 °C was hardly detected (lane 11), while treatment with the cAMP a nalog at 33 °C induced the mRNA l evel (lane 12). A t emperature shift to 39 °C did not enhance the 3bHSD mRNA level (lane 13), and the induction by the cAMP analog at 39 °C was smaller than that observed at 33 °C (lane 14). It should be noted that, although being expressed in adrenal cortex and gonads (as are the P450scc and StAR genes), the 3bHSD gene of these cell lines is expressed in a manner (Fig. 6A) distinct f rom those of P450scc and StAR gene expression (Fig. 5 A,B). Figure 6B illustrates differences in P450c21 mRNA levels among the c ell lines. The mRNA level i n AcA101 cells in the absence of B t 2 cAMP was undetectable at 33 °C(lane1), whereas t reatment with the cAMP analog induced a weak signal at 33 °C (lane 2). A simple shift to 39 °C did not induce the mRNA (lane 3), but the same p rocedure in the presence of Bt 2 cAMP increased the level signi®cantly (lane 4). The results obtained with AcA201 cells (lanes 6±9) were similar to those obtained with AcA101 cells except that the induction in AcA201 was weak. In AcE60 cells, P450c21 mRNA was detectable upon treatment with B t 2 cAMP at 33 °C (lanes 11 and 12). At 39 °C, P450c21 mRNA became undetectable irrespective of the presence of Bt 2 cAMP (lanes 13 and 14). Thus, AcA101, AcA201 and AcE60 cells were Fig. 5. Expression of P450scc and steroidogenic acute regulatory p rotein (StAR) genes in AcA101, AcA201, and AcE60 cells upon a temperature shift and/or treatment w ith dibutyryl cAMP (Bt 2 cAMP). AcA101, AcA201, and AcE60 cells were plated at 33 °C,andallowedtoattachtodishesfor 24 h, and were further cultured at 33 or 39 °C for 4 days in the absence or presence of 1 m M Bt 2 cAMP. Total RNA was prepared from the cells and was subjected to RT-PCR analysis using the primer pairs for (A) P450scc ,(B)StAR and ( C) GAPDH as described in Materials an d methods. RNA preparation from Y-1 ce lls were used a s positive controls for P450scc and StAR mRNA. P CR products (5 lL) were analyzed through 2 % agarose gels followed by visualizatio n with ethidium brom ide. Cycle numbers in PCR for P450scc (A) were 32 in AcA101, 28 in AcA201, and 35 in AcE60 cells, and those in PCR for StAR (B) and GAPDH (C) were 35 and 25, respectively, for the three cell line s. 76 K. Mukai et al. (Eur. J. Biochem. 269) Ó FEBS 2002 able to express the P450c21 gene, the marker expressed exclusively in the entire regions of adrenal cortices but not in gonads, indicating that the cell lines retain a f eature of adrenocortical cells. P45011 b and P450aldo genes Figure 7 shows the levels of P45011b mRNA in the absence or presence of Bt 2 cAMP at 33 and 39 °C. AcA101 cells did not have a detectable level of P45011b mRN A in the absence of the cAMP a nalog at 33 °C (Fig. 7, lane 1; Fig. 4B, lane 1). Either treatment with the cAMP an alog (Fig. 7, lane 2) or a temperature shift (lane 3) did not induce the mRNA. Upon the combined treatment with the cAMP analog and a temperature shift, however, the cells expressed the P45011b gene (lane 4). A similar synergistic effect in AcA101 cells was observed on the levels of 3bHS D mRNA (Fig. 6A). The P45011b mRNA level in AcA201 cells at 33 °Cwas detectable in the absence of Bt 2 cAMP (Fig. 7, lane 6; Fig. 4B, lane 2), and was not increased by the Bt 2 cAMP treatment at 33 °C ( lane 7 of Fig. 7 ). A simple shift to 39 °C enhanced the mRNA level (lane 8), and the additive effects of the cAMP analog appeared to be small, if any (lane 9). AcE60 cells did not exhibit a detectable level of P45011b mRNA either in the absence (lane 11) or presence (lane 12) of Bt 2 cAMP at 33 °C. Interestingly, AcE60 cells showed the ability to induce the mRNA level upon the temperature shift to 39 °C ( lane 13), although the level after the Bt 2 cAMP treatment remained almost unchanged at 39 °C(lane14). These results indicated that the three cell lines are able to express