Irregular dimerization of guanylate cyclase-activating protein 1 mutants causes loss of target activation Ji-Young Hwang 1, *, Ramona Schlesinger 2 and Karl-Wilhelm Koch 1 1 Institut fu ¨ r Biologische Informationsverarbeitung 1 and 2 2, Forschungszentrum Ju ¨ lich, Germany Guanylate cyclase-activating proteins (GCAPs) are neur- onal calcium sensors that activate membrane bound guanylate cyclases (EC 4.6.1.2.) of vertebrate photoreceptor cells when cytoplasmic C a 2+ decreases during illumination. GCAPs contain f our EF-hand Ca 2+ -binding motifs, but the first EF-hand is nonfunctional. It was concluded that for GCAP-2, the loss of Ca 2+ -binding ability of EF-hand 1 resulted in a region that is crucial for targeting guanylate cyclase [Ermilov, A.N., Olshevskaya, E.V. & Dizhoor, A.M. (2001) J. Biol. Chem. 276, 48143–48148]. In this study we tested the consequences of mutations in EF-hand 1 of GCAP-1 w ith respect to Ca 2+ binding, C a 2+ -induced con- formational c hanges and target activation. When the non- functional first EF-hand in GCAP-1 is replaced by a functional EF-hand the chimeric mutant CaM–GCAP-1 bound four Ca 2+ and showed similar Ca 2+ -dependent changes i n t ryptophan fluorescence as the wild -type. CaM– GCAP-1 neither activated nor interacted with guanylate cyclase. Size exclusion c hromatography revealed that the mutant tended to form inactive dimers instead of active monomers like the wild-type. Critical amino acids in EF- hand 1 of GCAP-1 are cysteine at position 29 and proline at position 30, as changing these to glycine was sufficient to cause l oss of t arget activation w ithout a l oss of Ca 2+ - induced conformational c hanges. The latter mutation also promoted dimerization of the protein. Our results show that EF-hand 1 in wild-type GCAP-1 is critical for providing the correct conformation for target activation. Keywords: GCAP; guanylate cyclase; neuronal Ca 2+ sensor; phototransduction. Light triggers the activation of a G-protein coupled cascade in photoreceptor cells that ultimately leads to the hydrolysis of 3¢,5¢-cyclic GMP (cGMP) [1,2]. Cyclic nucleotide-gated (CNG) channels in the plasma membrane are kept open by cGMP in the dark and close upon light-induced cGMP hydrolysis. CNG channels are permeable for Ca 2+ and provide the main entrance route for Ca 2+ in photoreceptor cell outer segments [3]. Extrusion of Ca 2+ is catalysed by a Na + /Ca 2+ ,K + -exchanger. Thus the cytoplasmic [Ca 2+ ]in the dark is balanced by these t wo transport mechanisms to around 700 n M . Closure of CNG channels prevents Ca 2+ from entering the outer segment; however, by the continous operation of the e xchanger cytoplasmic [Ca 2+ ]decreases to < 100 n M [1–3]. Changes in c ytoplasmic [Ca 2+ ]are detected by Ca 2+ -binding proteins such as calmodulin, recoverin and the guanylate cyclase-activating proteins (GCAPs), which in turn regulate their targets in a Ca 2+ - dependent manner [4–6]. GCAPs serve a key function in rod and cone cells as they activate two forms of a membrane-bound rod outer segment guanylate cyclase (ROS-GC), ROS-GC1 and ROS-GC2 (a lso n amed ret- GC1, retGC2 and GC-E, GC-F) at low cyto plasmic [Ca 2+ ] and thereby participate in one of several negative feedback loops that restore the dark state of the cell and help to adjust the cell’s light sensitivity [6,7]. GCAPs belong to a group of proteins named neuronal Ca 2+ sensor (NCS) proteins which are mainly expressed in the nervous system [8,9]. Properties of GCAPs have been intensively i nvestigated in recent y ears and the main focus wasonGCAP-1andGCAP-2[4–6].Commonfeaturesof these proteins are four EF-hand Ca 2+ -binding sites, but only EF-hands 2,3 and 4 are functional. GCAPs are myristoylated at the N-terminus, but they do not undergo a Ca 2+ –myristoyl switch as do other NCS proteins such as recoverin and hippocalcin [10,11]. However, they change their conformation in response to b inding of Ca 2+ . Conformational t ransition in GCAPs has been investigated by different methods s uch as site-directed mutagenesis, gel shift assays, tryptophan fluorescence, CD spectroscopy, limited prot eolysis and thiol reactivity o f cysteines [11–18]. Although GCAP-1 and GCAP-2 share some properties, they also differ in several aspects. For example, GCAP-1 and GCAP-2 regulate guanylate cyclase with different Ca 2+ Correspondence to K W. Koch, Institut fu ¨ r Biologische Informa- tionsverarbeitung 1, Forschungszentrum Ju ¨ lich, D-52425 Ju ¨ lich, Germany. Fax: +49 2461 614216, Tel.: +49 2461 61 3255, E-mail: k.w.koch@fz-juelich.de Abbreviations:cGMP,3¢,5¢-cyclic guanosine monophosphate; CNG channel, cyclic nucleotide-gated channel; GCAP, guanylate cyclase- activating protein; CaM–GCAP-1 and CPG–GCAP-1, mutants of GCAP-1; DTT, dithiothreitol; dibromo-BAPTA, 1,2-bis [2-bis(o- amino-5-bromophenoxy]ethane-N,N,N¢,N¢-tetraacetic acid; GC, guanylate cyclase; NCS, neuronal Ca 2+ sensor proteins; ROS, rod outer segments; ROS-GC, rod outer segment guanylate cyclase; Rh, rhodopsin; SEC, size exclusion chromatography. Enzymes: guanylate cyclases (EC 4.6.1.2.). *Present address: Genetic s & Molecular Biology Branch Nationa l Human Genome Research Institute (NIH), Bethesda, MD 20892-4442, USA. (Received 24 June 2004, revised 26 J uly 2004, a ccepted 3 August 2004) Eur. J. Biochem. 