A nonphosphorylated 14-3-3 binding motif on exoenzyme S that is functional in vivo Maria L. Henriksson 1,2 , Matthew S. Francis 2 , Alex Peden 4 , Margareta Aili 2 , Kristina Stefansson 1 , Ruth Palmer 3 , Alastair Aitken 4 and Bengt Hallberg 1 1 Department of Medical Biosciences/Pathology, Umea ˚ University, Sweden; 2 Department of Molecular Biology, Umea ˚ University, Sweden; 3 Umea ˚ Center for Molecular Pathogenesis, Umea ˚ University, Sweden; 4 Membrane Biology Group, Division of Biomedical and Clinical Laboratory Sciences, University of Edinburgh, Scotland 14-3-3 proteins play an important role in a multitude of signalling pathways. The interactions between 14-3-3 and other signalling proteins, such as Raf and KSR (kinase suppressor of Ras), occur in a phospho-specific manner. Recently, a phosphorylation-independent interaction has been reported to occur between 14-3-3 and several proteins, for example 5-phosphatase, p75NTR-associated cell death executor (NADE) and the bacterial toxin Exoenzyme S (ExoS), an ADP-ribosyltransferase from Pseudomonas aeruginosa. In this study we have identified the amino acid residues on ExoS, which are responsible for its specific interaction with 14-3-3. Furthermore, we show that a peptide derived from ExoS, containing the 14-3-3 interaction site, effectively competes out the interaction between ExoS and 14-3-3. In addition, competition with this peptide blocks ExoS modification of Ras in our Ras modification assay. We show that the ExoS protein interacts with all isoforms of the 14-3-3 family tested. Moreover, in vivo an ExoS protein lacking the 14-3-3 binding site has a reduced capacity to ADP ribosylate cytoplasmic proteins, e.g. Ras, and shows a reduced capacity to change the morphology of infected cells. Keywords: ADP-ribosylation; coenzyme binding site; cyto- toxicity; NAD-dependent; peptide inhibitor. Members of the 14-3-3 family function as adaptor or scaffold proteins and appear to interconnect different proteins involved in signal transduction, cell cycle regulation and apoptosis (reviewed in [1–3]). Studies in other model systems have also shown that 14-3-3 proteins are essential for Drosophila melanogaster and yeast cell proliferation and survival [4–7]. 14-3-3 proteins have been shown to interact with phosphoserine-containing peptides, within a defined consensus-binding motif. Some well-described 14-3-3 bind- ing partners include the protein kinases Raf-1 [8], kinase suppressor of Ras-1 [9], Ask1 [10], mitogen-activated protein kinase/extracellular signal-regulated kinase kinase [11], Bcr [12] and protein kinase C [13]. In addition, 14-3-3 proteins also interact in a phospho-specific manner with the pro-apoptotic protein Bad [14] and the transcription factor Forkhead [15]. Analysis of the crystal structural of 14-3-3 proteins has revealed that all isoforms of 14-3-3 exist as a dimer, which is made up of a conserved concave surface, a so-called amphipathic groove, and a more variable outer surface in each monomer [16–19]. It has been verified by both mutational analysis and crystal studies that the basic cluster in the amphipathic groove is involved in mediating the interaction of 14-3-3 with the phosphorylated residues in its interaction partners [20,21]. In addition to the defined interaction of 14-3-3 proteins with phosphoserine-containing motifs [22], there are also several reports showing an interaction between 14-3-3 and nonphosphorylated substrates [23–32]. It is presumed that there are structural similarities between the phosphorylated and nonphosphorylated 14-3-3 ligands. The best studied nonphosphorylated ligand for 14-3-3 is R18, an artificial peptide isolated from a phage display library as a 14-3-3 binding sequence, which assumes an extended conformation in the amphipathic groove in a manner similar to that observed for the phosphorylated peptides and interacts with 14-3-3 with high affinity [33]. 14-3-3 has also been shown to interact with Exoenzyme S (ExoS) in an unphosphorylated manner and recently we have shown that 14-3-3 interacts with the C-terminal region of ExoS [27–29]. ExoS is a bi-functional toxin, encoded by the pathogen Pseudomonas aeruginosa. ExoS contains a C-terminal ADP-ribosyltransferase activity, which blocks receptor-stimulated Ras activation through a modification of Ras in vivo [34–36]. It has also been reported to contain an N-terminal Rho GTPase-activating protein (GAP) activity in vitro [37] and in vivo [34]. Since the interaction between ExoS and 14-3-3 has been suggested to be important for the ADP-ribosylation activity of ExoS, and more intriguingly appears to be independent of serine-phosphorylation, we wanted to define the amino acid sequence required for the ExoS interaction with 14-3-3 and its resultant activity both in vitro and in vivo. We have approached these questions by using deletion and substitu- tion analysis of ExoS both in vitro and in vivo. Various Correspondence to B. Hallberg, Department of Medical Biosciences/ Pathology, Umea ˚ University, S-901 87 Umea ˚ ,Sweden. Fax: +46 90 77 14 20, Tel.: +46 90 785 25 23, E-mail: Bengt.Hallberg@medbio.umu.se Abbreviations: ExoS, Exoenzyme S; NADE, p75NTR-Associated cell Death Executor; GAP, GTPase-activating protein; HRP, horseradish peroxidase. (Received 22 March 2002, revised 16 August 2002, accepted 20 August 2002) Eur. J. Biochem. 