P45011b gene, which is a determinant for synthesis of corticosterone in the zona fasciculata cells. Moreover, these three cell lines responded to distinct stimulatory conditions to express the P45011b gene. As mentioned earlier in this article, P450aldo mRNA was undetectable in AcA101, AcA201, and AcE60 cells at 33 °C cultured in the absence of Bt 2 cAMP at 33 °C. In addition, a temperature shift and/or treatment with Bt 2 cAMP failed to Fig. 6. Expression of 3b-hydroxysteroid dehydrogenase (3bHSD) and 21-hydroxylase P450 (P450c21) upon a temperature shift and/or treatment with Bt 2 cAMP. PCR w as performed with primer pairs for (A) 3bHSD an d ( B) P450c21 using the cDNAs synthesized in the experiments in Fig. 5. Y-1 cells and mouse adrenal glands we re used as positive controls for de tection of 3bHSD and P450c21 mRNA, respectively. PCR products (5 lL) were analyzed through 1% agarose gels followed by visua lization with ethidium brom ide. Cycle numbers in PCR for 3bHSD and P450c21 were 35 for the three cell lines. Fig. 7. Expression of P45011b gene upon a temperature shift and/or treatment with Bt 2 cAMP. PCR w as perfo rmed w ith th e primer pair for P45011b using the cDNAs synthesized in the experiments in Fig. 5. Y-1 cells were used as a positive control for detection of P45011b mRNA. PCR products (5 lL) were analyzed through 2% gels followed by visualization with ethidium bromide. C ycle numbers in PCR w ere 35 for the three cell lines. Ó FEBS 2002 Immortalized adrenocortical cell lines (Eur. J. Biochem. 269)77 induce P450aldo mRNA (data not shown). Furthermore, to induce expression of the P450aldo gene, these cells were cultured in the presence of either of angiotensin II, KCl, or reagents that could change i ntracellular concentration o f calcium ion at 33 or 39 °C (see Materials and methods). These stimuli, however, could not induce detectable levels of P450aldo mRNA in the cell lines under current experimen- tal conditions (data not shown). Steroidogenesis of the cell lines The ability of the cell lines to produce steroids w as examined by using reversed phase HPLC. As s hown in Fig. 8A±D, when AcA101 cells were cultured in the presence o f Bt 2 cAMP for 4 days at 39 °C, progesterone and a small amount of deoxycorticosterone were detected, while corti- costerone was undetectable. On the other hand, AcA201 cells synthesized only a detectable amount of progesterone when the cells were stimulated with Bt 2 cAMP at 39 °C (Fig. 8 E). AcE60 cells secreted progesterone in the presence of Bt 2 cAMP at both 33 and 39 °C (data not shown). Thus, the three cell lines showed responsiveness of their steroido- genesis to activation of protein kinase A. Although pregn- enolone is a possible intermediate o f the steroidogenesis, it i s hardly undetectable in the eluate of HPLC by monitoring at 254 n m. To examine amounts of pregnenolone in the culture medium of the three cell lines, the dic hloromethane extracts were treated w ith cholesterol oxidase for conversion into progesterone. After treatment, a remarkable peak of progesterone was detected in the culture medium of AcA201 (Fig. 8 F), suggesting that AcA201 cells secrete d large amounts of p regnenolone. Similarly, AcA101 and AcE60 cells synthesized signi®cant amounts of pregnenolone when they were cultured in the presence of Bt 2 cAMP at 39 °C (data not shown). These results were consistent with the results from RT-PCR a nalysis of mRNA levels of t he steroidogenic genes (Figs 5±7). DISCUSSION Previous studies on regulatory mechanisms of adrenocor- tical s teroidogenesis have often utilized mouse Y-1 [55] and human NCI-H295 [56] cells. Y-1 cells have been known to display expression patterns of steroidogenic genes a nalo- gous to those of the zona fasciculata cells except that the endogenous P450c21 gene is not expressed, and that the P450aldo gene is constitutively expressed though its mRNA level is one-tenth of that of P45011b