271, 3785–3793 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04320.x sensitivities and the myristoyl group has a strong impact on regulatory properties of GCAP-1, but almost no effect on GCAP-2 [19]. Further, reversible dimerization as a function of Ca 2+ was demonstrated for GCAP-2 and it was proposed that dimer formation in the absence of Ca 2+ is one mechanistic s tep in the activation of guanylate c yclase [20,21]. In c ontrast, G CAP-1 c an form dimers irrespective of the Ca 2+ concentration, but only the GCAP-1 monomer is active, whereas the dimer is not [17]. Sites in G CAP-1 a nd GCAP-2 tha t int eract with ROS- GC1 h ave been mapped by testing chimeric GCAP mutants, single point mutations in GCAPs, and by the use of peptide libraries in competition assays [13,21–25]. Thereby several distant regions were identified that parti- cipate in the activation or inhibition of ROS-GC1. The N-terminus seems to have a critical function in both GCAPs and it was proposed that EF-hand 1 in GCAP-2 has lost the ability to bind Ca 2+ in order to target to guanylate cyclase [21]. A similar function was also discussed for EF-hand 1 in GCAP-1, but was not tested experimentally. Furthermore, an amino acid sequence comparison of the first (i.e. nonfunctional) EF-hand in NCS proteins with the func- tional EF-hand in the prototypical C a 2+ -binding protein calmodulin unveils differences of hypothetical importance. In the present report we investigated whether manipulations in the r egion of EF- hand 1 o f GCAP-1 can change its Ca 2+ -dependent conformational transitions and its regula- tory features. Experimental procedures Construction of mutants CPG–GCAP-1 and CaM–GCAP-1 To create the mutants of CPG–GCAP-1 the amino acids cysteine at position 29 and proline a t position 30 in EF-1 of GCAP-1 were both substituted by glycine. In CaM–GCAP- 1theEF-1regionofGCAP-1wasreplacedwiththeEF-1 region of human calmodulin (data base accession number J04046). Oligonucleotide-directed mutagenesis was per- formed by PCR using the cDNA of GCAP-1 as a template [26]. To generate mutant CPG–GCAP-1, the inner muta- genesis primer (5¢-GGAACCCTCTGTC ATGAACTTC TTGTACC-3¢) and the flanking primers (upstream primer with an NdeI site, indicated by italics: 5 ¢-GCCATATGGG TAACATTATGGACGGTAAGTCGA-3¢; downstream primer introducing a BamHI site, indicated by ital- ics: 5¢-CGGGATCCTAGCCGTCGGCCTCCGCGGC-3¢) were used in a two-step PCR. For creating mutant CaM–GCAP-1 two parallel PCR were performed. One PCR contained fusion primer A (5¢-GACAAGGATGGAGATGGCACTATCACCACCAA GGAGTTCCGCCAGTTCTTCGGCC-3¢)andthesame downstream primer as before whereas the other reaction contained fusion primer B (5¢-CTTGGTGGTGA TAGTGCCATCTCCATCCTTGTCGAACTTCTTGTAC CACTGGTGC-3¢) a nd the upstream primer. In a s econd step, the two PCR products were interlinked by PCR by their overlapping r egions (bold s equence in p rimers A and B). This procedure results in a hybrid gene w here 12 amino acids (residues 26–37) in GCAP were replaced by 11 amino acids (residues 21–31) of human calmodulin. Preparation of ROS Bovine ROS were prepared according to a standard protocol using dim red light. This involves a sucrose density centrifugation in the presence of moderate salt concentration to minimize loss of cytoplasmic proteins [19]. R OS were at all t imes stored and handled in the dark. Rhodopsin (Rh) concentration was determined spectrophotometrically at 498 nm using a molar extinc- tion coefficient of 40 000 M )1 Æcm )1 . Preparation of washed ROS membranes a nd guanylate cyclase activity measurements were performed as described previously [18,19,26]. Expression of GCAPs GCAPs were e xpressed i n Escherichia coli as described [18,19]. Plasmid pET-11a/GCAP was construced by sub- cloning DNA fragments with the GCAP1 gene with NdeI/ BamHI into the vector pET-11a. Bacterial strains Epicurian ColiÒ BL21-CodonPlus TM (DE3)-RIL (Stratagene) were used for o verexpression of GCAPs. Cells were cultured in dYT medium (16 g bacto-tryptone, 10 g bacto-yeast extract and 5 g NaCl p er 1 L) at 37 °C. Expression of GCAPs w as induced by 1 m M isopropyl thio-b- D -galactoside at 37 °C. After 4 h cells were harvested by centrifugation for 20 min at 10 000 g at 4 °C and then resuspend ed in 20 m M Tris pH 7.4, 150 m M NaCl, 2 m M EGTA or 2 m M CaCl 2 ,2m M dithiothreitol (DTT) and proteinase inhibitor cocktail m ix (Boehringer Mannheim). Purification of GCAP-1 wild-type and mutants The overexpressed GCAPs were released from the BL21- CodonPlus TM (DE3)-RIL cells by passing through a French press (SLM Aminco; American Instrument Exchange, Inc., Haverhill, MA). Subsequent purification of GCAPs by size exclusion and anion exchange chromatography using an A ¨ KTA FPLC system (Pharmacia Biotech) was exactly as described [11,22]. Purified G CAPs were dialys ed against 50 m M ammonium bicarbonate buffer. Aliquots of 1 mg were lyophilized by a Speedvac concentrator and then stored at )80 °C until further use. SDS/PAGE was performed as described [11,22]. 45 Ca 2+ -binding assay Binding of Ca 2+ to GCAPs was performed as previously described for binding of Ca 2+ to recoverin [ 27,28]. Briefly, all buffers and p rotein solutions used in Ca 2+ -titration experiments were p assed over a Chelex column (Bio-Rad) to remove residual a mounts of Ca 2+ . Chelex resin was prepared and e quilibrated according to the manufacturer’s instructions. Samples (0 .3–0.5 m L) that contained 5 0 or 100 l M protein were dissolved in 20 m M HEPES pH 7.5, 100 m M NaCl and 1 m M DTT and were transferred to Centricon 10 devices (Amicon). A solution of 10 lLof 0.2 m M 45 CaCl 2 (0.2–0.3 lCi) solution was added and centrifuged for 1 min at 3 0 °C (16 000 g) in a tabletop centrifuge (Beckman model TJ-6). After centrifugation, the r adioactivity in 10 lL of the filtrate (free Ca 2+ )and an equal volume of protein sample (total Ca 2+ )were 3786 J Y. Hwang et al. (Eur. J. Biochem. 