269, 4921–4929 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03191.x mutant ExoS proteins were tested for their capacity to interact with 14-3-3 and subsequently for their ADP- ribosylation potential using Ras as a substrate both in vitro and in vivo. Here we identify the binding site on ExoS for 14-3-3 interaction and show that it harbours a short amino acid sequence (DALDL) with similarities to the peptide sequence (WLDL) of R18. In addition, we also show that a peptide containing the interaction determinant of ExoS acts as an efficient competitor for both 14-3-3 : ExoS binding and the resulting activation of 14-3-3-dependent ExoS ADP-ribosy- lation activity. We show that the ExoS proteins interact with all isoforms of the 14-3-3 family. Finally, we show that the DALDL sequence is necessary for the ADP-ribosylation activity and the cytotoxic action of ExoS in vivo. MATERIAL AND METHODS Cell cultures, cell lysis HeLa cells were grown in RPMI 1640 supplemented with 10% (v/v) fetal bovine serum and 100 UÆmL )1 penicillin. Following bacterial infection (80 min) cells were washed in ice-cold NaCl/P i and lysed on ice in lysis buffer [1% (v/v) Triton X-100, 100 m M NaCl, 50 m M Tris/HCl pH 7.5, 1m M EDTA supplemented with protease inhibitors (10 lgÆmL )1 aprotinin, pepstatin and leupeptin)]. Lysates were subsequently cleared by centrifugation at 14 000 r.p.m. for 10 min at 4 °C. Lysates were precleared with purified glutathione S-transferase (GST). Lysates were incubated with GST-fusion proteins for 1 h prior to the addition of Glutathione Sepharose (Amersham Pharmacia Biotech) for 30 min. After three washes in lysis buffer, samples were boiled in SDS/PAGE sample buffer. Western analysis, peptide and antibodies Anti-14-3-3b was from Santa Cruz; monoclonal Ras (R02120) was from Transduction Laboratories; anti-phos- pho-Erk, phospho-Akt, pan-Erk were from Cell Signaling Technology; epidermal growth factor (EGF) was from UBI. Immunoblotting was performed according to the manufac- turer’s instructions using secondary antibodies conjugated to horseradish peroxidase (HRP) sheep anti-mouse or rabbit antibodies (Pierce and ECL Plus, Amersham Phar- macia Biotech). A synthetic peptide, purified by reverse- phase HPLC and characterized by MS, corresponding to the putative 14-3-3 binding domain of ExoS (QSGHSQG LLDALDLASKP), was purchased from Agrisera AB (Sweden). Plasmids pGEX-ExoS(SD), was derived from wild-type ExoS (pTS103) [38] as follows. Primers were designed to introduce flanking 5¢-ClaI site (shown in italic type), 5¢-CAGGTCCG GAATCGATGTCAGCGG-3¢, at position 1101, 3¢-NdeI/ NotI restriction sites (shown in italic type) 5¢-CCCCTCGT CTCACCGGTATACCGCCGGCGCGAG-3¢, at position 1251, 5¢-NotI/NheI(5¢–GCTCGCGGCCGCAGCTAGCA AACCGGAACGTTCAGG-3¢), at position 1277, and 3¢-EcoRI (5¢-TACGACGAATTCGGCCAGATCAAG GC-3¢), at position 1359 over the area to be substituted. PCR from wild-type ExoS was carried out using these primers. PCR products were subsequently inserted into a pGEX-2TK-ExoS(88–453) opened with ClaI–EcoRI to produce pGEX-ExoS(SD). pGEX-ExoS(SD)ismutated at amino acid positions 419–423 from SQGLL to MAAAA and deleted from amino acid 424 to 428. The substitution mutants, pGEX-2TK-ExoS(S1), pGEX- 2TK-ExoS(S2) and pGEX-2TK-ExoS(S3), were then con- structed by digesting pGEX-2TK-ExoS(SD)withNdeI/ NheI and insertion of oligomers corresponding to the appropriate amino acid substitutions, as outlined in Fig. 1B. All constructs were sequenced using the DYEnamic.ET terminal cycle sequencing kit (Amersham-Pharmacia). pGEX-2TK-ExoS(88–453), pGEX-2TK-ExoS(400–453), pGEX-2TK-ExoS(366–453), pGEX-2T-14-3-3-zeta and pRSET-Ha-Ras were expressed as described previously [29,39,40]. Competition analysis 14-3-3 (250 n M ) was preincubated for 30 min at 37 °Cwith increasing amounts of peptide, and then transferred into a mixture containing (in a final volume of 20 lL): 0.2 M sodium acetate, pH 6.0 and 500 n M GST–ExoS (366–453). After 1 h at 37 °C the reaction was put on ice and 5 lL Glutathione Sepharose beads were added and tumbled for 1hat4°C. Complexes were washed three times with 1 mL 20 m M Hepes, 120 m M NaCl, 10% glycerol, 0.5% NP-40, 2m M EDTA pH 8.0 and then subjected to SDS/PAGE and immunoblotting. Immunoblotting analysis of the 14-3-3 isoforms pulled down by GST–ExoS mutants HeLa cell lysate (2.4 mg) was incubated with GST-fusion protein (10 lg) for 1 h prior to the addition of Glutathione Sepharose for 30 min After three washes in lysis buffer, samples were boiled in SDS/PAGE sample buffer. Protein samples were loaded onto a single wide lane of an SDS/ polyacrylamide gel. After electrophoresis the separated proteins were transferred onto nitrocellulose membranes at 200 mA constant current for 1 h. The membranes were then blocked for 1 h in 5% skimmed milk in TBS-Tween (20 m M Tris/HCl pH 7.5, 137 m M NaCl, 0.1% Tween). Longitudi- nal strips of the membrane were exposed to a range of 14-3- 3 isoform-specific antisera (diluted in 5% skimmed milk in TBS-Tween, see Table 1) using a Biometra TM slot blot apparatus [41]. After washing the slots separately with TBS- Tween, the nitrocellulose filters were probed with HRP- conjugated goat anti-(rabbit Ig) (Bio-Rad) diluted 1 : 2000 and developed by enhanced chemiluminescence. Construction of arabinose inducible ExoS derivatives and infection of cells To ensure protein stability of ExoS derivatives, mutant alleles were coexpressed with orf1, encoding the cognate nonsecreted chaperone of ExoS [38,42]. In all cases, DNA was amplified by PCR using conditions described previously [43]. pMF366 was constructed from amplified DNA from pTS103 [38] harbouring wild-type orf1, which was cloned into the NcoI/XhoI (shown in italic type) sites of pBAD/ Myc-His under the control of an arabinose inducible 4922 M. L. Henriksson et al. (Eur. J. Biochem. 269) Ó FEBS 2002 promoter using the orf1 specific primers porf1a (forward): 5¢-GCCGCCTCCATGGACTCGGAACACGCC-3¢ and porf1b (reverse): 5¢-TCGCCCGACTCGAGTCAGCGTA GCTCTTC-3¢. Wild-type exoS sequence was cloned into the XhoI/KpnI (shown in italic type) sites of pMF366 to generate the plasmid pMF384, using DNA amplified from pTS103 with the exoS specific primer pair pexoSa (forward): 5¢-CGGAGAAACTCGAGGAGAAGGCAACCATC-3¢, pexoSb (reverse): 5¢-GTCTTTCTGGTACCACCGGTCA GGCCAGA-3¢. pMF419 and pMF420 were obtained by replacing the C-terminal ClaI/KpnI fragment from pMF384 with DNA amplified and restriction enzyme cut with ClaI/ KpnI from pGEX-2TK-ExoS(SD) and pGEX-2TK-ExoS (S3), respectively, using the exoS specific primers, pexoSseq3 (position 973–991; forward): 5¢-AAGTGATGGCGCTTG GTCT-3¢ and pexoSd (reverse): 5¢-ATGCATGGTACCTC AGGCCAGATCAAGGCCGCG-3¢. All constructs were confirmed by sequence analysis. Stable induction of protein expression in strains grown in the presence of 0.02% L (+) arabinose was confirmed by Western analysis as described previously [44], using polyclonal rabbit anti-ExoS [38]. Bacterial infection of cells was performed in the presence of 0.1% L (+)arabinose as described previously [45]. RESULTS Amino acids 420–429 of ExoS are important for interaction