Purification, characterization and biosynthesis of parabutoxin 3, a component of Parabuthus transvaalicus venom Isabelle Huys 1 , Karin Dyason 2 , Etienne Waelkens 3 , Fons Verdonck 4 , Johann van Zyl 5 , Johan du Plessis 2 , Gert J. Mu¨ ller 5 , Jurg van der Walt 2 , Elke Clynen 6 , Liliane Schoofs 6 and Jan Tytgat 1 1 Laboratory of Toxicology, University of Leuven, Leuven, Belgium; 2 Department of Physiology, University of Potchefstroom, Potchefstroom, South Africa; 3 Laboratory of Biochemistry, University of Leuven, Leuven, Belgium; 4 Interdisciplinary Research Centre, University of Leuven Campus Kortrijk, Kortrijk, Belgium; 5 Department of Pharmacology, University of Stellenbosch, Tygerberg, South Africa; 6 Laboratory for Developmental Physiology and Molecular Biology, University of Leuven, Belgium A novel peptidyl inhibitor of voltage-gated K + channels, named p arabutoxin 3 (PBTx3), has been purified to homo- geneity from the venom of Parabuthus transvaalicus. This scorpion toxin contains 37 residues, has a mass of 4274 Da and displays 41% identity with charybdotoxin (ChTx, also called Ôa-KTx1.1Õ). PBTx3 is the tenth member (called Ôa-KTx1.10Õ)ofsubfamily1ofK + channel-blocking pep- tides known thus far. Electrophysiological experiments using Xenopus laevis oocytes indicate that PBTx3 is an inhibitor of Kv1 c hannels (Kv1.1, Kv1.2, Kv1.3), but has no detectable effects on Kir-type and ERG-type channels. The dissoci- ation constants ( K d ) for Kv1.1, Kv1.2 and Kv1.3 channels are, respectively, 79 l M ,547n M and 492 n M . A synthetic gene encoding a PBTx3 homologue was designed and expressed a s a fusion protein with the maltose-binding pro- tein ( MBP) in Escherichia coli. T he recombinant p rotein was purified from the b acterial p eriplasm compartment using an amylose affinity resin column, followed by a gel filtration purification step and cleavage by factor X a (fX a ) to release the recombinant toxin peptide (rPBTx3). After final purifi- cation and refolding, rPBTx3 was shown to be identical to the native P BTx3 with respect to HPLC retention time, mass spectrometric analysis and functional properties. The three- dimensional structure of PBTx3 is proposed by homology modelling to contain a double -stranded antiparallel b sheet and a single a-helix, connected by three disulfide bridges. The scaffold of PBTx3 i s homologous to most other a-KTx scorpion toxins. Keywords: Parabuthus; purification; synthesis; scorpion; toxin. The southern African scorpion Parabuthus tr ansvaalicus Purcell, 1 899, is one of the largest scorpions belonging t o t he Buthidae family [1], subphylum C helicerata, order S cor- pionis. Severe envenomation with P. transvaalicus causes primarily neuromuscular effects with involvement of the heart and parasympathetic nervous system [2], illustrating that this scorpion can be potentially lethal, especially for children. P. g ranulatus scorpionism has been described by Mu ¨ ller [3]. P. transvaalicus scorpionism is clinically similar, but appear s to p roduce s lightly more m otor and fewer sensory symptoms [4]. Crude, diluted venom of P. t rans- vaalicus was already tested on isolated cardiomyocytes and induced an increase in the sodium current an d a retardation of the time c ourse of inactivation, implicating t he presence of an a-toxin [5]. Verdonck et al. [6] reported the occurrence of pore-forming activity in the venom of P. transvaalicus, but th e variability was rather high and i n s ome s pecimens this activity was absent . A study was undertaken to find compounds or toxins in the venom of P. transvaa licus that modulate physiological processes a t the cellular level; t his w as done for the following reasons: (a) very little is known about the bioactive substances present in the venom of this scorpion [7,8]; (b) the discovery of new toxins can be the key to gain insight into the molecular mechanisms of scorpionism; (c) selective toxins can be u sed f or purifying channels from native tissue, determining their subunit composition [9] and for e lucida- ting the pharmacology and physiological roles of voltage- dependent Na + ,Ca 2+ and K + channels [10–12] i n target tissues. Voltage-dependent K + channels in particular serve important functions in many signal-transduction pathways in the nervous system: they are involved in neuron excitability; they influence the resting membrane potential, the waveforms and frequencies of action potentials; and they determine the thresholds of excitation [13]. Moreover, they are the putative target sites in t he design of therapeutic drugs [14]. In our work, a new short-chain toxin acting on Kv1 channels, called p arabutoxin 3 (PBTx3), has been purified to homogeneity from the venom of P. transvaalicus and its specific function on different channels has been analysed electrophysiologically. Using a recombinant expression system, t he toxin was produced in high quantity to confirm our data and to facilitate t he screening of the active peptide Correspondence to J. Tytgat, Laboratory o f Toxicology, University of Leuven, E. Van Evenstraat 4, 3000 Leuv en, Belgium. Fax: + 32 16 3 2 34 05, Tel.: + 32 16 32 34 03, E-mail: Jan.Tytgat@farm.kuleuven.ac.be Abbreviations: PBTx3, toxin from th e venom of th e scorpion Parabuthus transvaalicus;AgTx2,toxinfromthevenom of the scorpion Leiurus quinquestriatus var. Hebraeus; MBP, maltose-binding protein; fXa, factor Xa. Note: a website is available at http://www.toxicology.be (Received 3 1 December 2001, accepted 12 February 2002) Eur. J. Biochem. 269, 1854–1865 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02833.x PBTx3. In this way, a study of the structure–function relationship of PBTx3 to different ion channels and receptors could be performed and a structural model for this novel toxin has been proposed. MATERIALS AND METHODS Venom collection and purification P. transvaalicus scorpions were captured in South Africa. Venoms were c ollected by electrical s timulation and lyophi- lized after dilution in a saline buffer or distilled w ater. The lyophilized venom was dissolved in 100 m M ammonium acetate, pH 7 (Merck, Germany). After vortexing, the sample was clarified by centrifugation at 12 000 g for 15 min and its supernatant was submitted t o gel filtr ation (Fig. 1 A) using a Superdex 30 prep grade HiLoad 16/60 FPLC column (Pharmacia LKB Biotech, Sweden) equili- brated with 100 m M ammonium acetate, pH 7. The mate- rial was eluted w ith t he same buffer at a flow r ate of 0.2 m LÆmin )1 . A bsorbance of the eluate was monitored at 280 nm and 4-mL fractions were collected automatically. The fraction c ontaining the toxin was recovered, lyophilized andappliedonaPepRPCHR5/5C 2 /C 18 reversed-phase FPLC column (Pharmacia, Sweden) equilibrated w ith 0 .1% trifluoroacetic acid (TFA, Merck Eurolab, Belgium) in distilled w ater (Fig. 1B). Separation w as perform ed by u sing a linear gradient o f 0–50% UV-grade acetonitrile (LiChro- SolvÒ gradient grade, Merck Eurolab), supplemented w ith 0.1% TFA, for 30 min. The flow rate was 0.5 mLÆmin )1 and the absorbance was measured at 214 nm. Fractions between 17 and 23 min with potential short-chain toxins were r ecovered, dried (Speed Vac Ò Plus, S avant, U SA), and applied t o a monomeric 238TP54 C 18 reversed-phase HPL C column (Vydac, USA) equilibrated with 0 .1% trifluoroacetic acid in distilled w ater (Fig. 1C). Separation was performed as follows: after 4 min a linear gradient to 30% acetonitrile, for 2 min, followed by a linear gradient to 42% for the final 8 m in (total run, 14 min). The flow rate was 0.75 mLÆmin )1 and the absorbance was measured simultaneously at 214, 254 and 280 nm. The toxin-containing fraction (see Fig. 1C) was recovered and dried (Speed Vac Ò Plus). Sequence determination The first 3 6 residues of the primary s tructure of the peptide were resolved by direct sequencing (Edman degradation) (Fig. 2A). A glass fibre disk was coated with Biobrene (Applied