271) Ó FEBS 2004 determined by liquid scintillation counting. In the next steps nonradioactive CaCl 2 was added and the above centrifugation procedure was repeated. Protein-bound Ca 2+ vs. free Ca 2+ was determined from the excess Ca 2+ in the protein sample over that present in the ultrafiltrate. The data were analysed as follows: ½Ca 2þ  free ¼ðR f =R p Þ½Ca 2þ  total where R f is the radioactivity in the filtrate, R p is radioactivity in protein sample, Ca 2+ total and Ca 2+ free are the total and free Ca 2+ concentration, respectively. Bound Ca 2+ thatwasretainedonwild-typeGCAP-1 after Chelex treatment, was determined as follows: GCAP-1 was denatured by heating a t 95 °C in 0.5% SDS for 5 min. Next, the sample was added to Ca 2+ -free buffer (see above) that contained 10 l M of 1,2-bis [2-bis(o-amino-5-bromo- phenoxy]ethane-N,N,N¢,N¢-tetraacetic acid, (dibromo- BAPTA) [29] and the absorption was m easured at 264 nm against a suitable control. Free [Ca 2+ ] was determined from aCa 2+ /EGTA-calibration curve using dibromo-BAPTA as indicator. Size exclusion chromatography Protein samples were chromatographed on a BioSep–S EC- S2000 column (Phenomenex, Aschaffenburg, Germany) b y injection of 2 0 lL of molecular mass standards o r G CAP solutions. M olecular mass s tandards for gel filtration were aldolase (Stokes’ radius: 48.1 A ˚ , molecular mass 158 kDa) , BSA (Stokes’ radius: 35.5 A ˚ , 66 kDa), ovalbumin (Stokes’ radius 30.5 A ˚ , 43 kDa), chymotrypsinogen (Stokes’ radius: 20.9 A ˚ , 25 kDa) and ribonuclease A (Stokes’ radius: 16.4 A ˚ , 13.7 k Da). Standards were dissolved at 1.2– 5mgÆmL )1 in size exclusion chromatograpy (SEC) buffer (20 m M Tris/HCl pH 7.5 , 50 m M KCl, 10 m M NaCl, 10 m M MgCl 2 ,1m M DTT and either 0.3 m M CaCl 2 or 0.4 m M EGTA). Void volume ( V o )ofthecolumnwas determined with dextran blue (2000 kDa). Elution volumes (V e ) of s tandards were d etermined by single r uns or in different combinations. GCAPs were dissolved at a concentration of 1.8–3.9 m gÆmL )1 in SEC buffer contain- ing either 0.3 m M CaCl 2 or 0.4 m M EGTA. S tokes’ radii of GCAPs were obtained from a plot according to Laurent & Killander [30], where (–logK AV ) 1/2 was plotted vs. the Stokes’ radius. K AV ¼ V e ) V 0 /V t ) V 0 ;whereV t is the total column volume. Apparent molecular m asses w ere obtained from a plot of logM r vs. K AV . For analysis we assumed a similar compact structure for GCAP-1 as that reported for GCAP-2 [31] and therefore we based the determination of Stokes’ radii on a calibration curve obtained with protein standards o f spherical shape. Fluorescence spectroscopy Fluorescence experiments were performed with a Shimadzu RS-1501 fluorescence spectrometer. GCAPs were dissolved in 50 m M HEPES/K OH pH 7.4, 100 m M NaCl and 1 m M DTT at a concentration of 2 l M . The excitation wavelength was 280 nm. The trypto phan fluorescence emission spec- trum was recorded between 290 and 450 nm. The free [Ca 2+ ] in the buffer was adjusted by a Ca 2+ /EGTA buffer system as described a nd varied between 10 )3 and 10 )9 M free Ca 2+ [19]. Limited proteolysis of GCAPs GCAPs ( 0.2–1 mgÆmL )1 ) w ere incubated with trypsin at a ratio of 300 : 1 in a total volume of 50 or 60 lL. CaCl 2 or EGTA were added to yield a final concentration of 0.1 m M . Incubation was performed at certain time intervals at 30 °C, proteolysis was stopped by removing 10 lLfromthe incubation mixture and adding 1 m M phenylmethylsulfonyl fluoride a nd 1 m M benzamidine. Results were a nalysed by SDS/PAGE and staining with Coomassie blue. Results Ca 2+ -binding to GCAP-1 mutants The first EF-han d in all known NCS proteins is nonfunc- tional. It is mainly distorted from an effective Ca 2+ -binding loop by a Cys and Pro in the position between y and z of the EF-hand loop region (Fig. 1 ). A NMR derived three- dimensional structure of Ca 2+ -bound GCAP-2 demon- strates that the bulky sulfhydryl group at the third position in the loop of EF-hand 1 prevents entry of Ca 2+ [31]. In addition the Pro at the fourth position in the loop leads to a distortion from a favourable Ca 2+ -binding geometry. A sequence alignment of the first EF-hand in GCAP-1, GCAP-2 and calmodulin unveils the critical difference a t these two particular positions, c almodulin has a Gly (G) insteadofCysPro(CP).MutantsofGCAP-1were constructed in which either the first EF-hand was r eplaced by the first EF-hand of calmodulin (CaM–GCAP-1) or the CP in position 29 a nd 30 was changed to a G (CPG– GCAP-1). Mutants were heterologously expressed in E. coli and purified by chromatographic procedures. It is a reasonable assumption that the mutant CaM–GCAP-1 could bind four Ca 2+ , as it contains four intact EF-hands. We tested this hypothesis by a direct 45 Ca 2+ -binding assay. In fact, at saturating f ree [Ca 2+ ] (> 180 l M ), we measured a stoichiometry of 4.0 ± 0.5 Ca 2+ bound per CaM– GCAP-1. The mutant CPG–GCAP-1 showed a lower stoichiometry of 3.3 ± 0.5 Ca 2+ bound. Surprisingly, we Fig. 1. Sequence alignment of the loop region in the first (nonfunctional) EF-hand of GCAP-1 and GCAP-2 in comparison to the first EF-hand i n calmodulin. Data base accession num bers for sequences are; bovine GCAP-1, P46046; bovine GCAP-2, U 32856; bovine calmodulin, MCBO. The am ino acid sequence Trp21–Met26 of G CAP-1 that is located N-terminally to the loop regionhasbeensuggestedtoforman interaction domain [ 24] a nd is shown in comparison to th e corres- ponding sequences of GC AP-2 and calmodulin. Positions of oxygen - containing amino acid side chains that participate in complexing Ca 2+ in a canonical EF-hand are marked x, y, z, -y, -x and -z. The arrow highlights the position CysPro in neuronal Ca 2+ sensor proteins, that is not present in calmodulin. Ó FEBS 2004 Irregular dimerization of GCAP-1 mutants (Eur. J. Biochem. 