with 14-3-3 Numerous observations have revealed that 14-3-3 binds phosphorylated ligands [3]. The binding of 14-3-3 proteins to nonphosphorylated partners is, however, far less defined. As the interaction between ExoS and 14-3-3 has been suggested to be important for the ADP-ribosylation activity of ExoS, and more intriguingly appears to be independent of serine phosphorylation, we decided to define the amino acid sequence required for the ExoS interaction with 14-3-3. To date, the best-studied example of a nonphosphorylated interaction with 14-3-3 is with an artificial peptide, named R18, which was isolated from a phage display library as having high affinity for 14-3-3 proteins. A motif in R18 10 WLDLE 14 , was found in a similar position as the phosphorylated residues in the 14-3-3 binding phosphopep- tides, with negatively charged Asp12 and Glu14 making contacts similar to those of phosphoserine [3]. The hydro- phobic residues in the R18 peptide make contact with the hydrophobic side of the amphipathic groove of 14-3-3, implying that the R18 peptide interacts with 14-3-3 in a manner very similar to phosphorylated ligands [33,46]. In an earlier study we have shown that a C-terminal deletion in which the extreme 26 amino acids of ExoS were removed was unable to bind 14-3-3 (Fig. 1A, lane 4, and see [29]). On further inspection we noted that ExoS contains a DALDL sequence, at amino acid position 424–428, which is similar to the WLDLE of R18 (Table 2). To address the question of whether the DALDL sequence is a determinant of the 14-3-3 : ExoS interaction, Fig. 1. GST–ExoS mutant analysis of interaction with endogenous 14-3-3 proteins. HeLa cells were harvested, and lysates were subjected to pull-down analysis with 5 lg of various GST-fusion proteins. Samples were separated by SDS/PAGE on a 12.5% gel. (A) Upper panel: HeLa cell lysates were subjected to affinity precipitation with a series of GST–ExoS mutants. Lanes correspond to schematic repre- sentations of the constructs illustrated in (B). Lower panel: Commassie blue stained SDS/PAGE, shows purified GST-fusion proteins purified from Escherichia coli used in this study. Lanes correspond to schematic representations of the constructs illustrated in (B). Lane 1 represents 2 lg of whole HeLa cell lysate. 14-3-3 proteins were detected by immunoblotting with anti-14-3-3 antibodies. (B) Schematic diagram detailing the various GST-fusion protein constructs of ExoS used in the present study. Important amino acids for 14-3-3 interactions of ExoS are indicated between amino acids 418 and 429. The region of interest in ExoS and the limited similarity towards other nonphos- phorylated 14-3-3 partners is shown in Table 2. Table 1. Summary of isoform specific 14-3-3 antibodies used. Isoform Antibody Epitope Position Dilution bbT Ac-MDKSELV 1–7 1 : 3000 ff1002 Ac-MDKNELVQKAC 1–10 1 : 3000 ss197 Ac-MEKTELIQKAC 1–10 1 : 3000 rr789 Ac-MERASLIQKAC 1–10 1 : 3000 ee2025 Ac-MDDREDLVYQAKC 1–12 1 : 3000 gg2043 Ac-GDREQLLQRARC 2–12 1 : 3000 cc1006 Ac-VDREQLVQKAC 2–11 1 : 6000 Ó FEBS 2002 Identification of a 14-3-3 binding motif on ExoS (Eur. J. Biochem. 269) 4923 a set of deletion and substitution variants of ExoS were generated for use in protein pull-down experiments (see Fig. 1B). We constructed an ExoS deletion protein depicted in Fig. 1B, named GST–ExoS(SD), as well as three over- lapping substitution mutants between amino acids 419–429 [named GST–ExoS (S1 to S3)] (see Fig. 1B). HeLa cell lysates were precleared with GST–agarose beads prior to incubation with the various GST–ExoS fusion proteins, as indicated. Samples were subsequently washed and separated by SDS/PAGE, followed by immu- noblotting with anti-14-3-3 Igs. As we have previously shown, GST–ExoS(88–453) clearly interacts with 14-3-3, whereas GST–ExoS(88–426) does not (Fig. 1A, compare lanes 3 and 4). Precipitation of 14-3-3 proteins could also be seen with GST–ExoS(S1) and (S2), although less 14-3-3 proteins were precipitated when compared with GST– ExoS(88–453) (Fig. 1, compare lanes 6 and 7 with lane 3). However, fusion proteins GST–ExoS(SD)andGST– ExoS(S3) failed to interact with and precipitate 14-3-3 proteins (Fig. 1A, lane 5 and 8). The E-son peptide blocks the ExoS : 14-3–3 interaction We thus reasoned that 14-3-3 proteins may interact with ExoS through residues within this region. However, the possibility exists that mutation or deletion of ExoS may cause conformational changes elsewhere in ExoS which are responsible for the observed loss of ExoS : 14-3-3 binding activity. To exclude this possibility and to investigate further the interaction between 14-3-3 and ExoS we decided to perform a peptide competition analysis. From our analysis of the binding of 14-3-3 proteins to the ExoS deletion and substitution mutants we synthesized a 18-mer peptide spanning the area of interest from amino acid 415–432 of ExoS (QSGHSQGLLDALDLASKP), which we have denoted ÔE-sonÕ. As controls in our experiments we used the previously published peptide; R18 in our analysis (for details see Table 2 and [47]). In in vitro assays we observed that the E-son peptide was able to competitively block the ExoS : 14-3-3 interaction in a dose-dependent manner (Fig. 2B). In fact, a 10-fold excess of the E-son peptide was sufficient to compete out 90% of the interaction between 14-3-3 and ExoS (Fig. 2B). We also noted that the phage display peptide R18 was able to disrupt the interac- tion between 14-3-3 and ExoS within a similar concentra- tion range (Fig. 2A). These results therefore provide strong evidence that 14-3-3 proteins do indeed interact with ExoS through amino acid residues 415–432, containing the DALDL sequence. E-son blocks modification of Ras by ExoS Having defined the sequences in ExoS required for ExoS : 14-3-3 binding, we next wished to address the question of whether these residues are of importance for ExoS activity. This question can be approached by using an in vitro Ras modification assay, where ADP-ribosylation of Ras by ExoS is reflected by a gel mobility shift of Ras on SDS/PAGE [35]. Incubation of Ha-Ras, 14-3-3, NAD and GST alone does not alter the mobility of Ras proteins (Fig. 3, lane 1). However, when ExoS is also included Ras modification is readily