Biosystems) and p recycled for four cycles. Subse- quently, the sample (18 pmol) was loaded onto the glass fibre disk and subjected to N-terminal amino-acid sequenc- ing o n a Perkin Elmer/Applied Biosystems Procise 492 microsequencer (PE Biosystems) running in pulsed liquid mode. T o identify the las t C-terminal residue, a sample of peptide was also cleaved by cyanogen bromide. By this reaction, three fragments were produced (E 1 –M 4 ,R 5 –M 28 and N 29 –R 37 ), separated by HPLC by using the s ame C 18 analytical column as described above, and then sequenced. The last amino acid (arginine) was elucidated. Construction of the recombinant genes A cDNA fragment encoding a 36 amino-acid peptide, corresponding to PBTx3 without the C-terminal arginine, was designed as follows (Fig. 3A). Two overlapping oligonucleotide pairs 5¢-GAGGTCGACATGCGCTGCA AGTCGTCGAAGGAGTGCCTGGTCAAGTGCAAG CAG-3¢,3¢-CTCCAGCTGTACGCGACGTTCAGCAG CTTCCTCACGGACCAGTTCACGTTCGTCCGCTG CCCGGCC-5¢,and5¢-GCGACGGGCCGGCCGAACG GCAAGTGCATGAACCGGAAGTGCAAGTGCTAC CCGTGAG-3¢,3¢-GGCTTGCCGTTCACGTACTTGGC CTTCACGTTCACGATGGGCACTCCTAG-5¢,respect- ively, ranging in length from 49 to 66 base p airs, were synthesized chemically on an Applied Biosystem d evice (Amersham Pharmacia Biotech, The Netherlands), purified by PAGE and phosphorylated at the 5¢ end. The c omple- mentary oligomers (100 pmol of each) were annealed to generate two duplexes that were ligated using T4 DNA ligase (NEB). The synthetic PBTx3 gene was inserted into the vector pMAL-p2X (NEB) downstream from the ma lE gene of Escherichia coli and also d irectly downstr eam of a fX a site Fig. 1. Purification of native PBTx3 from the venom of P. transvaali- cus. (A) Crude ven om was first fractionated by FPLC gel filtration, yielding four peaks. The labelled fraction (*) was recovered and lyo- philized. B ased on a constructed gel filtration calibration curve, the molecular mass of the material in this fraction ranged fr om 3 to 6 kDa. (B) T he second p urificat ion step was carried out usin g a FPLC C 2 /C 18 reversed-phase column. Fractions eluting at 17–23 min (*) contain ÔpotentialÕ short-chain toxins an d were rec overed an d dried. (C) Th e third step involved a H PLC C 18 reversed-phase purification. Ó FEBS 2002 Novel K + channel blocker parabutoxin 3 (Eur. J. Biochem. 269) 1855 into a XmnI site. The gene possessed an overhang at the 3¢ end ( BamHI) t o d irect the orientation of the i nsert into pMAL-p2X. The transformants c ontaining the correctly constructed DNA fragments for PBTx 3 were analysed by digestion with two different restriction enzymes NaeIand XmnI (NEB). Because insertio n of the s ynthetic gene disrupts the XmnI recognition site, this enzyme cannot cleave the recombinant plasmid. To c leave the gene in the seco nd part of its sequence, NaeI was used as a double c ontrol of the original duplexes. In both cases, E. coli JM109 (P romega, The Netherlands) was used for p lasmid propagation. A translation termination codon was i nserted at t he end o f the PBTx3 coding sequence. The vector possesses malEtrans- lation initiation signals to direct the toxin-fusion proteins to the periplasm, thus allowing folding and disulfide bond formation to t ake place in E. coli [15,16]. T he method for t he expression of our toxins used the strong P tac promoter, which gave a h igh-level expression of thecloned sequences encoding the fusion. For c omparison with PBTx3, the h igh affinity K + channel blocker AgTx2 [17], which is structurally related to PBTx3, was produced by a similar strategy. Expression, purification and cleavage of fusion proteins Rich Luria–Bertani medium containing bactotryptone (Sigma, Belgium), yeast (Remel, BioTrading, Belgium), NaCl (Merck Eurolab, Belgium), g lucose (Merck Eurolab) and ampicillin (1 lgÆmL )1 ) was inoculated with an over- night c ulture of E. coli DH5a cells, c arrying the gene fusions encoding either rAgTx2 or rPBTx3, in a culture shaker incubator (Innova 4 000, New Brunswick Scientific). In b oth situations, the cells were grown a t 37 °C and when the cell density had reached A 600 ¼ 0.5, expression of the fusion proteins was i nduced by adding isopropyl thio-b- D -galacto- side (Sigma) to a final concentration of 0 .2 m M . Cells were harvested by centrifugation at 2660 g at 4 °Cfor20min and subjected to osmotic s hock according to the following procedures. The cells were resuspended in 400 mL 30 m M Tris/HCl (Sigma) w ith 20% sucrose (Sigma) pH 8.0 at 25 °C. The suspension was treated with Na 2 EDTA (Sigma) to give a concentra tion of 1 m M and incubated at room temperature with shaking. After 10 min, the mixture was centrifuged f or 20 min at 2660 g at 4 °C. The s upernatant was removed and t he well drai ned pellet w as resuspend ed in 400 m L ice-cold 5 m M MgSO 4 (Sigma) in an ice bath for 10 min and centrifuged at 2660 g at 4 °C. The supernatant is the c old o smotic shock fluid which contains the periplas- mic e xtracts. The periplasmic extracts (400 mL) were loaded Fig. 2. Sequence determination of native PBTx3. (A) The first 36 amino acid residue s of PBTx3 w ere identified b y direct seq uenci ng a . Sequencing the last f ragment, produced af ter cyanogen b romide cleavage, identified the C-te rminal re sidue arginine b . (B) Alignment of the amino acid se quences of t he members o f subfamily 1 o f short-chain a-KTx toxins isolated from scorp ion venom. Dashes represent gaps that were introduced to improve the align ment. Identical amino acids are indicated with a black background. Homologous residues are indicated w ith a grey background. The p e rcentage id ent ity w ith ChTx is shown. ChTx (c harybdo toxin [24]), charybdotoxin-Lq-2 [10], Lqh 15–1 [25] and AgTx2 (agitoxin 2 [15]), were purified from Leiurus quinquestriatus var. Hebraeus; B mTx1–2 [26] was purified from Buthus martensi Karsch; HgTx2 (h ongotoxin 2 [27]), and LbTx (lim batotoxin [34]), were purified from Centruroides lim batus; IbTx ( iberiotoxin [28]), and TmTx (tamulotoxin [56]), were purified from Buthus tamulus; PBTx3 (parabutoxin 3, this study) was purified from Parabuthus transvaalicus. Fig. 3. Schematic diagram of the pMAL-p2X vector containing the synthetic gene for the PBTx3 homologue. (A) Two ligations were performed u sing a 6706-bp p MAL-p XmnI/BamHI fr agment and a 111-bp fragment encoding the PBTx3 homologue, immediately downstream of t he fX a cleavage site in the v ector. Amp R , ampicillin resistance gene; ori, origin. (B–D) Chromatographic profiles after purification of the fusion p rotein (B) and reco mbinant toxin (C,D) rPBTx3. Fractions containing the MBP-fusion proteins wer e co llected and prepared for cleavage with fX a . The restriction digests were applied on the same HPLC C 18 column as in Fig. 1 and material eluting between 8 and 15 min was purified further on a H PLC C 2 /C 18 column and tested on Kv1 channels expressed in Xenopus oocytes. 1856 I. Huys et al. (Eur. J. Biochem. 