mRNA [8]. On the other hand, NCI-H295 cells have been reported to exhibit the phenotypes of both zona glomerulosa and fasciculata cells simultaneously. Although these cell lines have been showntobeusefulin vitro cell c ulture s ystems, the phenotypes of Y1 and NCI-H295 cells do not precisely correspond to either of the glomerulosa or fasciculata cells. Other adrenocortical cell lines were also established by using the wild-type SV40 T-antigen gene [57,58]. When compared with the cell lines established previously, ou r cell lines described in the present study have several d istinct features suitable for studies on differentiation of adreno- cortical cells and regulation of the steroidogenic genes. First, immortalization is c onditional so that activity o f the oncogene can be removed. Secondly, multiple cell lines with the identical genetic background exhibit different pheno- types in steroidogenic gene expression from one ano ther. Finally, and most importantly, established AcA101 and AcE60 cell lines have the a bility to convert from an undifferentiated stage into the differentiated one analogous to zona fasciculata-like cells. Because the ts T-antigen transgene did not affect cytogenesis and zonal differentiation of the adrenocortical cells of the mice, the adrenocortical cells in vivo were lik ely to be in a normal pathway of their differentiation. It is unknown whether the ts T-antigen is active in the adrenals in vivo. However, we have previously noted that amounts of the ts T-antigen protein in other cells, which were obtained by transfection, were decreased markedly at 37 °Cwhen compared with amounts of wild-type T-antigen at 37 °C. It is presumable that levels of the ts T-antigen protein are very low at body temperature. At 33 °C, on the other hand, the capability of the established cell lines to grow over PDL 200, appeared to be a result of T -antigen activation. Being consistent with the v iew, inactivation of the T-antigen by culturing at the nonpermissive temperature reduced their growth rates. Thus, the cell lines established under the permissive conditions for the T-antigen could be returned to Fig. 8. Analysis of steroid production. Cells were cultured at 33 or 39 °C in the absence or presence of 1 m M Bt 2 cAMP for 4 days. A water-soluble form of cholesterol (20 l M ) was added at 24 h before removal of the medium. Dichloromethane extracts of the incubated medium were prepared and were analyzed by r eversed phase HPLC as described in Materials and methods. AcA101 cells were cultured at 33 °C in the absence (A) or presence (B) of Bt 2 cAMP and at 39 °Cin the absence (C) or pre sence (D) of Bt 2 cAMP. Dichloromethane extract of the medium of A cA201 cells, which were incubated at 39 °Cfor 4 days in the presence of 1 m M Bt 2 cAMP (E), was treated with cho- lesterol oxidase to convert pregneno lone into pro gesterone (F), and was a nalyzed by H PLC. Peaks o ther than tho se corresponding to deoxycorticosterone and progesterone are unidenti®ed compounds which are also extracted from medium without incubation of the cells. D, deoxycorticosterone. P, progesterone. 78 K. Mukai et al. (Eur. J. Biochem. 269) Ó FEBS 2002 [...]... showed inducible expression of 3bHSD and P450c21 genes indicate that the cell lines have the property of adrenocortical cells Especially, expression of the endogenous P450c21 gene in the established cell lines contrasts strikingly with the characteristics of Y- 1 and other mouse adrenocortical cell lines [58] Based on the results from analysis for expression of the zonal markers in the established cell lines, ... the fasciculata-like cells, they may be referred to as precursor cell lines for the zona fasciculata cells The available evidence does not support the hypothesis that these cell lines represent bipotential progenitor cell lines or stem cell- like lines Further studies are obviously necessary to examine whether AcA101 and AcE60 cells