observed by a change in mobility on SDS/PAGE (Fig. 3, lane 2). When either the E-son or the R18 peptide were preincubated with 14-3-3 prior to addition of Ras, NAD and ExoS, no change in Ras shift due to ADP-ribosylation of Ras by ExoS was observed (Fig. 3, lanes 3 and 4 compared with lane 2). Thus, we are able to show that both E-son and R18 are capable of inhibiting ExoS activity efficiently, resulting in an observed inhibition of the modification of Ras in vitro. ExoS interacts with all isoforms of the 14-3-3 family ExoS interacts with 14-3-3 proteins in the C-terminal part and this interaction is necessary for the ADP ribosylation Table 2. Protein interacting with 14-3-3 in a nonphosphorylated man- ner. A literature search for nonphosphorylated 14-3-3 interacting partners reveals five binding partners. References are indicated in brackets after each interacting protein name and putative interaction amino acid residues are marked in bold. E-son (315–432) (this study) QSGHSQGLLDALDLASKP R18 [33] FHCVPRDLSWLDLEANMCLP GPIb-a (593–610) [30] QDLLSTVSIRYSGHSL IP5-Pase(359–371) [24] ELVLRSESEEKVV NADE (81–100) [23] EEMREIRRKLRELQLRNCLR CLIC4 (145–161) [50] LKTLQKLDEYLNSPLPG Fig. 2. E-son disrupts the binding between ExoS and 14-3-3. Recom- binant 14-3-3 (250 n M )wasmixedwiththeindicatedamountofpep- tide for 30 min at 37 °C, prior to incubation for 1 h with 500 n M purified GST–ExoS(366–453), followed by GST-bead precipitation, washing and separation by SDS/PAGE and immunoblotting with anti-14-3-3 antibodies. The R18 peptide (A) and E-son peptide (B) were used as competitor peptides. 4924 M. L. Henriksson et al. (Eur. J. Biochem. 269) Ó FEBS 2002 activity of ExoS (see above and [29]). However we have no indication as to whether ExoS interacts with all, or a subset of the 14-3-3 family members (Table 1). To explore this further we used pull-down assays using different GST–ExoS deletion proteins. In our assay we used the following ExoS constructs: ExoS(88–453) (see above), which harbours the ability to bind 14-3-3 and to ADP-ribosylate endogenous cellular targets both in vivo and in vitro [29]; GST– ExoS(400–453), a construct that we have shown to bind to 14-3-3 proteins but lacks both the GAP and the ADP- ribosylation domains of ExoS [29]. In addition, we have also made use of ExoS(88–426), which lacks the ability to interact with 14-3-3 and shows a dramatically reduced ADP-ribosylation activity both in vivo or in vitro (see above and [29]). All 14-3-3 isoforms appear to be expressed in HeLa cells, although 14-3-3 r and s are not as pronounced as the other isoforms (Fig. 4A). The ExoS(88–453) protein is able to affinity precipitate all 14-3-3 isoforms from HeLa lysates (Fig. 4B), as is the ExoS(400–453) protein, although ExoS(400–453) appears to have a reduced ability to interact with 14-3-3 r (Fig. 4C) and ExoS(88–453) appears to have a reduced ability to interact with 14-3-3 s (Fig. 4B). As expected, GST–ExoS(88–426) does not affinity precipitate 14-3-3 proteins from HeLa whole cell lysates (Fig. 4D). From this analysis we conclude that the full-length ExoS protein does indeed have the capacity to interact with all members of the 14-3-3 family. ExoS mutants lacking the 14-3-3 binding site do not modify Ras in vivo Most importantly we wished to test the significance of the in vitro determined amino acid sequence for the interaction between ExoS and 14-3-3 in a biological system in vivo.We approached this question through the utilization of two different assays. Firstly, we exploited the ADP-ribosylation activity of ExoS towards an important endogenous target – namely the small G-protein Ras – as a readout [35]. Secondly, we employed a cytotoxicity assay, since the ADP- ribosylation activity of ExoS mediates a marked change in cell morphology and has a lethal activity upon translocation into the host cell in vivo [38,48,49]. In our earlier studies we have shown that Ras is modified by ExoS expressed and delivered into the eukaryotic cells by a genetically defined Yersinia pseudotuberculosis strain, devoid of endogenous toxins, and also by several different clinically relevant parental P. aeruginosa strains ([35] and data not shown). Y. pseudotuberculosis strain, YPIII/ pIB251, can express and deliver heterogenous ExoS protein (YPIII/pTS103) with high efficiency, at levels substantially greater than parental P. aeruginosa 388 and PAK (MLH and BH, unpublished results). To reduce the expression and translocation of ExoS from the bacteria to the cell we constructed a Y. pseudotuberculosis strain which expresses and translocates ExoS and various ExoS mutants under the control of an arabinose inducible promoter located on pBAD/Myc-His [44]. Thus, by growing the bacteria in the presence of 0.1% arabinose in the culture media we could induce a reduced expression and translocation of ExoS into eukaryotic cells compared to YPIII/pTS103, to increase the sensitivity of our assay. In this study we measured the Fig. 3. E-son blocks the modification of Ras by ExoS in vitro. Recombinant Ha-Ras (10 l M ) was incubated with 500 n M GST (lane 1), 500 n M GST–ExoS(88–453) fusion proteins (lanes 2–4) together with recombinant 14-3-3 (250 n M )and1.25m M NAD + for 10 min at 37 °C. Samples were separated by SDS/PAGE, followed by immuno- blotting with anti-Ras monoclonal antibody. E-son (100 l M ;lane3)or R18 (100 l M ; lane 4) was preincubated with recombinant 14-3-3 for 30 min at 37 °C prior to addition of NAD + , Ha-Ras and GST-fusion protein. Fig. 4. Pull down of 14-3-3 isoforms with GST–ExoS mutants. HeLa cells were harvested, and lysates were subjected to pull-down analysis with various GST-fusion proteins as indicated. Cell lysates and the eluates from the GST–ExoS pull downs were analysed for the presence of 14-3-3 isoforms by immunoblotting. Eluted protein was subjected to 12% (w/v) SDS/PAGE. The separated proteins were then transferred onto nitrocellulose and immunoblotted with 14-3-3 antisera specific for the seven isoforms (b, f, s, r, e, g and c)usingaBiometra TM slot blot apparatus. A summary of these antisera is shown in Table 1 and [41]. (A) Whole HeLa cell lysate. HeLa cell lysates were subjected to affinity precipitation with (B) GST–ExoS(88–453) (C) GST–ExoS(400–453) (D) GST–ExoS(88–426) and (E) GST-fusion protein. The position of the 30 kDa marker proteins is indicated. Ó FEBS 2002 Identification of a 14-3-3 binding motif on ExoS (Eur. J. Biochem. 