269) Ó FEBS 2002 to an amylose affinity resin (1.5 · 23 cm column, Biolabs, NEB) at a flow rate of 1 mLÆmin )1 in column buffer containing 20 m M Tris/HCl, 200 m M NaCl (Merck Eur- olabs, Be lgium), a nd 1 m M Na 2 EDTA buffer, pH 7.4. After washing of the unbound proteins, the bound maltose- binding protein (MBP)-fusion products were eluted from the amylose resin using the same column buffer containing 10 m M maltose ( Merck E urolabs). T wenty 3 -mL f ractions were collected and the fusion protein was easily detected by the UV absorbance spectrophotometer (UV/VIS Spectro- photometer lambda 16, PerkinElmer) at 280 nm. The protein-containing fractions were pooled and purified further using a Superdex Peptide gel filtration column on the SMART System (Pharmacia Biotech). The elution was performed with a buffer containing 20 m M Tris/HCl and 100 m M NaCl, pH 8 .0 (Fig. 3B). C ontrols were performed with cells containing no vector or cells containing the vector without insert. The synthetic gene encodin g the PBTx3 homologue was designed such that an fX a cleavage site (Ile-Glu-Gly-Arg-) immediately preceded the N-terminal Glu of the toxin (Fig. 3 A). The enzymatic cleavage of the pooled fusion proteins was carried out at various conditions by fX a (different sources: Boehringer, Sigma, NEB). Optimal cleavage could be performed in the following conditions: 72 h incubation at room temperature a nd a concentration of 0.5 UÆlg )1 fusion protein in a buffer c ontaining 20 m M Tris/HCl, 100 m M NaCl and 2 m M CaCl 2 ,pH8.0.After cleavage with this enzyme, the recombinant toxin was generated without vector-related fragments. In a parallel experiment with AgTx2, chromatographic profiles of rAgTx2 and commercially available rAgTx2 (Alomone Laboratories) under the same conditions were compared and were identical. HPLC Separations of the recombinant proteins were fir st per- formed with a 218TP104 C 18 reversed-phase HPLC column (Vydac) a nd equilibrated with 0 .1% trifluoroacetic acid (Sigma)at25°C (Fig. 3C ). A fter 4 min an immediate ste p to 5% aceton itrile (with 0.1% trifluoroacetic a cid) was followed by a linear gradient to 30% acetonitrile for 5 min and then by a linear gradient to 60% for the last 12 min. The flow rate was 0.75 mLÆmin )1 and t he absorbance was measured simultaneously a t 214, 254 and 2 80 nm. The fraction containing the recombinant toxin (arrow) was recoveredandappliedtoalRPC C 2 /C 18 SC 2.1/10 reversed-phase HPLC column (Vydac). A linear gradient, starting after 6 min and ranging from 0% to 30% up to 100 min with a flow rate of 200 lLÆmin )1 (Fig. 3 D), was applied and the toxin was collected, dried (Speed VacÒ Plus) and prepared for functional analysis. Mass spectroscopy For e xamination of mass, 1 pmol o f the venom was dried and redissolved in acetonitrile (+ 0.1% trifluoroacetic acid). The molecular mass of the compounds in the venom and the masses of rAgTx2 (used as a control toxin) and rPBTx3 were determined with M ALDI-TOF MS on a V G Tofspec (Micromass, UK) operating in the linear a nd in th e reflectron mode. Electrophysiological recording Oocyte expression – Kv1.1. For in vitro transcription, plasmids were first linearized with PstI (New England Biolabs) 3 ¢ to the 3¢ nontranslated b-globin sequence i n our custom-made h igh expression vector for oocytes, pGEMHE [18–20] and then t ranscribed us ing T7 RNA polymerase and a cap analogue diguanosine triphosphate (Promega). Kv1.2. The cDNA encoding Kv1.2 (originally termed RCK5) in its original vector, pAKS2, was first subcloned into pGEM- HE [19]. The insert was released by a double restriction digest with BglII and EcoRI. N ext, the cDNA was loaded onto an a garose gel, fr agments of interest were cut out, g ene cleaned (QIAGEN) and ligated into the BamHI and EcoRI sites of pGEM-HE. For in vitro transcription, the cDNA was linearized with SphI and transcribed using the large- scale T7 mMESSAGE mMACHINE transcription kit (Ambion). Kv1.3. Plasmid pCI.neo containing the gene for Kv1.3 was linearized with NotI (New England Biolabs) and transcribed as for Kv1.2 [21]. Stage V–VI Xenopus laevis oocytes were isolated by partial ovariectomy under anaes- thesia (tricaine, 1 gÆL )1 ). Anaesthetized animals were kept on ice during dissection. The oocytes were defolliculated by treatment with 2 mgÆmL )1 collagenase (Sigma) in zero calcium ND-96 solution (see below). Between 2 and 24 h after defolliculation, ooc ytes were injec ted with 50 nL of 1– 100 ng ÆlL )1 cRNA. The oocytes were then incubated in ND-96 solution at 18 °C for 1–4 days . The animals were handled in conformity with the ‘Guide f or the Care and Use of Laboratory Animals’, published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). Electrophysiology. Whole-cell c urrents from oocytes were recorded using the two-microelectrode voltage clamp technique. Voltage and current electrodes (0.4–2 mega- ohms) were filled with 3 M KCl. Current records were sampled at 0.5-ms intervals after low pass filtering at 0.1 k Hz. Off-line analysis was performed on a Pentium(r) III processor computer. Linear components o f capacity and leak currents were not subtracted. All experiments were performed at room temperature (19–23 °C). Fitted K d values were obtained after calculating the fraction current left over after a pplication of several toxin concentrations in different oocyte experiments (mean ± SD, n). Solutions. The ND-96 solution (pH 7.5) c ontained 96 m M NaCl, 2 m M KCl, 1.8 m M CaCl 2 ,1m M MgCl 2 ,5m M Hepes, supplemented with 50 mgÆL )1 gentamycin sulphate (only for incubation). Modeling A model was generated by an automated homology modelling server (Expert Protein Analysis System proteo- mics server using SWISS-MODEL-ProModII) running at the Swiss Institute of Bioinformatics ( Geneva). Target (PBTx3) and template (hongotoxin 2) sequences were automatically aligned by Multiple Sequence Alignment Software ( CLUSTALW ), which subsequently generated the coordinates of both models. Energy minimization ( GROMOS 96) and simulated annealing cycles were run. SWISS - MODEL computes a confidence factor for each atom Ó FEBS 2002 Novel K + channel blocker parabutoxin 3 (Eur. J. Biochem. 269) 1857 in the model structure, taking i nto account the deviation of the model from the template structure and the distance t rap value used for framework building. RESULTS Kv1 K + channels were expressed in X. laevis oocytes and studied using a two-microelectrode voltage clamp. Crude venom of P. transvaalicus (340 lg) produces a reversible inhibition of the Kv1.1 K + current elicited by depolariza- tion up to 0 mV (data not shown). In our quest to find novel short-chain scorpion toxins in t he venom of P. transvaali- cus, acting on voltage-dependent K + channels, we fraction- ated the crude venom of this scorpion as detailed in Materials and methods (Fig. 1). As described by Debont et al . [22], gel filtration shows three typical groups of components (Fig. 1A), the largest of which (group I) was shown to block Kv1.1 channels. Based on a constructed calibration curve (see Debont et al. 199 8), t he active fra ction corresponded to a molecular mass between 3 and 6 kDa, which probably represents the family of short-chain scor- pion toxins. After HPLC purification of this active fraction (Fig. 1 C), that representing native PBTx3 (85 l M )caused an inhibition of Kv1.1 channels of 50%, whereas 550 n M native PBTx3 produces 54% and 51% block of t he Kv1.2 and K v1 .3 ch annels, respectively ( Fig. 4A–C). We have undertaken the recombinant synthesis of this toxin in o rder to facilitate the characterization of its biological properties. The yields of affinity-purified proteins were 40–60 mg ÆL )1 culture, estimated by absorbance at 280 nm, which after cleavage resulted in the production of 2–4 m g of r ecombin- ant toxin per litre culture. The r ecombinant synthesis resulted in the production of a recombinant toxin with an expected molecular mass of 4118 Da, with respect to the three disulfide bridges present in the secondary structure of the PBTx3 homologue. T he mass of rAgTx2 (ÔcontrolÕ tox in for comparison) was also consistent with the theoretical mass. Functional effects of recombinant toxins on Kv.1 channels were investigated by electrophysiological experi- ments. No block was obtained when MBP-rPBTx3 was applied to expressed K + channels in Xenopus oocytes (n ¼ 3) (data not shown). Recombinant PBTx3 inhibits both Kv1.2 and Kv1.3 channels with weak affinities and similar potencies, whereas it is a very weak inhibitor of Kv1.1 channels: application of 550 n M rPBTx3 produced no blocking effect on Kv1.1 channels (Fig. 4D), whereas the Kv1.2 and Kv1.3 curre nts were reversibly b locked to 52% and 49%, respectively (Fig. 4E,F). As part of a control, rAgTx2 was a pplied to the same oocytes expressing Kv1.1 channels. A ddition o f 1 n M rAgTx2 blocked the K + current almost completely (Fig. 4 G) and this effect was reversible upon washout. A fter equilibration