271) 3787 measured for wild-type GCAP-1 a pproximately two Ca 2+ (1.8 ± 0.3) at saturating free [Ca 2+ ] and not as expected three bound Ca 2+ . However, denaturing Chelex treated wild-type GCAP-1 led to the additional release of 1.2 ± 0.75 Ca 2+ per GCAP-1 molecule indicating the presence of a high affinity Ca 2+ -binding site. CaM–GCAP-1 and CPG–GCAP-1 sense changes in [Ca 2+ ] Both mutants exhibited a decrease in electrophoretic mobility when Ca 2+ in the sample buffer was complexed by EGTA (Fig. 2). This electrophoretic mobility shift of % 4.5 kDa was nearly identical to that observed with wild- type GCAP-1. It indicated that the GCAP-1 mutants underwent a similar Ca 2+ -induced conformational change as wild-type GCAP-1. This conclusion was further supported by tryptophan fluorescence studies. wild-type GCAP-1 contains three tryptophan residues that caused fluorescence emission spectra as shown in Fig. 3 (upper part, left panel; see a lso [16]). Varying the free [Ca 2+ ]from10 )3 to 10 )9 M caused an increase in maximum fluorescence intensity. When the fluorescence intensity is plotted as a function of [Ca 2+ ] the resulting curve saturated below 10 )7 M Ca 2+ and the change in intensity was half-maximal at 300 n M (Fig. 3 A, right panel), which i s consistent with th e known activation profile of guanylate cyclase by GCAP-1 in the submicro- molar range. The CaM–GCAP-1 chimera showed a similar Ca 2+ -dependent change in tryptophan fluorescence inten- sity (Fig. 3B, left panel), which was half-maximal at 600 n M Ca 2+ (Fig. 3 B, right panel). The CPG mutant also showed an increase in tryptophan fluorescence emission, although the relative changes in emission intensity were not as high as those observed with wild-type and CaM–GCAP-1 (Fig . 3 C, left panel). However, the Ca 2+ titration curve revealed a similar EC 50 of 350 n M for the Ca 2+ -induced change in emission intensity (Fig. 3C, right panel). W e c oncluded from the r esults obta ined from t he gel shift assay and the tryptophan fluorescence spectroscopy study that the Ca 2+ - sensing properties of the mutants do not differ significantly from those of wild-type GCAP-1. Therefore, we conclude that mutants have retained characteristic properties of wild- type GCAP-1 with respect to Ca 2+ binding. GCAP-1 mutants have lost activating properties Both mutants were then tested in guanylate cyclase (GC) activity assays using washed native ROS membranes that lacked endogeneous GCAPs (Fig. 4) [11,18,19]. T he con- centration of CaM–GCAP-1 and CPG–GCAP-1 was 2 l M in the p resence of 1 m M Ca 2+ (black bars) or 2 m M EGTA (grey bars). A control incubation was performed with wild- type GCAP-1 or buffer. Basal activity in t he presence of 1m M Ca 2+ was a round 2 nmol c GMPÆmin )1 Æmg )1 Rh (Fig. 4 ) and was identical to the GC activity of washed GCAP-depleted R OS membranes. Increase in GC activity by wild-type GCAP-1 at low [Ca 2+ ] was fivefold, but neither CaM–GCAP-1 nor CPG–GCAP-1 were able to stimulate GC activity above the basal level (Fig. 4 ). The apparent failure of the mutants to activate GC could either reflect no interaction with the target or could result from interaction without transition to the activating state. A simple way t o distinguish betwee n these possibilities is a competition experiment: guanylate cyclase wass activated by 2 l M wild-type GCAP-1 or wild-type GCAP-2 at low free [Ca 2+ ] and a fivefold excess (10 l M )ofCaM–GCAP-1 or CPG –GCAP-1 were added ( grey bars in Fig. 5). When the concentration of wild-type GCAP-1 was decreased to 0.9 l M (at which activation is half-maximal) [11] we observed no interference b y more than 11-fold excess of CaM–GCAP-1 or CPG–GCAP-1 (data not shown). Thus, high concentrations of the mutants did not interfere with the ac tivation of ROS-GC1 by either GCAP-1 or GCAP-2 indicating that the mutants could not compete with wild- type GCAPs for the same binding site. However, we cannot entirely exclude that GC AP-1 mutants associate with a different region in ROS-GC1 than wild-type GCAP-1, because the cross-linking experiments gave no conclusive results. Mutations in EF-hand 1 of GCAP-1 causes dimerization What causes the failure of GCAP-1 mutants to interact properly with GC? An answer came from size exclusion experiments. Active GCAP-1 exists as a monomer both in the p resence o f C a 2+ and EGTA. This is different from GCAP-2 which forms dimers when Ca 2+ is chelated by EGTA and t hus needs the dimerization step in order to switch from the inhibitor to activator state. We performed size exclusion experiments to test wild-type and mutants of GCAP-1 for irregular shape or dimerization. GCAP-1 eluted on a size exclusion column mainly as a protein with a Fig. 2. Ca 2+ -dependent electrophoretic mobility shift of GCAPs. Wild- type GCAP-1 (a and a¢), CPG–GCAP-1 (b and b¢)andCaM–GCAP-1 (c and c¢) were se parated by electrophoresis in the presence of CaCl 2 or EGTA in a 15% polyacrylamide gel. GCAPs exhibited an electrophoretic mobility shift of % 4.5 kDa, when CaCl 2 was replaced by EGTA. The low molecular mass (LMW) standard consisted o f phosphorylase b (97.4 kDa), BSA (66 kDa), ovalbumin (45 kDa), carbonic anhydrase (29 kDa), soybean trypsin inhibitor (20.1 kDa) and a-lactalbumin (14.2 kDa). Th e gel was stained with Coomassie blue. 3788 J Y. Hwang et al. (Eur. J. Biochem. 