269) 4925 modification of Ras in vivo as a reflection of ExoS ADP- ribosyltransferase activity. HeLa cells were infected for 80 min with Y. pseudotuberculosis, which had been induced to express and translocate ExoS, ExoS(SD) and ExoS(S3). After stimulation with EGF for 2 min, cells were harvested and the resultant lysate was separated on SDS/PAGE followed by immunoblotting with anti-Ras, antiphospho- Akt and antiphospho-Erk Igs (Fig. 5A). Stimulation of the uninfected cells with EGF caused the phosphorylation of both Erk and PKB/Akt (Fig. 5A, compare lanes 1 and 2). The expected modification of Ras and its subsequent inability to signal downstream to Erk and Akt was observed in cells infected with bacteria expressing wild-type ExoS but not in stimulated uninfected cells or in mock infected cells (Fig. 5A, compare lane 4 with that of lanes 2 and 3). However, this inhibition of the activation of Ras, Erk and Akt was abrogated when the cells were infected with bacteria producing ExoS mutants unable to interact with 14-3-3, e.g. ExoS(SD) and ExoS(S3) (Fig. 5A, lanes 5 and 6), thus indicating that mutation of the 14-3-3 binding motif in ExoS results in an inactive ExoS molecule in vivo. Cell morphology is not affected by an ExoS mutant lacking the 14-3-3 binding site It has previously been demonstrated that delivery of ExoS into HeLa cells results in a change in cell morphology, concommitent with a disruption of actin microfilaments, which is followed by cell death, the latter also being correlated to the ADP-ribosylation activity of ExoS [35,38,49]. Here we wished to address whether infection of HeLa cells with Y. pseudotuberculosis strain, YPIII/pIB251, pregrown in 0.1% arabinose to induce expression of ExoS mutants lacking the 14-3-3 binding site, could induce a morphological change of HeLa cells. To achieve this we infected cells with bacteria, which translocated either the wild-type ExoS, ExoS(SD), or ExoS(S3). The extent of cytotoxicity as visualized by a distinct change in cell morphology in vivo was examined in HeLa cells taken at 80 min postinfection. As control, the trans- location efficiencies of ExoS, ExoS(SD) and ExoS(S3) proteins were compared by immunoblot analysis to ensure that the effects observed were not caused by decreased translocation of protein (Fig. 5C). As expected, intracellular wild-type ExoS induced a rapid cytotoxic response toward infected HeLa cells, consistent Fig. 5. Morphological and protein effects of ExoS infection on cells in vivo and on EGF receptor signalling components downstream of Ras. (A) Upper panel: phosphorylation of PKB/Akt and Erk was examined in nonstimulated (–) (lane 1) and EGF stimulated (+) (lanes 2–6) cells. Cells were infected for 80 min as follows: uninfected (lanes 1 and 2), infected with Y. pseudotuberculosis, YPIII(pIB251) alone (mock infected, lane 3), or YPIII(pMF384), expressing ExoS wild-type (lane 4), YPIII(pMF419), expressing ExoS(SD) (lane 5) or YPIII(pMF420), expressing ExoS(S3) (lane 6). Whole cell lysates were subjected to SDS/ PAGE followed by immunoblotting with anti-phosphospecific Erk (a-P-Erk) and PKB/Akt (a-P-PKB/Akt) Igs, as indicated. Middle panel: the membrane was stripped and reprobed with anti-pan Erk antibodies, as indicated. Lower panel: the same membrane was im- munoblotted with anti-Ras antibodies. (B) Morphological changes caused by different variants of ExoS preinduced in 0.1% arabinose. HeLa cells, also in the presence of 0.1% arabinose, were infected with YPIII(pMF384), expressing wild-type ExoS (3), YPIII(pMF419), expressing ExoS(SD) (4), or YPIII(pMF420), expressing ExoS(S3) (5). As controls we used uninfected HeLa cells (1) or HeLa cells infected with YPIII(pIB251) (2) for mock infection. (C) Translocation of ExoS variants by Y. pseudotuberculosis into HeLa cells. Bacteria were pre- induced with 0.1% arabinose, allowed to infect HeLa cells for 80 min prior to cold washing of the cells and harvest. ExoS was immuno- precipitated from cell lysates with Sepharose G-coupled ExoS anti- bodies, and analysed by immunoblotting using ExoS antibodies. YPIII(pMF384), expressing ExoS (lane 4), YPIII(pMF419), expres- sing ExoS(SD) (lane 5), or YPIII(pMF420), expressing ExoS(S3) (lane 6). Twenty lg whole cell lysate from ExoS(SD) infected cells (lane 1), uninfected HeLa cells (lane 2) or HeLa cells infected with YPIII(pIB251) (lane 3) for mock infection were used as controls. 4926 M. L. Henriksson et al. (Eur. J. Biochem. 269) Ó FEBS 2002 with published reports (Fig. 5B(3) and [38,48]). However, HeLa cells infected with the bacteria expressing the ExoS mutants: ExoS(SD), ExoS(S3), or mock infected, were essentially indistinguishable, indicating no evidence of a cytotoxic response (Fig. 5B, compare 3 with 1, 2, 4 and 5). Using our new arabinose inducible strains, which translo- cate a more physiological level of ExoS, we observe no GAP domain induced cytotoxicity, however, a cytotoxic effect can be seen when the ADP-ribosylation domain is complete. We have also observed that there is no decrease or increase in the Rho GAP activity between wild-type and SD of ExoS constructs in vitro (M Aili and B Hallberg, data not shown). In summary, the lack of Ras modification and inhibition together with the loss of cytotoxic effect in ExoS mutant for the 14-3-3 binding motif clearly points to an important function for the 14-3-3:ExoS interaction in vivo. DISCUSSION In this study we have focused our attention on defining the amino acids on ExoS important for its interaction with 14-3-3 both in vitro and in vivo. This is an important consideration since the interactions between 14-3-3 and many cellular proteins have been described to occur in a phospho-specific manner [21,25]. However, the interaction between 14-3-3 and ExoS has been reported to occur in a phosphorylation-independent manner. We have shown that the ExoS sequence between amino acid 424 and 428 (DALDL) is critical for the interaction between 14-3-3 and ExoS. Furthermore, sequences flanking this DALDL sequence also contribute to binding of 14-3-3 