of the c hannels and application of the same concentration of commercially available rAgTx2, quantitatively the same effect was observed as with our laboratory prepared rAgTx2. This observation, together with the fact that co-injection of equimolar amounts of both A gTx2 on reverse-phase HPLC resulted in a single peak (data not shown), demonstrates that our rAgTx2 b ehaved similarly t o the commercially available recombinant toxin. Blockage of the Kv1 channels induced by rAgTx2 or rPBTx3 (tested at different concentrations) was shown n ot to be voltage-dependent, as the degree of block was not different in the range of test potentials from )30 to +20 mV. Recombinant PBTx3 (500 n M ) blocked the Kv1.2 and Kv1.3 peak currents by 54% and 53% at )30 mV (n ¼ 3), and by 53% and 54% (n ¼ 3) at 20 mV . In the presence of 70 l M rPBTx3, t he Kv1.1 peak current was blocke d by 45% (n ¼ 3) at )30 mV and by 42% at 2 0 mV (n ¼ 3). Blocking of the Kv1 channels by rPBTx3 is reversible a nd has no influence on the gating characteristics of the channels. Therefore, the time constants for relaxation to equilibrium block o f t he different Kv1 channels in the presence of the toxin reflect only t he progress of the b inding reaction. To determine the time constants s on and s off for blockade and recovery, current t races were repeated every 2 s before, during and after rPBTx3 application. The time- courses of blockade and recovery were fitted t o mono- exponential curves, in agreement w ith the results obtained for other scorpion toxins [23]. In the presence of 10 l M rPBTx3 on Kv1.1 and 3 .3 l M rPBTx3onKv1.2andKv1.3 channels, b lockade o ccurred with a mean time constant s on of 8.3 ms, 2.1 m s a nd 1.7 ms, respectively, for Kv1.1, Kv1.2 and Kv1.3 channels. The recovery from blockade Fig. 4. Effects of native (A–C) and recombinant (D–F) PBTx3 on Kv1.1, Kv1.2 and Kv1.3 channels. Whole-cell K + currents through Kv1.1, Kv1.2 and Kv1.3 channels, respectively, expressed in Xenopus oocytes, a re evoked by depolarizing t he oocyte f rom a h olding potential of )90 mV to 0 mV. The oocytes were clamped back to )90 mV (A), or to )50 m V (B–G). Application of 85 l M native PBTx3 (active fraction in Fig. 1C indicated by *) on Kv1.1 channels or 550 n M on Kv1.2 and Kv1.3 channels, produced 50%, 54% and 51% inhibi- tion, respectively, of the Kv1.1, Kv1.2 and Kv1.3 currents. (D–F) Current through Kv1.1, Kv1.2 a nd Kv1.3 channels, respectively, in control conditions (s) and in the presence ( d)of550n M rPBTx3. (G) Inhibition of Kv1.1 current, produced by 1 n M of rAgTx2. 1858 I. Huys et al. (Eur. J. Biochem. 269) Ó FEBS 2002 occurred with a mean s off of 9.2 ms, 23.9 ms and 10.8 ms. Corresponding k on values were therefore 1.3 · 10 3 M )1 Æs )1 , 12.7 · 10 4 M )1 Æs )1 and 1.4 · 10 5 M )1 Æs )1 and k off values were 0.108 s )1 , 0.041 Æs )1 and 0.092 Æs )1 , respectively, for Kv1.1, Kv1.2 and Kv1.3. The K d calculated from the ratio k off /k on was in all cases in g ood agreement with the value obtained in the dose–response experiments (see further): 80 l M for Kv1.1 (K d ¼ 79 l M ), 322 n M for Kv1.2 (K d ¼ 547 n M )and657n M for Kv1.3 (K d ¼ 492 n M ). The fraction of unblocked current at equilibrium (f u )is readily measured and is related to the rate constants according to f u ¼ k off /(k on [rPBTx3] + k off ). The Hill coefficients were not significantly different from 1. From the constructed current/voltage relationship (I test /V test ), it can be seen that 70 p M rAgTx2 produced a marked inhibition (45%) of the K + current of Kv1.1 channels at all V test (Fig. 5 , 1b) as measured at the end of each 100 ms test pulse. Recombinant PBTx3 produced almost the same effect by applying 550 n M toxin on Kv1.2 (Fig. 5, 1c) and 500 n M toxin on Kv1.3 (Fig. 5, 1d) channels, whereas the same degree of inhibition was o bserved with 7 0 l M toxin o n Kv1.1 channels (Fig. 5 , 1a). This was in close agreement with the inhibition seen with native PBTx3 ( Fig. 4A). The r eversal potential for Kv1.1 currents was evaluated from the kinetics of the tail currents upon repolarization. A tail current/voltage curve (I tail /V test ) was constructed by fitting the data with a single Boltzmann distribution function of the form I tail ¼ I tail,max /{1 + exp[(V 1/2 –V)/ s]} where I tail is the tail c urrent, I max is the maximal t ail current, and s the slope factor of the voltage dependence. The peak amplitudes of t he tails were measured at )50 mV a nd plotted as a function of the preceding V test (Fig. 5 , 2a,b). This resulted in a typical fraction open channels/membrane voltage relationship. In the study with rAgTx2 (Fig. 5, 2a), the function in the control situation (n ¼ 4) was charac- terized by a half-maximal potential (V 1/2 ) and slope ( s)of )19.7 ± 0.7 mV and 10.0 ± 0.7 mV, respectively. With 10 p M rAgTx2 (n ¼ 4), V 1/2 was )20.3 ± 1.3 mV and s was 10.5 ± 1.3 mV, demonstrating that there was no significant shift o f V 1/2 and of t he s-value, showing n o effect on the c hannel gating. For t he control situation (n ¼ 4) in the e xperiment w ith r PBTx3 ( Fig. 5, 2b), the V 1/ 2 and s were )19.5 ± 2.7 mV and 10.9 ± 2.7 mV, respec- tively. I n t he presence of rPBTx3 (n ¼ 4), V 1/2 and s were )19.9 ± 1.7 mV and 9.3 ± 1.6 mV, respectively, s uggest- ing that this n ew toxin did not change the midpoint of the open channel/voltage curve of K v1.1 channels. Steady-state Kv1.2 and Kv1.3 currents were converted to conductances using a reversal potential of )80mVandfittedtosingle, first-order Boltzmann distributions. Conductances were normalized to the maximum estimated from the Boltzmann fit. In control, the function was characterized by a half- maximal potential (V 1/2 )of)19.6 ± 3.3 mV and –22.0 ± 6.0 mV ( n ¼ 4) with a slope factor of 7.5 ± 0.3 mV and 9.3 ± 4.7 mV, for Kv1.2 and Kv1.3 channels, respectively. With 500 n M rPBTx3, there was no shift: V 1/2 , )19.5 ± 1.7 mV and –21.6 ± 4.3 mV and s 9.6±3.3mVand8.5±6.3mV(n ¼ 4) for Kv1.2 and Kv1.3 channels, respectively (Fig. 5, 2c,d). The induced inhibition by rPBTx3 was concentration- dependent. F ig. 6A and B show the dose–response c urves o f Kv1 c hannels to the recombinant toxins. The half-maximal effect on Kv1.2 a nd Kv1.3 c hannels was obtained with 547 n M and 492 n M , respectively. However, the affinity of rPBTx3 for Kv1.1 channels was very l ow, w ith K d ¼ 79 l M , showing t hat rAgTx2 ( K d ¼ 59 p M )hasa 1 · 10 6 times higher affinity toward these channels. The Fig. 5. (1a–d) T he current/voltage ( I test /V test ) relationship i n control (s) and in the presence (d) of d ifferent concentrations of rPBTx3 (a, c, d ) on Kv1.1, Kv1.2 and Kv1.3, respectively, and r AgTx2 (B) on Kv1. 1 channels expressed in Xenopus oocytes. Currents were measured at the end of each 500 ms test pulse. In all cases, the effect was reversible. (2a, b) Corresponding fraction open ch annels/membrane voltage curve ( I tail / V test ) relationship, fitted with a Boltzmann function (n ¼ 4). (2a) In the absence of toxin ( s), the midpo int (V 1/2 ) and slope factor for Kv1.1 channels were )19.7 ± 0.7 mV and 10.0 ± 0.7 mV, respectively. In the presence o f rAgTx2 (d), V 1/2 and s were )20.3 ± 1.3 mV a nd 10.5 ± 1.3 mV (2b). In the control experiment (s) f or rPBTx3 on Kv1.1 channels, V 1/2 and s wer e )19.5 ± 2.7 and 10.9 ± 2.7, respectively, whereas after addition of rPBTx3 (d), they were )19.9 ± 1.7 mV and 9.3 ± 1 .6 mV, respectively. The residual in maximal fraction open channels induced by application of 10 p M rAgTx2 was 75 ± 1.47% a nd by a p plication of 7 0 l M rPBTx3 it was 53.6 ± 9.4%. (2c,d) M aximal membrane conductances (G max )were calculated. The steady-state activation curves for th e control (s)andin thepresenceof500n M PBTx3 ( d) w ere obtained after fitting with a Boltzmann fun ction I ¼ I c /[1 + exp(–V test –V 1/2 )/s] )1 .Inbothcases, for Kv1.2 and Kv1.3, V 1/2 is not shifted by rPBTx3 a s illustrated by the dashed lines. Slope values (s) for the c ontrol and t he toxin c urve s are, respectively, 7.5 and 9.6 for Kv1.2, and 9.3 and 8.5 for Kv1.3 channels. In all cases, there was no significant shift of V 1/2 . Ó FEBS 2002 Novel K + channel blocker parabutoxin 3 (Eur. J. Biochem. 