271) Ó FEBS 2004 Stokes’ radius of 26.5 A ˚ and apparent molecular mass of 36 kDa (Fig. 6A and B, l eft p anels; t hin tra ce). A small fraction containing < 10% of the total GC AP-1 that was applied to the column eluted with a Stokes’ radius of 35 A ˚ and apparent molecular mass of 62 kDa. This elution pattern d id not change when Ca 2+ was replaced b y EGTA in the column buffer (Fig. 6A and B, right panels; thin trace). These values are consistent with the main fraction being a GCAP-1 monomer and the smaller fraction being a dimer. However, the hydrodynamic properties of the mutants d iffered significantly f rom t hese wild-type proper- ties. For instance, the chimeric protein CaM–GCAP-1 eluted mainly as a dimer with a Stokes’ radius of 32.2 A ˚ (Fig. 6 A, right panel; thick trace). In the presence of Ca 2+ only 20% of the protein eluted as a monomer (Stokes’ radius 25.3 A ˚ ). When the run w as performed in the presence of EGTA the main portion of CaM–GCAP-1 remained in the dimeric form. A second peak appeared on the shoulder of the dimer peak (Fig. 6B, left panel; thick trace) that was situated between wild-type monomer and dimer. This peak would correspond to a protein with a Stokes’ radius of 29 A ˚ and an apparent molecular mass of 45 k Da. It p robably represented a monomer of CaM–GCAP-1 with a different shape (see Discussion). CPG–GCAP-1 eluted almost entirely as a dimer in the presence of Ca 2+ (Fig. 6 B, left panel; thick trace, Stokes’ radius 33.5 A ˚ ), a sma ll fraction eluted in a peak at V e ¼ 7 .2 mL r epre senting a h igher oligomeric or aggregated state of CPG–GCAP-1. A com- pletely different picture was obtained when CPG–GCAP-1 was chromatographed in t he presence of EGTA (Fig. 6B, right panel; thick trace). The dimer peak became much [Ca 2+ ] (M) 10 -9 10 -8 10 -7 10 -6 10 -5 10 -4 10 -3 10 -2 Intensity 100 105 110 115 120 125 130 CPG-GCAP-1 300 350 400 0 50 100 150 Fluorescence (arbitrary units) Wavelength (nm) [Ca 2+ ] (M) 10 -9 10 -8 10 -7 10 -6 10 -5 10 -4 10 -3 10 -2 Intensity 60 65 70 75 80 85 90 95 WT 300 350 400 450 0 50 100 150 Fluorescence (arbitrary units) Wavelength (nm) [Ca 2+ ] (M) 10 -9 10 -8 10 -7 10 -6 10 -5 10 -4 10 -3 10 -2 Intensity 80 90 100 110 120 130 140 150 CaM-GCAP-1 300 350 400 450 0 50 100 150 Fluorescence (arbitrary units) Wavelen g th (nm) A B C Fig. 3. Tryptophan fluorescence spectra of GCAPs at different [Ca 2+ ]. In each case 2 l M of wild-type or mutant G CAP-1 was ana lysed. Emission spectra for each GCAP-1 form are displayed on the left panels and the corres- ponding maximum relative fluorescence intensity values at different [Ca 2+ ] are shown on the right panels. (A) Wild-type GCAP-1. (B) CaM–GCAP-1. (C) CPG–GCAP-1. Fig. 4. Guanylate cyclase activity in the presence of GCAPs. Washed ROS membranes were reconstituted w ith 2 l M of either wild-type GCAP-1 (WT) , buffer (RM ), CaM–GCAP-1 o r CPG–GCAP-1. Guanylate cyclase (GC) activity was measured in the presence of 1 m M CaCl 2 (black bars) or 2 m M EGTA (grey bars) and is expressed a s nmol cGMPÆmin )1 Æmg )1 Rh. Ó FEBS 2004 Irregular dimerization of GCAP-1 mutants (Eur. J. Biochem. 271) 3789 smaller a nd the m ajority of C PG–GCAP-1 e luted as a protein of apparent molecular mass of 45 k Da and is similar to the behaviour of the CaM–GCAP-1 mutant in the presence of EGTA (Fig. 6A, right panel). Limited proteolysis of GCAPs The Ca 2+ -bound form of wild-type GCAP-1 can be envisaged as a rather co mpact core s tructure with less compact parts at the N- and C-termini. It is protected from limited proteolytic degradation, whereas the Ca 2+ -free form undergoes more rapid proteolysis by trypsin [14]. We compared the protein/peptide pattern of wild-type GCAP-1 with that of CaM–GCAP-1 and CPG–GCAP-1 after limited proteolysis (Fig. 7). As reported previously for wild-type GCAP-1, the C a 2+ -free form was rapidly d egra- ded (Fig. 7, upper part) and the Ca 2+ -bound form was better protected: proteolysis yielded large fragments between 14 and 20 kDa (b, c, d in th e upper part of Fig. 7). The relative amounts of proteolytic fragments varied, but the pattern was similar in different trials (data not shown). The mutants CaM–GCAP-1 and CPG– GCAP-1 exhibited stronger protection ) in particular when the proteolysis was compared with that of t he wild-type i n the absence of Ca 2+ (Fig. 7 , upper part in comparison to middle and lower parts). Proteolysis of CaM–GCAP-1 in the presence of Ca 2+ yielded six main fragments between 14 and 20 kDa (b)k, Fig. 7 ) that were a lso seen in the absence of Ca 2+ . However, staining intensity of the large fragment b was lower in the absence of Ca 2+ indicating that progessive trypsin d igestion of the Ca 2+ -free f orm o f CaM–GCAP-1 had already occurred. A similar observation was made with CPG–GCAP-1, fragments I–VIII (Fig. 7) were produced in the presence and absence of Ca 2+ , but proteolysis pro- ceeded slightly faster in the absence of Ca 2+ . Discussion Peptide competition and truncation studies have shown that the N-terminal 20–25 amino acids of GCAP-1 are import- ant f or regulation of ROS-GC1 [13,22,25] and a study with recoverin/GCAP-1 chimera c oncluded that t he sequence Trp21–Thr27 is required for activation of ROS-GC1 [24]. In addition, other regions in GCAP-1 contribute to the activation or represent contact s urfaces [13,24]. However, the role of the nonfunctional EF-hand 1 in GCAP-1 remains unclear, in particular whether it acts as an essential target region as it does in GCAP-2 [21]. Our s tudy was focused on the loop region of EF-hand 1 in GCAP-1, where a CysPro sequence i s supposed to prevent binding of Ca 2+ . Fig. 5. Competition experiments. G uanylate cyclase in washe d ROS membranes was in cubated with 2 l M of either GCAP-1 or GCAP-2 at 2m M EGTA. The corresponding maximal activity is set as 100% (black bars). Addition of 10 l M CaM–GCAP-1 or 10 l M CPG– GCAP-1 did n ot ch ange significantly the maximal GC activity (grey bars). Error bars are within the size of the columns. time (min) 0246810121416 Ca 2+ monomer (WT) dimer A 280 CaM-GCAP-1 time (min) 0246810121416 A 280 EGTA CaM-GCAP-1 monomer (WT) dimer time (min) 0246810121416 A A B 280 EGTA CPG monomer (WT) dimer time (min) 0246810121416 Ca 2+ monomer (WT) dimer A 280 CPG Fig. 6. Size exclusion chromatography of CaM–GCAP-1 and CPG–GCAP-1 on a Bio- Sep–SEC-S2000 column in the presence of Ca 2+ (left panels) or EGTA (right panels). Chromatograms of w ild-type GCAP-1 (WT, thin traces) are always included to allow a direct comparison with the elution profiles of the mutants. Chromatograms of GCAP-1 mutants are presented as thick lines. Monomer and dimer forms are indicated. 