proteins. Further evidence for a specific phosphorylation–independent interaction between 14-3-3 and ExoS is provided by competi- tion experiments utilizing the E-son peptide, corresponding to the amino acids 415–432 of ExoS. Firstly, E-son efficiently inhibits the formation of the 14-3-3:ExoS complex, with similar kinetics as seen earlier with the R18 peptide [20]. It seems that the interaction between 14-3-3 and ExoS is of a specific and tight-binding nature. Secondly, and more importantly, E-son is an efficient competitor for the 14-3-3 dependent ExoS ADP-ribosylation activity, as measured by modification of the small GTPase protein Ras in vitro. Considering the large number of 14-3-3 isoforms together with the large number of putative target proteins for 14-3-3 within the cell, we asked which of the 14-3-3 isoforms were able to interact with ExoS. It has been suggested that homo-/ hetero-dimer combinations of 14-3-3 may confer specificity, which would mean that there are differences in specificity towards the 14-3-3 partners [39]. It is also possible that specific interactions occur as a result of particular subcellular localizations or transcriptional regulation of isoforms rather than of differences in their ability to bind to a specific target. From our analysis we have strong evidence that full-length ExoS(88–453) has the ability interact with all members of the 14-3-3 family, although there may be a reduction in the affinity of ExoS for 14-3-3 s (Fig. 4). Interesting, the ExoS(400–453) construct, which lacks a GAP domain, did not appear to interact with 14–3-3 r, in contrast with ExoS(88–453). This discrepancy may be worthy of future investigation but has not been approached here. Comparisons of amino acid sequences in the published nonphosphorylated interaction partners for 14-3-3 are shown in Table 2. The identified 14-3-3 binding sequence in ExoS, DALDL, shows similarities to the artificial unphosphorylated peptide (R18) isolated from a phage display library, which contains the sequence WLDLE (10– 14), and has been suggested to bind to the conserved amphipathic groove of 14-3-3 [33]. It has been proposed that negatively charged amino acids, such as glutamic and aspartic acid residues are able to mimic a phosphorylated serine motif of Raf-1, which would perhaps explain the binding of 14-3-3 proteins to these motifs [33]. Furthermore, it has been proposed that the motif RSESEE of the 43 kDa inositol polyphosphate 5-phosphatase binds 14-3-3 proteins due to the appearance of multiple negatively charged amino acids (Table 2 and [24]). Another 14-3-3 binding protein is GPIb-a, which contains a reported interaction domain [30]. This domain harbours the motif, QDLLSTVS, which shows a weak resemblance to ExoS and R18. A motif that weakly resembles this (ELQLRN) can be found at residues 90–112 of the p75NTR-associated cell death executor (NADE), within the domain, which has recently been reported to interact with 14-3-3 [23]. CLIC4, an ion channel protein, also binds 14-3-3 proteins and harbours a sequence which resembles a negatively charged motif, DEYLN, at residues 152–156 [50]. From this comparison of 14-3-3 nonphosphorylated motif sequences it is not clear which amino acids within the motif are important for the interaction between 14-3-3 and its nonphosphorylated ligand. However, it is clear that a more thorough dissection is needed for the hypothesis that negatively charged amino acids can substitute phosphoryl- ated serine/threonine residues. Numerous reports have clarified the importance of 14-3-3 proteins as a factor that activates ExoS [27–29,35]. It has been proposed that the dimeric structure of the 14-3-3 proteins allows it to bind two ligands simultaneously, as the ligand-binding grooves run in opposite directions in each monomer of the molecule [3,21,51]. It is possible that the interaction between 14-3-3 and ExoS creates a conformational change in the structure of ExoS, thereby changing ExoS from nonactive protein to an active protein with ADP-ribosylation activity. Thus 14-3-3 proteins may have two functions, firstly as an activator of ExoS and secondly to localize ExoS to a specific domain within the cell. Most importantly in this study we wished to test the significance of the in vitro determined amino acid sequence for the interaction between ExoS and 14-3-3 in vivo.We have shown earlier that Ras (and its deactivation of downstream targets such as Erk and PKB/Akt), and many other small GTPases are modified by ExoS, expressed and translocated into the eukaryotic cells by a genetically defined Y. pseudotuberculosis strain and also by several different Pseudomonas aeruginosa strains [34,35]. The Yer- sinia strain expresses and translocates ExoS protein with high efficiency, at levels greater than that observed in strains such as P. aeruginosa 388 and PAK. For this reason we have engineered a Yersinia strain to express wild-type ExoS and two different mutants of ExoS under the control of an arabinose-inducible promoter so that considerably lower levels of ExoS proteins were translocated into infected cells. We observed the expected phosphorylation of both PKB/ Akt and of Erk 1/2 after stimulation by EGF in HeLa cells. As reported previously, infection of HeLa cells for 80 min with bacteria expressing the wild-type ExoS caused the ADP-ribosylation of Ras and inhibited the EGF mediated Ó FEBS 2002 Identification of a 14-3-3 binding motif on ExoS (Eur. J. Biochem. 