are able to differentiate into cells with the property of the zona... & Ishimura, Y (1993) Isolation and characterization of rat CYP11B genes involved in late steps of mineralo- and glucocorticoid syntheses J Biol Chem 268, 9130± 9137 10 Rainey, W.E (1999) Adrenal zonation: clues from 11b-hydroxylase and aldosterone synthase Mol Cell Endocrinol 151, 151±160 11 Waterman, M.R (1994) Biochemical diversity of cAMP-dependent transcription of steroid hydroxylase genes in the... lines, AcA201 cells displayed the feature of the zona fasciculata cells at 33 °C, while AcE60 and AcA101 cells were at undifferentiated stages that have a similar pattern of gene expression to the undifferentiated cell layer Furthermore, differences in induction of P45011b gene between AcE60 and AcA101 were demonstrated and were more evident than the differences in the other steroidogenic genes; the P45011b... derived from cells in the functionally undifferentiated cell layer Nevertheless, several lines of experimental evidence conceivably support a notion that AcE60 and AcA101 cells were derived from the undifferentiated cell layer Although a number of cell lines were obtained in the present study, there was no cell line expressing the P450aldo gene During initial passages, however, we found that the cells from... F., Mukai, K., Suematsu, M & Ishimura, Y (2000) Daily regeneration of rat adrenocortical cells: circadian and zonal variations in cytogenesis Endocrinol Res 26, 899±904 34 Morley, S.D., Viard, I., Chung, B.C., Ikeda, Y. , Parker, K.L & Mullins, J.J (1996) Variegated expression of a mouse steroid 21-hydroxylase/b-galactosidase transgene suggests centripetal migration of adrenocortical cells Mol Endocrinol... enucleation at the boundary between the zona glomerulosa and zona fasciculata (F Mitani, unpublished observation) In the early days after enucleation, it was demonstrated that the cells of the capsular portion dedifferentiate into those devoid of both P450aldo and P45011b, proliferate, and then differentiate into morphologically and functionally distinct cells, i.e the glomerulosa cells and fasciculata cells... FEBS 2002 Immortalized adrenocortical cell lines (Eur J Biochem 269) 79 the normal pathway of their differentiation after a temperature shift The three cell lines characterized in the present study retained a common phenotype of steroidogenic cells, i.e expression of SF-1, P450scc, and StAR genes These genes are known to be expressed throughout adrenal cortices as well as in the steroidogenic cells in... AcA101 cells were likely to produce small amounts of deoxycorticosterone The ability to produce the steroids together with enhancement of the synthesis by treatment with a cAMP analog were consistent with the expression levels of mRNA molecules of the steroidogenic genes, which were regulated through the protein kinase A pathway Accumulation of pregnenolone and low levels of progesterone, deoxycorticosterone,... and histochemistry J Anat 88, 437±454 24 Deane, H.W & Greep, R.O (1946) A morphological and histochemical study of the rat's adrenal cortex after hypophysectomy, with comments on the liver Am J Anat 79, 117±145 25 Hall, K & Korenchevsky, V (1937) Histological changes produced by castration and by sex hormones in the adrenals of normal and of castrated male rats Nature 140, 318 26 Hartroft, P.M & Eisenstein, . Conditionally immortalized adrenocortical cell lines at undifferentiated states exhibit inducible expression of glucocorticoid-synthesizing genes Kuniaki Mukai 1 , Hideko. i ndicate that mice exhibit a functionally undifferentiated cell layer analogous to that observedinrats. Establishment of immortalized adrenocortical cell lines A number of cell lines were derived. showed inducible expression of 3bHSD and P450c21 genes indicate that the cell lines have the property of adrenocortical cells. Especially, expression of the e ndogenous P450c21 gene in the established cell lines