3790 J Y. Hwang et al. (Eur. J. Biochem. 271) Ó FEBS 2004 The functional EF-hand 1 in calmodulin contains a Gly at this position. A GCAP chimera in which the loo p region of EF-hand 1 is replaced by the corresponding region of calmodulin had lost completely any cyclase-activating property. In fact, loss of activity was even observed i n a point mutant where CysPro was substituted by Gly (CP fi G; CPG). T hese results highlight the importance of Cys29andPro30inGCAP-1fortheactivationprocessand are consistent with previous findings t hat substitu tion of Cys29 b y Ser, Gly or Asp produced inactive mutants [17]. However, Cys29 can be deleted or changed to Asn, Tyr and Ala without significant loss of GCAP activity [17,18]. Interestingly, the mutant C29S was described as a potent competitor of a constitutively active GCAP-1 mutant showing that it binds to the target without activating it [17]. In contrast, our CPG mutant did not bind to the cyclase (Fig. 5), which indicates that Pro30 in EF-hand 1 might be necessary for the interaction with the target. However, it is also possible that the short sequence CysPro is important for p roviding the proper c onformation for target activation. Why were the mutants CaM–GCAP-1 and CPG– GCAP-1 without activity? Reasonable explanations are that they do not bind Ca 2+ or do not change conforma- tion in response to C a 2+ . We can exclude these possibil- ities, as the mutants exhibited similar Ca 2+ -induced conformational changes as wild-type GCAP-1 a s probed by gel shift and tryptophan fluorescence assays. Further- more, stoichiometries of Ca 2+ bound per GCAP-1 mutants were consistent with four (CaM–GCAP-1) or three (CPG–GCAP-1) functional EF-hands. However, wild-type GCAP-1 bound only two Ca 2+ under the conditions used and no t three as e xpected. Due t o its activation profile and because of the intermediate affinity for Ca 2+ of its EF-hand 3, wild-type GCAP-1 must have at least one Ca 2+ -binding site of very high affinity [18]. We think t hat t reating GCAP-1 solutions with Chelex did not remove Ca 2+ from the high affinity site and therefore we measured only b inding of Ca 2+ to the remaining two sites. This assumption was verified by th e r elease of one additional C a 2+ from denatur ed wild-type G CAP-1. In the case of CaM–GCAP-1 we were able to observe the binding of four Ca 2+ , because the introduction of a complete functional EF-hand might have lowered the affinity of the other EF-hand(s). Size exclusion chromatography revealed a plausible reason why these EF-hand 1 mutants had lost their activating p roperties. Sokal et al. r eported r ecently that GCAP-1 dimers are inactive [17]. Our results showed that mutations in EF-hand 1, like those in CaM–GCAP-1 a nd CPG–GCAP-1, promote the formation of inactive dimers. Dimerization of GCAP-1 apparently prevents the access of the target to the target binding site. Therefore, the target site must not necessarily be lo cated within EF-hand 1. Alter- natively, dimer formation could allosterically change the contact surface of the interaction site. So far we cannot distinguish between these two possibilities. GCAP-2 undergo es a Ca 2+ -controlled re versible dimeri- zation in order to activate g uanylate cyclase [20,21]. But point mutations in EF-hand 1 of GCAP-2 led to inactive mutants that were still able to dimerize in the absence of Ca 2+ [21]. The difference to GCAP-1 in our study is significant: in one case (GCAP-1) changes in EF-hand 1 induce i rregular dimerization of the protein, in the other case (GCAP-2) the Ca 2+ -induced transition to the ÔactiveÕ dimer still works, but the protein lacks activity. Fig. 7. Limited p roteolysis of GCAPs by trypsin. GCAPs were incu- batedwithtrypsininthepresenceofCa 2+ (Ca) or in its absence (EGTA) and the fragmentation pattern was analysedbySDS/PAGE. Time of incubation is indicated in minutes. Molecular mass standards are shown on the left site of each gel (MW), numbers refer to kDa of corresponding standards. Upper part: 5 lg of undigested wild-type GCAP-1 (a) and 10 lg of tryptic fragments were loaded on the gel. Main fragments after staining withCoomassieblueareindicated as b–g. Middle part: CaM–GCAP-1, amount of protein as indicated above. Undigested protein is labelled a and main fragments are labelled b–k. Lower part: CPG–GCAP-1, am ount of protein a s indicated above. Undigested protein is labelled I and main fragments are labelled I I–VIII. Ca 2+ -dependent differences in electrophoretic mobilities as shown in Fig. 2 are not visible, because the final EGTA concentration of the sam ples was too l ow. Ó FEBS 2004 Irregular dimerization of GCAP-1 mutants (Eur. J. Biochem. 