269) 4927 phosphorylation of both Erk and PKB/Akt. This effect was not seen upon infection with bacteria expressing the ExoS S3 constructs where the DALDL sequence has been mutated or with the substitution/deletion ExoS(SD). These results suggest that an ExoS construct lacking the DALDL sequence, which we suggest to be the binding motif in ExoS for 14-3-3, does not abrogate the activation of Ras, Erk or PKB/Akt upon stimulation with EGF and thus is nonfunc- tional in vivo. In addition, no modification of endogenous Ras can be observed if 14-3-3 has lost its ability to interact with ExoS, as is the case with ExoS(SD). ExoS is known to cause infected cells to round up and detach from the underlying surface, which correlates with disruption of the actin microfilament structure within the cell [38,48]. We observed that an ExoS protein lacking the residues important for 14-3-3 binding motif is unable to elicit the changes in cell morphology routinely observed with wild-type ExoS. Thus, the 14-3-3 binding motif of ExoS ) DALDL ) appears to be necessary for both the ADP-ribosylation activity and the cytotoxic action of ExoS in vivo. In this report we have firstly identified the residues on ExoS responsible for its specific interaction with 14-3-3, both in vitro and in vivo. Secondly, we have shown that an amino acid peptide derived from ExoS, containing the important 14-3-3 interaction site, effectively competes out the interaction between ExoS and 14-3-3. Thirdly, compe- tition with this peptide blocks ExoS modification of Ras in our in vitro Ras modification assay. Fourthly, we show that the full-length ExoS proteins interact with all isoforms of the 14-3-3 family. Finally, in vivo an ExoS protein lacking the 14-3-3 binding site is unable to ADP ribosylate cytoplas- matic proteins, e.g. Ras, and is impaired in its capacity to change the morphology of infected cells. ACKNOWLEDGEMENTS Financial support for this work was from the MRC, UK (A. A), the Wellcome trust (A. A), Swedish Cancer Society, Riksfo ¨ rbundet Cystisk Fibros Forskningsfond, Sven Jerring foundation, Kungliga Vetenskap- sakademin, Elsa and Folke Sahlbergs minnesfond, and the Swedish Natural Science Council. REFERENCES 1. Aitken, A. (1995) 14-3-3 proteins on the MAP. Trends Biochem. Sci. 20, 95–97. 2. Aitken, A., Jones, D., Soneji, Y. & Howell, S. (1995) 14-3-3 pro- teins: biological function and domain structure, Biochem. Soc. Trans. 23, 605–611. 3. Fu, H., Subramanian, R.R. & Masters, S.C. (2000) 14-3-3 pro- teins: structure, function, and regulation. Annu. Rev. Pharmacol Toxicol. 40, 617–647. 4. Su, T.T., Parry, D.H., Donahoe, B., Chien, C.T., O’Farrell, P.H. & Purdy, A. (2001) Cell cycle roles for two 14-3-3 proteins during Drosophila development. J. Cell Sci. 114, 3445–3454. 5. Broadie, K., Rushton, E., Skoulakis, E.M. & Davis, R.L. (1997) Leonardo, a Drosophila 14-3-3 protein involved in learning, regu- lates presynaptic function. Neuron 19, 391–402. 6. Ford, J.C., al-Khodairy, F., Fotou, E., Sheldrick, K.S., Griffiths, D.J. & Carr, A.M. (1994) 14-3-3 protein homologs required for the DNA damage checkpoint in fission yeast. Science 265, 533–535. 7. van Heusden, G.P., Griffiths, D.J., Ford, J.C., Chin, A.W.T.F., Schrader, P.A., Carr, A.M. & Steensma, H.Y. (1995) The 14-3-3 proteins encoded by the BMH1 and BMH2 genes are essential in the yeast Saccharomyces cerevisiae and can be replaced by a plant homologue. Eur. J. Biochem. 229, 45–53. 8. Fantl, W.J., Muslin, A.J., Kikuchi, A., Martin, J.A., MacNicol, A.M., Gross, R.W. & Williams, L.T. (1994) Activation of Raf-1 by 14-3-3 proteins. Nature 371, 612–614. 9. Xing, H., Kornfeld, K. & Muslin, A.J. (1997) The protein kinase KSR interacts with 14-3-3 protein and Raf. Curr. Biol. 7, 294–300. 10. Zhang, L., Chen, J. & Fu, H. (1999) Suppression of apoptosis signal-regulating kinase 1-induced cell death by 14-3-3 proteins. Proc. Natl Acad. Sci. USA 96, 8511–8515. 11. Fanger, G.R., Widmann, C., Porter, A.C., Sather, S., Johnson, G.L. & Vaillancourt, R.R. (1998) 14-3-3 proteins interact with specific MEK kinases. J. Biol. Chem. 273, 3476–3483. 12. Reuther, G.W., Fu, H., Cripe, L.D., Collier, R.J. & Pendergast, A.M. (1994) Association of the protein kinases c-Bcr and Bcr-Abl with proteins of the 14-3-3 family. Science 266, 129–133. 13. Hausser, A., Storz, P., Link, G., Stoll, H., Liu, Y.C., Altman, A., Pfizenmaier, K. & Johannes, F.J. (1999) Protein kinase C mu is negatively regulated by 14-3-3 signal transduction proteins. J. Biol. Chem. 274, 9258–9264. 14. Zha, J., Harada, H., Yang, E., Jockel, J. & Korsmeyer, S.J. (1996) Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X (L). Cell 87, 619–628. 15. Brunet, A., Bonni, A., Zigmond, M.J., Lin, M.Z., Juo, P., Hu, L.S., Anderson, M.J., Arden, K.C., Blenis, J. & Greenberg, M.E. (1999) Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96, 857–868. 16. Liu, D., Bienkowska, J., Petosa, C., Collier, R.J., Fu, H. & Liddington, R. (1995) Crystal structure of the zeta isoform of the 14-3-3 protein. Nature 376, 191–194. 17. Xiao, B., Smerdon, S.J., Jones, D.H., Dodson, G.G., Soneji, Y., Aitken, A. & Gamblin, S.J. (1995) Structure of a 14-3-3 protein and implications for coordination of multiple signalling pathways. Nature 376, 188–191. 18. Wu,K.,Lu,G.,Sehnke,P.&Ferl,R.J.(1997)Theheterologous interactions among plant 14-3-3 proteins and identification of regions that are important for dimerization. Arch. Biochem. Bio- phys. 339,2–8. 19. Jones,D.H.,Martin,H.,Madrazo,J.,Robinson,K.A.,Nielsen, P.,Roseboom,P.H.,Patel,Y.,Howell,S.A.&Aitken,A.(1995) Expression and structural analysis of 14-3-3 proteins. J. Mol. Biol. 245, 375–384. 20. Wang, H., Zhang, L., Liddington, R. & Fu, H. (1998) Mutations in the hydrophobic surface of an amphipathic groove of 14-3-3zeta disrupt its interaction with Raf-1 kinase. J. Biol. Chem. 273, 16297–16304. 21. Yaffe, M.B., Rittinger, K., Volinia, S., Caron, P.R., Aitken, A., Leffers, H., Gamblin, S.J., Smerdon, S.J. & Cantley, L.C. (1997) The structural basis for 14-3-3: phosphopeptide binding specifi- city. Cell. 91, 961–971. 22. Tzivion, G. & Avruch, J. (2002) 14-3-3 proteins: active cofactors in cellular regulation by serine/threonine phosphorylation. J. Biol. Chem. 277, 3061–3064. 23. Kimura, M.T., Irie, S., Shoji-Hoshino, S., Mukai, J., Nadano, D., Oshimura, M. & Sato, T.A. (2001) 14-3-3 is involved in p75 neurotrophin receptor-mediated signal transduction. J. Biol. Chem. 276, 17291–17300. 24. Campbell, J.K., Gurung, R., Romero, S., Speed, C.J., Andrews, R.K., Berndt, M.C. & Mitchell, C.A. (1997) Activation of the 43 kDa inositol polyphosphate 5-phosphatase by 14-3-3zeta. Bio- chemistry 36, 15363–15370. 25. Muslin, A.J. & Xing, H. (2000) 14-3-3 proteins: regulation of subcellular localization by molecular interference. Cell Signal. 12, 703–709. 4928 M. L. Henriksson et al. (Eur. J. Biochem. 269) Ó FEBS 2002 26. Seimiya, H., Sawada, H., Muramatsu, Y., Shimizu, M., Ohko, K., Yamane, K. & Tsuruo, T. (2000) Involvement of 14-3-3 proteins in nuclear localization of telomerase. EMBO J. 19, 2652–2661. 