269) 1859 obtained K d of rAgTx2 for Kv1.1 w as in accordance with the value reported by Garcia et al. [15]. Block was rever sible upon washing-out. A s the toxin binding was r eversible and did not alter channel gating, we investigated rPBTx3 binding to the channel. As has been explained earlier, blockade is assumed to o ccur by a simple bimolecular reaction. If the toxin binding to the channel indeed re flects a bimolecular reaction scheme, the a pparent first-order association rate increases linearly with toxin concentration and the first-order dissociation r ate remains constant. This was indeed the case as shown in Fig. 6 C, where the effects of increasing rPBTx3 concentrations on the kinetics of block on Kv1.2 are illustrated. The time course of activation was fitted using a Hodgkin–Huxley type model with a 4th power function of the form: I t ¼ A {1–exp[+ (t/s)] 4 +C}, with I t the macroscopic and t ime-dependent current, A the c urrent predicted at steady-state, s the time constant, and C a constant. For a depolarizing pulse from )90 to 0 m V, the activation kinetics of Kv1.3 could be fitted with a time constant of 11.2 ± 0.7 ms and 10.94 ± 1.1 ms in the control and in the pre sen ce o f 5 00 n M rPBTx3, respectively (Fig. 6D). Recombinant rPBTx3 did not alter the activation or inactivation time c onstants of Kv1.3 channels expressed in oocytes. Other channels Finally, we i nvestigated the effect of our new toxin on different cloned channels, included in the screening p rocess, in order to study its s electivity profile. Recombinant PBTx3 has n o e ffect on Kir2.1 channels, hERG-type channels, hH1 Na + channels (plant) KAT channels, cardiac two-pore background K + channels (cTBAK) and the calcium channel p2X expressed in Xenopus oocytes (data not shown). DISCUSSION The number of peptides isolated from distinct phyla, like scorpions [23], sea anemones [24,25], marine cone snails [26] and snakes has increased c onsiderably. They have a three- dimensional structure with some conserved motifs [27] b ut their affinity and specificity towards different targets may vary. Those t argets include ion channels, p resent in different tissues. In order to increase our knowledge o f the structure– function relationship between toxins and ion channels, it is necessary to isolate peptides in scorpion venoms and characterize them as much as possible. In this study, we present the purification, primary structure and functional characterization of PBTx3, a novel peptide inhibitor from the venom of the P. transvaalicus scorpion. PBTx3 was isolated from the venom on the basis of its ability to inh ibit the K + current through cloned voltage-dependent K + channels (Kv1) expressed in Xenopus oocytes. Separation procedures leading to the identification of this novel neurotoxin were performed by gel filtration and reversed- phase HPLC, by using different types of columns, as described previously [28]. The n ew toxin PBTx3 has a peptidic chain of 37 amino acids and shows similarities with members of the first subfamily of a-K + scorpion toxins [8], with a fully conserved stretch of residues G25-K26-C27-M28-N29 residing in one of the b sheets, like ChTx. The sequence Lys-Cys-XXX-Lys-Cys (X being any amino acid), with the Lys–Cys i n antiparallel b sheets and XXX b eing a tight turn, is also conserved, as in all other small scorpion toxins that areactiveonK + channels. In order to find structurally significant feat ures in t he sequence of P BTx3 (Fig. 2B), sequence alignments were per formed using the program CLUSTAL 1.8 (http://searchlauncher.bcm.tmc.edu:9331/mul- tialign/multialign.html). PBTx3 shows similarities with ChTx (41%) [ 29], Lqh 15-1 (44%) [ 30] and ChTx-Lq-2 (38%) [11] from Leiurus quinquestriatus var. Hebraeus, BmTx 1 (55%) and 2 (41%) [31] f rom Buthus martensi Karsch, HgTx 2 (55%) [32] and LbTx (50%) [33] from Centruroides limbatus, IbTx (47%) [34] and TmTx (52%) [35] from But hus ta mulus. Alignment of the cysteine residues (C 6 –C 27 ,C 12 –C 32 ,C 16 –C 34 ) s howed that it was a novel toxin and t hat the cystein e motif was highly conserved. This cysteine pattern w as also found in long-chain scorpion toxins [36] and other defence proteins s uch as the antibac- terial insect defensin A [37], as well as in plant thionins [38] and potent antifungal plant defensins [39]. Disulfide bridges are important in stabilizing the three-dimensional structure of the toxin, a s d emonstrated by NMR studies of ChTx [40], iberiotoxin [41] and Lq2 [ 42]. Definitive assignment of the disulfide linkages in PBTx3 is currently unknown but is assumedtomimicthatofChTxandothera-KTx. S pecific Fig. 6. Dose–response curves o f rAgTx2 (A) and rPBTx3 (B) with a K d value f or rAgTx2 of 59 p M (Hill coefficien t o f 0 .9). Each point repre- sents the mean ± SD from four oocytes. The expected K d values for rPBTx3 on Kv1.1, Kv1.2 and Kv1.3 are, respectively, 79 l M , 547 n M and 492 n M (Hill coefficients 0.89, 1.41 and 1.16, respectively). (C) Bimolecular k inetics of PBTx3 interaction. Rate constants of b locking [k on (rPBTx3), d] and dissociation (k off , s) were measured from volt- age-clamp rec ords as a function of external r PBTx3 c oncen tration. Each point represe nts the mean ± SD of three individual de termin- ations. ( D) Effect of rPBTx3 on activation a nd inactivation kinetics of Kv1.3 channels. After depolarizing up to 0 mV from a V hold of )90 mV for 500 ms, the activation and inactivation process in the presence of rPBTx3 is not c hanged. Both current traces, control a nd in the presence of toxin, have been superimposed after scaling of the trace in presence of rPBTx3. 1860 I. Huys et al. (Eur. J. Biochem. 269) Ó FEBS 2002 residues i n C hTx, responsible for s pecific properties, are a lso present in PBTx3. For example K26 (using PBTx3 numbering), the crucial residue in the interaction with the pore of voltage-gated K + channels [43], is located in the centre of the molecule. Furthermore G26 (corresponding to G25 in PBTx3) has been suggested to be important for appropriate formation of the disulfide pairing [44] and is also conserved throughout these sequences of all the members of subfamily 1 of a-KTx, including PBTx3. Because of these similarities and conservation of the consensus sequence, proposed for a-KTx subfamily 1, this new t oxin is supposed to be the tenth member of the a-K toxin 1 subfamily. Although this novel toxin maintains a number of expected features, present also i n ChTx and known to be important for the activity, it is unique in some aspects. In contrast with other members of the Ch Tx- subfamily, PBTx3 lacks F2 an d W 14. The latter plays a role in the interaction of the other members of this subfamily with residue G380 in the outer vestibule o f t he Kv1.3 channel [45]. The mutation W13L could w ell be responsible for the lower affinity of PBTx3 for Kv1 channels, as a similar decrease in affinity was demonstrated previously for the W14A mutant of ChTx [45]. However, those two residues are seen only in the toxins known to block BK channels (large-conductance Ca 2+ -activated K + channels). PBTx3 conserves a lso a higher content of proline residues (two), but the importance of this is not really clear. PBTx3 possesses no N -terminal pyroglutamate, a residue classified as influential in the functional map of ChTx [46]. These structural differences in PBTx3 together with differences in the sequence a t crucial or influential places (one N-terminal residue fewer, R22, P23, N24, R30, K33 and P36 versus the N-terminus, T23, S24, R25, K31, R34 and S37 in ChTx) may explain why the affinity of rPBTx3 is much lower for Kv1 channels. The toxin is composed of 37 amino-acid residues, with 11 