271) 3791 A s pecial case was observed with t he CPG mutant in the presence of the Ca 2+ chelator EGTA. A lthough dimeriza- tion was observed, the main portion of the mutant eluted as a monomer (Fig. 6B, right panel) but with a shifted retention volume. This indicated that the overall shape of the mutant deviates from the assumed c ompact shape o f wild-type G CAP-1 and probably has a more elongated form. If w e assume that the three-dimensional structure of GCAP-1resemblesthatofGCAP-2, one can s peculate about the structural impact o f the CPG replacement. The CysPro region is located before a short b-strand that is fixed by interaction with EF-hand 2. The entering helix of EF- hand 1 has hydrophobic c ontact with the exiting helix of EF-hand 2 [31]. Shortening of the distance in the loop region by the mutation could trigger something like a lever switch which would c ause a movement o f the N-terminus away from the centre of the molecule leading to a more elongated form. A similar obse rvation was also made with CaM–GCAP-1 in the presence of EGTA, but here t he dimer is t he prominent form of the mutant (Fig. 6A, right panel). Thus, the mutation CPG changed mainly the hydrodynamic v olume of the protein in addition to promoting the transition to the inactive dimer form. Furthermore, the CPG exchange could have lowered the Ca 2+ affinity of the high affinity EF-hand in CPG–GCAP-1, which would explain why we observed three bound Ca 2+ in CPG–GCAP-1. Proteolysis studies showed that the mutants exhibited a lower accessibility for tryptic dige stion. Of particular interest was the differen t pattern we observed for the digestion of the Ca 2+ -free GCAP-1 form, which is the cyclase-activating conformation. Removing Ca 2+ triggered a conformational change that opens the i nterior of the protein a nd allows tryptic cleavage at several interior trypsin cleavage sites [14]. Fragments f and g from the wild-type GCAP-1 digest (Fig. 7 ) probably c orrespond to fragments consisting of residues 9–91 (% 10 kDa) and 121–172 (% 6kDa)thathad been identified previously [14]. While these fragments appeared immediately after start of the digestion of wild- type GCAP-1 (2 min), digestion of the mutants produced larger fragments at higher molecular mass (see also Results) and to a lesser extent a few faint b ands of the appropriate size of g and f (6 and 10 kDa, Fig. 7, CaM–GCAP-1, below k and CPG–GCAP-1 one band at VIII). These critical digestions occur at t he tryptic c leavage sites L ys91 and Arg120 which are located at the N-terminal and C-terminal flanks of EF-hand 3. Dissociation of Ca 2+ from EF-hand 3 triggers the conformational change in GCAP-1 leading to an opening of the c ompact core structure [14,16,18]. Our data show that these opening steps are hindered i n the mutants CaM–GCAP-1 a nd CPG–GCAP-1. However, for each mutant a different reason might account for this behaviour. CaM–GCAP-1 forms a dimer in the a bsence of Ca 2+ (Fig. 6 ), which probably protects the site around EF- hand 3 f rom tryptic digestion, although CaM–GCAP-1 undergoes Ca 2+ -induced conformational changes (Figs 2 and 3). CPG–GCAP-1 also forms a dimer in the absence of Ca 2+ , but a m ain fraction is p resent as a distorted monomer (see above). Thus, the CPG point mutation in the nonfunctional EF-hand 1 exerts an effect o n the opening of the GCAP-1 structure around EF-hand 3 when Ca 2+ is released from this site. In summary, our results show that EF-hand 1 in wild- type GCAP-1 is critical for forming an inactive dimer and mutations in EF-hand 1 can hinder the opening of the core structure around EF-hand 3 . Our results highlight the differences between GCAP-1 and GCAP-2 [11,19]. Both proteins operate in the same type of cell, but they differ significantly in their regulatory functions. Acknowledgements We thank D. Ho ¨ ppner-Heitmann for excellent technical a ssistance, Prof. Georg Bu ¨ ldt (IBI-2, F Z Ju ¨ lich) for continuous support a nd Dr Oliver Weiergra ¨ ber (IBI-2) for helpful discussions. This work was also supported by a grant from the De utsche Forschungsgemeinschaft to K W.K. (Ko948/5-3) and a DAAD fellowship to J Y.H. References 1. Pugh, E.N. Jr & Lamb, T.D. (2000) Phototransduction in verte- brate rods and cones: Molecular mechanisms of amplification, recovery and light adaptation. In Handbook of Biological Physics (Stavenga, D.G., DeGrip, W.J. & Pugh, E.N. Jr, eds), pp. 183– 255. Elsevier Science BV, North-Holland. 2. Burns, M.E. & Baylor, D.A. (2001) Activation, deactivation, and adaptation in vertebrate phot oreceptor c ells. Annu. Rev. Neurosci. 24, 779–805. 3. Kaupp, U .B. & Seifert, R. (2002) Cyclic nucleotide-gated ion channels. Physiol. Rev. 82, 769–824. 4. Palczewski, K., Polans, A .S., Baehr, W. & Ames, J.B. (2000) Ca 2+ -binding proteins in the retina: structure, function, and the etiology of human visual diseases. Bioessays 22, 337–350. 5. Dizhoor, A.M. (2000) Regulation of cGMP synthesis in photoreceptors: role in signal transduction and congenital diseases of the retina. Cell. Signal. 12 , 711–719. 6. Koch, K W., D uda, T . & Sharma, R.K. (2002) Photoreceptor specific guanylate cyclases in verteb rate p hototransductio n. Mol. Cell. Biochem. 23 0, 97–106. 7. Pugh, E.N. Jr, Nikonov, S. & Lamb, T.D. (1999) Molecular mechanisms of vertebrate photoreceptor light adaptation. Curr. Opin. Neurobiol. 9, 410–418. 8. Braunewell, K H. & G undelfinger, E.D. ( 1999) Intracellular neuronal calcium sensor p roteins: a family of EF-hand calcium- binding proteins in search of a function. Cell Tissue Res. 295, 1–12. 9. Burgoyne, R.D. & Weiss, J.L. (2001) The neuronal calcium sensor family of Ca 2+ -binding proteins. Biochem. J. 353, 1–12. 10. Olshevskaya, E.V., Hughes, R.E., Hurley, J.B. & D izhoor, A.M. (1997) Calcium binding, but not a calcium-myristoyl switch, controls the ability of guanylyl cyclase-activating protein GCAP-2 to regulate photorec eptor guan ylyl cyclase. J . B iol. C hem . 