27. Masters,S.C.,Pederson,K.J.,Zhang,L.,Barbieri,J.T.&Fu,H. (1999) Interaction of 14-3-3 with a nonphosphorylated protein ligand, exoenzyme S of Pseudomonas aeruginosa. Biochemistry 38, 5216–5221. 28. Fu, H., Coburn, J. & Collier, R.J. (1993) The eukaryotic host factor that activates exoenzyme S of Pseudomonas aeruginosa is a member of the 14-3-3 protein family. Proc. Natl. Acad. Sci. USA 90, 2320–2324. 29. Henriksson, M.L., Troller, U. & Hallberg, B. (2000) 14-3-3 pro- teins are required for the inhibition of Ras by exoenzyme S. Bio- chem. J. 349, 697–701. 30. Gu, M.&., X. (1998) A novel ligand-binding site in the zeta-form 14-3-3 protein recognizing the platelet glycoprotein Ibalpha and distinct from the c-Raf-binding site. J. Biol. Chem. 273, 33465– 33471. 31. Calverley, D.C., Kavanagh, T.J. & Roth, G.J. (1998) Human signaling protein 14-3-3zeta interacts with platelet glycoprotein Ib subunits Ibalpha and Ibbeta. Blood 91, 1295–1303. 32. Andrews, R.K., Harris, S.J., McNally, T. & Berndt, M.C. (1998) Binding of purified 14-3-3 zeta signaling protein to discrete amino acid sequences within the cytoplasmic domain of the platelet membrane glycoprotein Ib-IX-V complex. Biochemistry 37, 638– 647. 33. Petosa, C., Masters, S.C., Bankston, L.A., Pohl, J., Wang, B., Fu, H. & Liddington, R.C. (1998) 14-3-3zeta binds a phos- phorylated Raf peptide and an unphosphorylated peptide via its conserved amphipathic groove. J. Biol. Chem. 273, 16305– 16310. 34. Henriksson, M.L., Sundin, C., Jansson, A.L., Forsberg, A., Palmer, R.H. & Hallberg, B. (2002) Exosenzyme S show selective ADP-ribosylation and GAP activities towards small GTPases in vivo. Biochem. J.,inpress. 35. Henriksson, M.L., Rosqvist, R., Telepnev, M., Wolf-Watz, H. & Hallberg, B. (2000) Ras effector pathway activation by epidermal growthfactorisinhibitedinvivobyexoenzymeSADP-ribosy- lation of Ras. Biochem. J. 347, 217–222. 36. McGuffie, E.M., Frank, D.W., Vincent, T.S. & Olson, J.C. (1998) Modification of Ras in eukaryotic cells by Pseudomonas aerugi- nosa exoenzyme S. Infect Immun. 66, 2607–2613. 37. Goehring, U.M., Schmidt, G., Pederson, K.J., Aktories, K. & Barbieri, J.T. (1999) The N-terminal domain of Pseudomonas aeruginosa exoenzyme S is a GTPase- activating protein for Rho GTPases. J. Biol. Chem. 274, 36369–36372. 38. Frithz-Lindsten, E.Y., Rosqvist, R. & Forsberg, A. (1997) Intra- cellular targeting of exoenzyme S of Pseudomonas aeruginosa via type III-dependent translocation induces phagocytosis resistance, cytotoxicity and disruption of actin microfilaments. Mol. Micro- biol. 25, 1125–1139. 39. Dubois, T., Rommel, C., Howell, S., Steinhussen, U., Soneji, Y., Morrice, N., Moelling, K. & Aitken, A. (1997) 14-3-3 is phos- phorylated by casein kinase I on residue 233. Phosphorylation at this site in vivo regulates Raf/14-3-3 interaction. J. Biol. Chem. 272, 28882–28888. 40. Rodriguez-Viciana, P., Warne, P.H., Khwaja, A., Marte, B.M., Pappin,D.,Das,P.,Waterfield,M.D.,Ridley,A.&Downward,J. (1997) Role of phosphoinositide 3-OH kinase in cell transforma- tion and control of the actin cytoskeleton by Ras. Cell 89, 457– 467. 41. Wiltfang, J., Otto, M., Baxter, H.C., Bodemer, M., Steinacker, P., Bahn, E., Zerr, I., Kornhuber, J., Kretzschmar, H.A., Poser, S., Ruther, E. & Aitken, A. (1999) Isoform pattern of 14-3-3 proteins in the cerebrospinal fluid of patients with Creutzfeldt-Jakob dis- ease. J. Neurochem. 73, 2485–2490. 42. Yahr, T.L., Goranson, J. & Frank, D.W. (1996) Exoenzyme S of Pseudomonas aeruginosa is secreted by a type III pathway. Mol. Microbiol. 22, 991–1003. 43. Francis, M.S. & Wolf-Watz, H. (1998) YopD of Yersinia pseudo- tuberculosis is translocated into the cytosol of HeLa epithelial cells: evidence of a structural domain necessary for translocation. Mol. Microbiol. 29, 799–813. 44. Francis, M.S., Aili, M., Wiklund, M.L. & Wolf-Watz, H. (2000) A study of the YopD–lcrH interaction from Yersinia pseudotuber- culosis reveals a role for hydrophobic residues within the amphi- pathic domain of YopD. Mol. Microbiol. 38, 85–102. 45. Francis, M.S., Lloyd, S.A. & Wolf-Watz, H. (2001) The type III secretion chaperone LcrH co-operates with YopD to establish a negative, regulatory loop for control of Yop synthesis in Yersinia pseudotuberculosis. Mol. Microbiol. 42, 1075–1093. 46. Masters, S.C. & Fu, H. (2001) 14-3-3 proteins mediate an essential anti-apoptotic signal. J. Biol. Chem. 276, 45193–45200. 47. Muslin, A.J., Tanner, J.W., Allen, P.M. & Shaw, A.S. (1996) Interaction of 14-3-3 with signaling proteins is mediated by the recognition of phosphoserine. Cell 84, 889–897. 48. Sundin, C., Henriksson, M.L., Hallberg, B., Forsberg, A. & Frithz-Lindsten, E. (2001) Exoenzyme T of Pseudomonas aerugi- nosa elicits cytotoxicity without interfering with Ras signal trans- duction. Cell. Microbiol. 3, 237–246. 49. Kaufman,M.R.,Jia,J.,Zeng,L.,Ha,U.,Chow,M.&Jin,S. (2000) Pseudomonas aeruginosa mediated apoptosis requires the ADP-ribosylating activity of exoS. Microbiology 146, 2531–2541. 50. Suginta, W., Karoulias, N., Aitken, A. & Ashley, R.H. (2001) Chloride intracellular channel protein CLIC4 (p64H1) binds directly to brain dynamin I in a complex containing actin, tubulin and 14-3-3 isoforms. Biochem. J. 359, 55–64. 51. Rittinger, K., Budman, J., Xu, J., Volinia, S., Cantley, L.C., Smerdon, S.J., Gamblin, S.J. & Yaffe, M.B. (1999) Structural analysis of 14-3-3 phosphopeptide complexes identifies a dual role for the nuclear export signal of 14-3-3 in ligand binding. Mol. Cell 4, 153–166. Ó FEBS 2002 Identification of a 14-3-3 binding motif on ExoS (Eur. J. Biochem. 269) 4929 . eukaryotic cells by a genetically defined Y. pseudotuberculosis strain and also by several different Pseudomonas aeruginosa strains [34,35]. The Yer- sinia strain expresses and translocates ExoS. A nonphosphorylated 14-3-3 binding motif on exoenzyme S that is functional in vivo Maria L. Henriksson 1,2 , Matthew S. Francis 2 , Alex Peden 4 , Margareta Aili 2 , Kristina Stefansson 1 , Ruth. factor Forkhead [15]. Analysis of the crystal structural of 14-3-3 proteins has revealed that all isoforms of 14-3-3 exist as a dimer, which is made up of a conserved concave surface, a so-called amphipathic