positively charged groups and three negatively charged residues, dispersed all over the molecular surface. Groups of strong hydrophobicity (M4, M28, Y35) and H-binding capacity (S8, S9 N24 and N29) would suggest that the s pecific block of t he toxin relies upon hydrophobic as well as polar interactions. The three- dimensional structure of PBTx3 is also related to the a-KTx1 subfamily. Its three-dimensional conformation is determined by homology modelling (Fig. 7) with hongo- toxin 2 (a-KTx 1.9) as a t emplate f or modelling because t his latter toxin shares 55% homology with PBTx3. The a/b scaffold consists of a short a helix (residues S9–A19) and a b sheet, which is not triple- but double- stranded in PBTx3. Rather than forming a third b strand as found for other a-K toxins, the N terminal region of PBTx3, based in our model, adopts an extended confor- mation. This can be explained by the presence of the N-terminal end of PBTx3, which i s one residue shorter t han that of ChTx. It has been shown that toxins acting o n SK channels mostly contain a two-stranded antiparallel b sheet (leiurotoxin I and PO5), whereas toxins active on Kv channels mostly have a triple-stranded bsheet. Whether PBTx3 blocks SK channels remains to be investigated. The key feature of ChTx block of the Kv1 channels, a 1 : 1 stochiometry for toxin block o f the channel, is also observed with PBTx3. Although those two toxins could s hare a common mechanism for blocking, there are some quanti- tative differences in the blocking kinetics. For instance, t he on rate of rPBTx3 binding to Kv1 channels is 10–100 times slower than that of ChTx for which, depending on the conditions, channels are blocked with an on rate of 0.2– 20 · 10 7 M )1 Æs )1 . This is not very surprising as ChTx and PBTx3 share only 41% sequence homology. Only three positively charged residues are conserved between the two toxins, and two arginine residues and lysine residues are exchanged b etween the two toxins, located in the a-sheet. Of the t hree residues in C hTx (R25, K27 and R34) crucial t o toxin binding and blockade [46], only the K27 is conserved. The R34 is mutated to a lysine residue. Because of the difference in the l ength of their side chains, lysine a nd arginine could have a d ifferent effect as also described for other t oxins [ 47]. H owever, structural s imilarities in this part of the toxins may underlie the functional similarities observed for the toxins. ChTx is a highly b asic toxin, with a n et charge of +5 at neutral pH, whereas PBTx3 ( still more basic), carries a net charge of +9 (pH range 5–9). For PBTx3, an additional n egatively charged D3 is present, and could b e an explanation for some of the differences in the association rate constants of the two t oxins. Several binding sites of K + channel blocking peptides have been characterized a nd most of these blockers possess at least a common d iad composed of two functionally important residues, separated by 6.6 ± 1.0 A ˚ : a positively charged r esidue and a hydrophobic residue [48,49]. Residues in AgTx2 and ChTx at positions equivalent to Y36 and K27 of PBTx3 have been shown to be critical for channel blocking [50,51]. These two residues are also found in anemone K + channel toxins, despite the fact that the three- dimensional folding of scorpion and anemone toxins are quite different [48]. Regarding this hypothesis and in correspondence with the diad in ChTx, K26 and t he Y35 in PBTx3 are most probably involved in this diad. The distance that s eparates the C a of the lysine f rom the centre of the b enzene ring of the t yrosine i s 6 .805 ± 0.406 A ˚ .Wecan imagine that the toxin in teracts with t he channel like a moon lander s ystem and that those t wo residues p lay an i mportant role in the interaction with the pore of the channel. Our control toxin in the recombinant expression, AgTx2, Fig. 7. A t hree-dimensional model f or PBTx3, co nstructed by homology modelling. Th e backbone o f the m olecule is sh own in ribb on. Residues forming the functional diad (K26 and Y35) are in yellow. Ó FEBS 2002 Novel K + channel blocker parabutoxin 3 (Eur. J. Biochem. 269) 1861 represents a very potent blocker of K v1 type c hannels. Mutagenesis studies on AgTx2 i dentified a set of residues a s functionally important f or blocking the Shaker K + channels (N30, K27, R24, S11, F25, T36, M29 and less important R31) [52]. Three residues are mutated in PBTx3, namely R27P, F25N and T36Y (AgTx2 numbering). The T36Y mutation is unlikely to affect drastically the affinity toward Kv1.3 channels, as i t also o ccurs in o ther members o f the first group. The effect of the R27P and F25N mutations could be m ore important, considering t he diad hypothesis. Most of the other mutations are located far f rom the inter- action surface, upstream from the a helix or within this helix. The sequence of rPBTx3 includes some similarities with subfamily three, seven and eight of the a-KTx toxins. These toxins all e nd with a positively charged residue at the C-terminus, preceded b y a proline. Functionally, the recom- binant toxin, lacking the arginine, demonstrates the same properties as the native toxin (with an additional arginine), illustrating that t his r esidue is not important f or function. In the first b sheet, PBTx3 represents a fully conserve d stretch referred to as the kaliotoxin group: C18-K19-A21-G22. Comparing the S5-P-S6 regions of the three channels, we can l ook for specific residues in the pore-forming r egion that are different between Kv1.1 c hannels and Kv1.2 or Kv1.3, that can possibly explain the selectivity toward t hese latter channels. T he only residue, present in both Kv1.2 a nd Kv1.3 and mutated in K v1.1 is D 372 (Kv1.3 numbering) . This residue is probably involved directly in the intimate interaction with the toxin right at the binding site. Mac- Kinnon et al. ( 1989) observed a substantial r eduction on the binding affinity when the s tructure of this site was altered by shortening the side chain (E–D) [13]. H owever, some studies have shown that the same mutations in highly homologous K + channels can produce different effects. Therefore the extrapolation of the structural and f unctional importance of residues should be done with caution, even with ion channels belonging to the same family [53]. It is well known that l ong-chain scorpion neurotoxic polypeptides from t he Buth idae family generally account for about 10–50% of the crude venom and that short-chain scorpion peptides appear only in very low quan tities in the venom [ 54]. D uring the past decade, a number of approa- ches have been developed t o produce toxins. For example PBTx3 is assessed to be only about 0.06% of the venom. Expression of scorpion toxins in Cos-7 cells [55], in insect cells by means of the Baculovirus system [56], in plants [57], in NIH/3T3 mouse cells [58] and in y east [57] led to rather low yields. The first recombinant toxin was described about 10 years ago [59] and different toxins followed. We produced rPBTx3 in order to verify that this peptide was indeed the inhibitory component in the scorpion venom, excluding the possibility of t he contamination with a peptide of higher affinity to K + channels. The system chosen to express PBTx3 in E. coli had previously been shown to be suitable for the production of soluble, correctly folded spider [60] or scorpion toxins [61]. F ollowing the procedures described in this study, it is feasible to p roduce 2 –4 mg of homogeneous and biologically active toxin from 1 L E. coli culture. The production of fully active rAgTx2 and rPBTx3 requires some in vitro post-translational modifications that are difficult to control: proteolytic release of the toxin from the fusion protein and correct forming of the three disulfide bonds by the six cysteines. Based on the chromatographic profile of a mixture of rAgTx2 and native AgTx2 (AlomoneÒ), which r esulted in a single elution peak without additional