272, 14327–14333. 11. Hwang, J Y. & K och, K W. (2002) The myristoylation o f the neuronal Ca 2+ -sensors guanylate cyclase-activating protein 1 and 2. Biochim. Biophys. Acta 1600, 111–117. 12. Dizhoor, A.M. & H urley, J.B. (1996) Inactivation of E F-han ds makes GCAP-2 (p24) a c onstitutive activato r of p hotorecep tor guanylyl cyclase by p reventing a Ca 2+ -induced Ôactivator-to- inhibitorÕ transition. J. Biol. Chem. 271, 19346–19350. 13. Otto-Bruc, A., Buczylko, J., S urgucheva, I., Subbaraya, I., Rud- nicka-Nawrot, M., Crabb, J.W., Are ndt, A., Hargrave, P.A., Baehr, W. & Palczewski, K . (1997) Functional reconstitution of photoreceptor guanylate cyclase with native and mutant forms of guanylate cyclase-activating protein 1. Biochemistry 36, 4295–4302. 3792 J Y. Hwang et al. (Eur. J. Biochem. 271) Ó FEBS 2004 14. Rudnicka-Nawrot, M., Surgucheva, I., Hulmes, J.D., Haeseleer, F., Sokal, I., Crabb, J.W., Baehr, W. & Palczewski, K. (1998) Changes i n biological activity and folding of g uanylate cyclase- activating protein 1 as a function of calcium. Biochemistry 37, 248–257. 15. Hughes, R.E., Brzovic, P.S., Dizhoor, A.M., Klevit, R.E. & Hurley, J.B. (1998) Ca 2+ -dependent conformational changes in bovine GCAP-2. Protein Sci. 7, 2675–2680. 16. Sokal, I., Otto-Bruc, A.E., Surgucheva, I., Verlinde, C.L.M.J., Wang,C K.,Baehr,W.&Palczewski,K.(1999)Conformational changes in guanylyl cyclase-activatin g protein 1 (GCAP1) and its tryptophan mutants a s a function of calcium concentration. J. Biol. Chem. 274, 19829–29837. 17. Sokal, I., Li, N., K lug, C.S., Filipek, S., Hubbell, W.L., Baehr, W. & Palczewski, K. (2001) Calcium-sensitive regions of GCAP1 as observed by chemical modifications, fluorescence, and EPR spectroscopies. J. Biol. Chem. 276, 43361–43373. 18. Hwang, J Y., Schlesinger, R. & K och, K W. ( 2001) Calcium- dependent c ysteine reac tivities in the neuronal calcium sensor guanylate cyclase-activating protein 1. FEBS Lett. 508, 355–359. 19. Hwang, J Y., Lange , C., Helten, A., Ho ¨ ppner-Heitmann , D., Duda,T.,Sharma,R.K.&Koch,K W.(2003)Regulatorymodes of rod outer seg ment membrane guanylate cyclase differ in catalytic efficiency and Ca 2+ -sensitivity. Eur. J. Biochem. 270, 3814–3821. 20. Olshevskaya, E.V., Ermilov, A.N . & Dizhoor, A.M. (1999) Dimerization of guanylyl cyclase-activating protein and a mechanism of photorecep tor guanylyl cyclase activation. J. Biol. Chem. 274, 25583–25587. 21. Ermilov, A.N., O lshevskaya, E.V. & Dizhoor, A.M. (2001) Instead of b inding calcium, o ne of the E F-hand structures i n guanylyl cyclase activatin g protein-2 is required for targeting photoreceptor guanylyl cyclase. J. Biol. Chem. 276, 48143–48148. 22. Schrem, A., Lange, C., Beyermann, M. & K och, K W. (1999) Identification of a domain in guanylyl cyclase-activating protein 1 that interacts with a complex of guanylyl cyclase and tubulin in photoreceptors. J. Biol. Chem. 274, 6244–6249. 23. Olshevskaya, E.V., Boikov, S., Ermilov, A., Krylov, D., H urley, J.B. & Dizhoor, A.M. (1999) Mapping functional domains of the guanylate cyclase regulator protein, GCAP-2. J. Biol. Chem. 274, 10823–10832. 24. Krylov, D.M., Niemi, G.A., Dizhoor,A.M.&Hurley,J.B.(1999) Mapping sites in guanylyl cyclase activating protein-1 reguired for regulation of photoreceptor membrane guanylyl cyclases. J. Biol. Chem. 274, 10833–10839. 25. Li, N., Sokal, I., Bronson, J.D., Palczewski,K.&Baehr,W.(2001) Identification of functional reg ions of guanylate c yclase-activating protein 1 (GCAP1) using GCAP1/GCIP chimeras. Biol. Chem. 382, 1179–1188. 26. Frins, S., Bo ¨ nigk, W., Mu ¨ ller, F., Kellner, R. & Koch, K W. (1996) Functional characterization of a guanylyl cyclase-activating protein from vertebrate rods. J. Biol. Chem. 271, 8022–8027. 27. Ames, J.B., Porumb, T., Tanaka, T., Ikura, M. & Stryer, L. (1995) Amino-terminal myristoylation induces cooperative calcium binding to recoverin. J. Biol. Chem. 270, 4526–4533. 28. Senin, I.I., Fischer, T., Komolov, K.E., Zinchenko, D .V., Phili- pov, P.P. & Koc h, K W. (2002) Ca 2+ -myristoyl switch in the neuronal calciu m sensor recoverin requ ires different functions o f Ca 2+ -binding sites. J. Biol. Chem. 277, 50365–50372. 29. Tsien, R.Y. (1980) New calcium indicators and buffers with high selectivity against magnesium and protons: design, synthesis, and properties of prototype structures. Biochemistry 19, 2396–2404. 30. Winzor, D.J. (1969) Analytical gel filtration. In Physical Principles and Techniques of Protein Chemistry, Part A (Leach, S.J., ed.), pp. 451–495. Academic Press, New York. 31. Ames,J.B.,Dizhoor,A.M.,Ikura,M.,Palczewski,K.&Stryer,L. (1999) Three-dimensional structure of guanylyl cyclase activating protein-2, a calcium-sensitive modulator of photoreceptor gua- nylyl cyclases. J. Biol. Chem. 274, 19329–19337. Ó FEBS 2004 Irregular dimerization of GCAP-1 mutants (Eur. J. Biochem. 271) 3793 . (M) 10 -9 10 -8 10 -7 10 -6 10 -5 10 -4 10 -3 10 -2 Intensity 10 0 10 5 11 0 11 5 12 0 12 5 13 0 CPG-GCAP -1 300 350 400 0 50 10 0 15 0 Fluorescence (arbitrary units) Wavelength (nm) [Ca 2+ ] (M) 10 -9 10 -8 10 -7 10 -6 10 -5 10 -4 10 -3 10 -2 Intensity 60 65 70 75 80 85 90 95 WT 300. Irregular dimerization of guanylate cyclase-activating protein 1 mutants causes loss of target activation Ji-Young Hwang 1, *, Ramona Schlesinger 2 and Karl-Wilhelm Koch 1 1 Institut. the size of the columns. time (min) 0246 810 1 214 16 Ca 2+ monomer (WT) dimer A 280 CaM-GCAP -1 time (min) 0246 810 1 214 16 A 280 EGTA CaM-GCAP -1 monomer (WT) dimer time (min) 0246 810 1 214 16 A A B 280 EGTA CPG monomer