components, and based on the identical func- tional activity on K v1, we can assume that the folding process in rAgTx2 was correctly performed. In the case of rPBTx3, the e lution time of the native and the recombinant toxins were identical and the effect on Kv1 channels was also comparable. Therefore, we could also conclude that PBTx3 is not amidated, because peptides o f t his size with a free or with an amidated residue in the C-terminal position exhibit different retention times on HPLC [62]. The reduced peptide could b e air oxidized in a concentration-independ- ent manner. This was observed previously for other short scorpion toxins acting on Ca 2+ -activated K + channels (e.g. leiurotoxin I and PO5) [63,64]. The lack of activity of the fusion proteins is not unexpected as the 44 kDa additional mass could affect s ignificantly t he folding and accessibility of the toxin portion. As mentioned b efore, just a few studies were performed based on the native venom of P. transvaalicus. Crude venom of P. transvaalicus has been shown to modulate t he ChTx binding to aortic sarcolemmal vesicles, in a w ay that it was able to inhibit ChTx binding in the preparation [34]. Inhibitors from scorpions, snakes and bees appear to target primarily either the Shaker-related subfamily of Kv chan- nels or the Ca 2+ -activated K + channels [15,65,66]. In our study, we used a heterologous expression in oocytes of cloned Kv channel proteins. To determine which type of voltage-gated K + channel c ould be sensitive to r ecombinant PBTx3, electrophysiological experiments were performed on Kv1.1, Kv1.2 and Kv1.3 channels expressed in Xenopus oocytes. Kv1.3 channels have been found in several types of cells, in neurons, and in T lymphocytes and have proven to be highly sensitive t o scorpion toxins [ 67]. Analysis of the effects of rPBTx3 on Kv1 channels showed that rPBTx3 mimicked the effects of ChTx. ChTx blocks Kv1.2 and Kv1.3 with dissociation c onstants in the nanomolar range, but does not block Kv1.1, even at 1 l M [68]. In parallel, rPBTx3 blocks Kv1.2 and Kv1.3 channels, but with lower channel affinities than those of ChTx. The half-maximal blockage of Kv1.2 a nd Kv1.3 occurred a t 547 n M and 592 n M ,comparedwith6n M and 1 n M for ChTx [ 68]. Although there is a considerable amount of seq uence identity between PBTx3 and other members of subfamily 1 of the a-KTx, t he values for the a ssociation r ates and dissociation rate constants differed from those determined previously for A gTx 2 and ChTx [46,69]. We examined the inhibitory effects of rPBTx3 at different membrane voltages. Block induced by rPBTx3 w as voltage-independent over the range )30 to +20 mV, indicating that t his toxin is not very sensitive t o the gating state of the channel. Channel block by AgTx2 i s performed by physical occlusion of the conduction pore [23]. The overall channel conductance, measured from the slope of the current–voltage relationship, is not changed in all cases in the presence of toxin. Fig. 5 shows activation curves obtained in the absence and presence of extracellular rPBTx3 on Kv1, channels. R ecombinant PBTx3 does not shift the voltage at which the channels open. Also, a s demonstrated for Kv1.3, there was n o shift in the a ctivation or inactivation kinetics of t hose three ch annels, as demon- strated for Kv1.3 (Fig. 6D). For Kv1.1, both the onset and recovery from inhibition were slow. Because the t oxin does not alter ch annel K v1.2 gating and the binding to this 1862 I. Huys et al. (Eur. J. Biochem. 269) Ó FEBS 2002 channel is reversible, the time constants for relaxation to equilibrium block upon toxin exposure reflect only the process of the binding reaction. Therefore, the kinetics of rPBTx3-induced inhibition were consistent with a bimolec- ular reaction between PBTx3 an d Kv1.2. The forward rate constant for onset of inhibition varied linearly with PBTx3 concentration, while backward rate constant for recovery from inhibition was independent of PBTx3 concentration (Fig. 6 C). The dissociation constants (k off ) d ecreased f rom Kv1.1 to Kv1.2 a nd Kv1.3, in an order that correlates with the increase o f t he affinity of rPBTx3 for these channels. We screened a variety of other channels to investigate the selectivity of rPBTx3, but no modulation was observed. In the future, additional functional characterization of rPBTx3 on other types of channels is planned where, for example, Ca 2+ -activated K + channels and other Kv1 channels (e.g. Kv1.6) are good candidates. ACKNOWLEDGEMENTS We thank O. Pongs for providing t he cDNA for the Kv1.2 c hannel and C. Ulens f or the subcloning of the g ene e ncoding the Kv1.2 channel. The Kv1.3clonewaskindlyprovidedbyM.L.Garcia.WearegratefultoH. Sentenac to provide the KAT1 clone. The hK1 clone was kindly provided by R. G. Kallen. We also thank E. Toth Zsamboki for providing the P2X clone and Y. Kurachi for p roviding the TBAK clone. I. H. and E. C. are R esearch As sistants of the Flemish Fund for S cientific Research (F.W.O Vlaanderen). This work was supported by a bilateral collaboration b etween Flanders and South Africa (BIL00/36). REFERENCES 1. Newlands, G. (1974) The venom-squirting ability of Parabuthus scorpions (arachnida: buthidae). S. Afr. J. M ed. Sci. 39, 175–178. 2. Bergman, N.J. (1997) Clinical description of Parabuthus trans- vaalicus scorpionism in Zimbabwe. Toxicon 35, 759–771. 3. Muller, G.J. (1993) Scorpionism in South Africa. A report of 42 serious scorpion envenomations. S. Afr. Med. J. 83, 405–411. 4. Bergman, N.J. (1997) Scorpion sting in Zimbabwe. S. Afr. Med. J. 87, 163–167. 5. Van Aarde, M.N., Van Rooyen, J.M. & Van Aswegen, G. (1996) Screening of the venoms of two Pa rabuthus scorpion species on isolated cardiomyocytes. Onderstepoort J. Vet. Res. 63, 127–130. 6. Verdonck,F.,Bosteels,S.,Desmet,J.,Moerman,L.,Noppe,W., Willems, J., Tytgat, J. & van d er Walt, J. (2000) A novel class of pore-forming peptides in the venom of Parabuthus schlechteri Purcell. Cimbebasia 16, 247–260. 7. Tytgat, J., Debont, T., Rostoll, K., Muller, G.J., Verdonck, F ., Daenens, P., van der Walt, J .J. & P ossani, L.D. (1998) Purifica- tion and partial characterization of a ÔshortÕ insectotoxin - like peptide from the venom of the scorpion Parabuthus s chlechteri. FEBS Lett. 441, 387–391. 8. Tytgat, J., Chandy, K.G., Garcia, M.L., Gut man, G.A., Martin- Eauclaire, M.F., van der Walt, J.J. & Possani, L.D. (1999) A unified nomenclature for short-chain peptides isolated from scorpion venoms: alpha-KTx molecular subfamilies. Trends Pharmacol. S ci. 20, 444–447. 9. Garcia-Calvo, M., Knaus, H.G., McManus, O.B., Giangiacomo, K.M.,Kaczorowski,G.J.&Garcia,M.L.(1994)Purificationand reconstitution of the high-conductance, calcium-activated potassium channel from trac heal smooth mu scle. J. B i ol. Che m. 269, 676–682. 10. Wu, C.H. & Narahashi, T. (1988) Mechanism of action of n ovel marine ne urotoxins on i on channels. Annu . Rev. Pharmaco l. Toxicol. 28, 141–161. 11. Lucches i, K., Ravindran, A., Young, H. & Moczydlowski, E. (1989) Analysis of th e blocking act ivity of charybdoto xin homo- logs and iodinated derivatives against Ca 2+ -activated K + chan- nels. J. Membr. Biol. 109, 269–281. 12. Castle, N .A., H aylett, D .G. & Jenkinson, D.H . (1989) Toxins in the characterization o f potassium c hannels. Tren ds Neurosci. 12, 59–65. 13. MacKinnon, R . & Miller, C. (1989) Mutant p otassium channels with alte red b inding of charybdotoxin, a pore-blocking p eptide inhibitor. Science 245, 1382–1385. 14. Ackerman , M.J. & C laph am, D.E. (1997) Mechanisms o f d ise ase: ion channels – basic science and clinical disease. NewEngl.J.Med. 336, 1575–1586. 15. Missiakas, D . & Raina, S. (1997) Protein f olding in the bacterial periplasm. J. Bacteriol. 179, 2465–2471. 16. Bessette, P.H., Cotto, J.J., Gilbert, H.F. & Georgiou, G. (1999 ) In vivo and in vitro f unction of the Escherichia coli pe riplasmic cysteine oxidoreductase DsbG. J. Biol. Chem. 274, 7784–7792. 17. Garcia, M.L., Garcia-Calvo, M., Hidalgo, P ., Lee, A. & Mac- Kinnon, R. (1994) Purification and characterization of three inhibitors of voltage- dependent K + channels from Leiurus quin- questriatus var. hebraeus venom. Biochemistry 33, 6834–6839. 18. Baumann, A., Grupe, A., Ackermann, A. & Pongs, O. (1988) Structure of the voltage-dependent potassium channel is highly conserved from Drosophila to vertebrate central nervous systems. EMBO J. 7, 2457–2463. 19. Stuhmer, W., Stoc ker, M., Sakma nn, B., Seeburg, P., Baumann , A., Grupe, A. & Pongs, O. (1988) Potassium channels expressed from rat brain cDNA have delayed rectifier properties. FEBS Lett. 242, 199–206. 20. Liman, E.R., Tytgat, J. & Hess, P. (199 2) Subunit stoichiometry of a mammalian K+ c hannel determined by construction of mu lti- meric cDNAs. Neuron 9, 861–871. 21. Swanson, R., Marshall, J., Smith, J.S., Williams, J.B., Boyle, M.B., Folander, K., Luneau, C.J., Antanavage, J., Oliva, C., Buhrow, S.A. et al. (1990) Clon ing and expression of cDNA and genomic clones encoding three delayed rectifier potassium chan- nels in rat b rain. Neuron 4, 929–939. 22. Debont, T., Swerts, A., Van der Walt, J.J., Muller, G.J., Verdonck, F., Daenens, P. & Tytgat, J. (1998) Comparison and characterization of the venoms of three Parabuthus scorpion species occurring in southern Africa. Toxicon 36, 341–352. 23. Miller, C. (1995) The charybdotoxin family of K + channel- blocking peptides. Neuron 15, 5–10. 24. Aneiros, A., Garcia, I., Martinez, J.R., Harvey, A.L., Anderson, A.J.,Marshall,D.L.,Engstrom,A.,Hellman,U.&Karlsson,E. (1993) A p otassium channel toxin from th e secretion of the sea anemone Bunodosoma granulifera.Isolation,aminoacidsequence and biological activity. Biochim. Biophys. Acta. 1157, 86–92. 25. Castaneda, O., Sotolongo, V., Amor, A.M., Stocklin, R., Anderson, A.J., Harvey, A.L., Engstrom, A., Werstedt, C. & Karlsson, E. (1995) Ch aracterization of a potassium channel toxin from the Caribbean Sea anemone Stichodactyla H elianthus. Tox- icon 33, 603–613. 26. Terlau, H., Stocker, M., Shon, K.J., McIntosh, J.M. & Olivera, B.M. (1996) MicroO-conotoxin MrVIA inhibits mammalian sodium channels, but not through site I. J. Neurophysiol. 76, 1423–1429. 27. Kobayashi, Y., Takashima, H., Tamaoki, H., Kyogoku, Y., Lambert, P., Kuroda, H., Chino, N., Watanabe, T.X., Kimura, T., Sakakibara, S. et al. (1991) The cystine-stabilized alpha-helix: a common structural mo tif of ion-channel blocking neurotoxic peptides. Biopolymers 31, 1213–1220. 28. Debont, T., Daenens, P. & Tytgat, J. (1996) An improved frac- tionation and fast scre ening method for the iden tificat ion of new and selective neurotoxins. Neurosci. Res. 24, 201–206. 29. Gimenez-Gallego, G., Navia, M.A., Reuben, J.P., Katz, G.M., Kaczorowski, G.J. & Garcia, M.L. (1988) Purific ation, sequ ence, Ó FEBS 2002 Novel K + channel blocker parabutoxin 3 (Eur. J. Biochem. 269) 1863 [...]... apamin-blocked Ca2+-activated K+ channels of small conductance in cultured rat skeletal muscle Nature 3 23, 718–720 66 Grissmer, S., Nguyen, A. N., Aiyar, J., Hanson, D.C., Mather, R.J., Gutman, G .A. , Karmilowicz, M.J., Auperin, D.D & Chandy, K.G (1994) Pharmacological characterization of five cloned voltage-gated K+ channels, types Kv1.1, 1.2, 1 .3, 1.5, and 3.1, stably expressed in mammalian cell lines Mol Pharmacol... characterization of kaliotoxin Is the 26–32 sequence essential for potassium channel recognition? J Biol Chem 268, 26302–26309 63 Sabatier, J.M., Zerrouk, H., Darbon, H., Mabrouk, K., Benslimane, A. , Rochat, H., Martin-Eauclaire, M.F & Van Rietschoten, J (1993) P05, a new leiurotoxin I-like scorpion toxin: synthesis and structure–activity relationships of the alphaamidated analog, a ligand of Ca2+-activated... the P-region of a mammalian potassium channel (RCK1): a comparison with the Shaker potassium channel Biochem Biophys Res Commun 2 03, 513–518 54 Gomez-Lagunas, F., Olamendi-Portugal, T., Zamudio, F.Z & Possani, L.D (1996) Two novel toxins from the venom of the scorpion Pandinus imperator show that the N-terminal amino acid sequence is important for their a nities towards Shaker B K+ channels J Membr... conformation of leiurotoxin I (scyllatoxin) by 1H nuclear magnetic resonance Resonance assignment and secondary structure FEBS Lett 260, 249–253 Park, C.S & Miller, C (1992) Interaction of charybdotoxin with permeant ions inside the pore of a K+ channel Neuron 9, 307–313 Menez, A. , Bontems, F., Roumestand, C., Gilquin, G & Toma, F (1992) Analysis of side-chain organization on a refined model of charybdotoxin:... Feyfant, E., Sampieri, F., Rochat, H., Bougis, P.E & Martin-Eauclaire, M.F (1997) Influence of a NH2-terminal extension on the activity of KTX2, a K+ channel blocker purified from Androctonus australis scorpion venom FEBS Lett 417, 123–129 62 Romi, R., Crest, M., Gola, M., Sampieri, F., Jacquet, G., Zerrouk, H., Mansuelle, P., Sorokine, O., Van Dorsselaer, A. , & Rochat, H et al (1993) Synthesis and characterization. .. Toma, F (1992) Analysis of side-chain organization on a refined model of charybdotoxin: structural and functional implications Biochemistry 31, 7756–7764 Johnson, B .A & Sugg, E.E (1992) Determination of the threedimensional structure of iberiotoxin in solution by 1H nuclear magnetic resonance spectroscopy Biochemistry 31, 8151–8159 Martins, J.C., Zhang, W.G., Tartar, A. , Lazdunski, M & Borremans, F .A. .. against K+ channels from venom of new world scorpions Biophys J 59, 7 8a Galvez, A. , Gimenez-Gallego, G., Reuben, J.P., Roy-Contancin, L., Feigenbaum, P., Kaczorowski, G.J & Garcia, M.L (1990) Purification and characterization of a unique, potent, peptidyl probe for the high conductance calcium-activated potassium channel from venom of the scorpion Buthus tamulus J Biol Chem 265, 11083–11090 Escoubas, P.,... Herrmann, R., Moskowitz, H., Rajendra, W., Hammock, B & Nakajima, T (1997) Tamulotoxin, a novel member of the potassium channel active short toxins from the venom of the Indian red scorpion Buthus tamulus Toxicon 35, 806 Dauplais, M., Gilquin, B., Possani, L.D., Gurrola-Briones, G., Roumestand, C & Menez, A (1995) Determination of the three-dimensional solution structure of noxiustoxin: analysis of structural... et al (Eur J Biochem 269) 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 and model structure of charybdotoxin, a potent selective inhibitor of calcium-activated potassium channels Proc Natl Acad Sci USA 85, 3329–3333 Marshall, D.L., Vatanpour, H., Harvey, A. L., Boyot, P., Pinkasfeld, S., Doljansky, Y., Bouet, F & Menez, A (1994) Neuromuscular effects of some potassium channel blocking toxins from the venom. .. J., Kaczorowski, G.J., Garcia, M.L & Knaus, H.G (1998) Subunit composition of brain voltage-gated potassium channels determined by hongotoxin-1, a novel peptide derived from Centruroides limbatus venom J Biol Chem 2 73, 2639–2644 Novick, J., Leonard, R.J., King, V.F., Schmalhofer, W., Kaczorowski, G.J & Garcia, M.L (1991) Purification and characterization of two novel peptidyl toxins directed against . Purification, characterization and biosynthesis of parabutoxin 3, a component of Parabuthus transvaalicus venom Isabelle Huys 1 , Karin Dyason 2 , Etienne Waelkens 3 , Fons Verdonck 4 , Johann. C-terminal arginine, was designed as follows (Fig. 3A) . Two overlapping oligonucleotide pairs 5¢-GAGGTCGACATGCGCTGCA AGTCGTCGAAGGAGTGCCTGGTCAAGTGCAAG CAG-3¢,3¢-CTCCAGCTGTACGCGACGTTCAGCAG CTTCCTCACGGACCAGTTCACGTTCGTCCGCTG CCCGGCC-5¢ ,and5 ¢-GCGACGGGCCGGCCGAACG GCAAGTGCATGAACCGGAAGTGCAAGTGCTAC CCGTGAG-3¢,3¢-GGCTTGCCGTTCACGTACTTGGC CTTCACGTTCACGATGGGCACTCCTAG-5¢,respect- ively,. 5¢-GAGGTCGACATGCGCTGCA AGTCGTCGAAGGAGTGCCTGGTCAAGTGCAAG CAG-3¢,3¢-CTCCAGCTGTACGCGACGTTCAGCAG CTTCCTCACGGACCAGTTCACGTTCGTCCGCTG CCCGGCC-5¢ ,and5 ¢-GCGACGGGCCGGCCGAACG GCAAGTGCATGAACCGGAAGTGCAAGTGCTAC CCGTGAG-3¢,3¢-GGCTTGCCGTTCACGTACTTGGC CTTCACGTTCACGATGGGCACTCCTAG-5¢,respect- ively, ranging in