A novel G-quadruplex motif modulates promoter activity of human thymidine kinase ˆ Richa Basundra1,*, Akinchan Kumar1,*, Samir Amrane2,*, Anjali Verma1, Anh Tuan Phan2 and Shantanu Chowdhury1,3 Proteomics and Structural Biology Unit, Institute of Genomics and Integrative Biology, CSIR, Delhi, India Division of Physics and Applied Physics, School of Physical and Mathematical Sciences, Nanyang Technological University, Singapore G N Ramachandran Knowledge Centre for Genome Informatics, Institute of Genomics and Integrative Biology, CSIR, Delhi, India Keywords G-quadruplex; NMR; thymidine kinase Correspondence S Chowdhury, G N Ramachandran Knowledge Centre for Genome Informatics, Institute of Genomics and Integrative Biology, CSIR, Mall Road, Delhi 110 007, India Fax: +91 011 27667471 Tel: +91 011 27666157 ext 144 E-mail: shantanuc@igib.res.in A T Phan, Division of Physics and Applied Physics, School of Physical and Mathematical Sciences, Nanyang Technological University, Singapore 637371, Singapore Fax: 6795 7981 Tel: 6514 1915 E-mail: phantuan@ntu.edu.sg G-quadruplex motifs constitute unusual DNA secondary structures formed by stacking of planar hydrogen-bonded G-tetrads Recent genome-wide bioinformatics and experimental analyses have suggested the interesting possibility that G-quadruplex motifs could be cis-regulatory elements Here, we identified a characteristic potential G-quadruplex-forming sequence element within the promoter of human thymidine kinase (TK1) Our NMR, UV and CD spectroscopy and gel electrophoresis data suggested that this sequence forms a novel intramolecular G-quadruplex with two G-tetrads in K+ solution The results presented here indicate the role of this G-quadruplex motif in transcription of TK1 in cell-based reporter assays Specific nucleotide substitutions designed to destabilize the G-quadruplex motif resulted in increased promoter activity, supporting direct involvement of the G-quadruplex motif in transcription of TK1 These studies suggest that the G-quadruplex motif may be an important target for controlling critical biological processes, such as DNA synthesis, mediated by TK1 *These authors contributed equally to this work (Received 10 October 2009, revised July 2010, accepted 16 August 2010) doi:10.1111/j.1742-4658.2010.07814.x Introduction Nucleotide sequences are established as regulatory elements [1] However, DNA conformation(s) is relatively unexplored in a regulatory context Non-B DNA structures have been implicated in recombination, replication and regulation of gene expression [2–6], in both prokaryotes [7] and eukaryotes [2,8] A particular type of non-B DNA structure, the G-quadruplex motif, has attracted interest in the context of gene regulation, owing to reports indicating the prevalence of such motifs in promoters [9,10] G-quadruplex motifs are Abbreviations TDS, thermal difference spectrum; TK1, thymidine kinase 1; TSS, transcription start site 4254 FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR) Journal compilation ª 2010 FEBS R Basundra et al G-quadruplex motif in human thymidine kinase structural conformations formed by consecutive stacking of coplanar arrays of four cyclic hydrogen-bonded guanines [11–15] G-quadruplex conformations were first reported in telomeres [16], and subsequently in other genomic regions, i.e immunoglobin heavy chain switch regions [17], G-rich minisatellites [18] and rDNA [19] Recently, genome-wide analysis of recombination-prone regions showed the enrichment of potential G-quadruplexforming sequences within human hot spots or short recombinogenic regions [20] In another recent study, it was proposed that G-quadruplex motifs may act as nucleosome exclusion signals [21] Moreover, several gene promoters, such as b-globin [22], retinoblastoma susceptibility genes [23], the insulin gene [24], adenovirus serotype [25], PDGF [26], c-KIT [27], hypoxiainducible factor 1a [28], BCL-2 [29] and c-MYC [10,30,31], harbor G-quadruplex motifs In genomewide studies, enrichment of G-quadruplex-forming motifs in promoters of several bacterial [32], chicken [33] and mammalian genomes, including the human genome [9,34–36], has been observed, suggesting a widespread regulatory influence of G-quadruplexes Further support comes from reports showing that more than 700 orthologous promoters conserve putative G-quadruplex sequences in human, mouse and rat [37], and a recent genome-wide gene expression study showing that the expression of many genes, whose promoters harbor putative G-quadruplex forming sequences, had changes in the presence of G-quadruplex-binding ligands in two different human cell lines [36] A role of G-quadruplex motifs in the transcription of specific genes has been experimentally demonstrated In the case of the c-MYC promoter, it was shown that the purine-rich strand of DNA in the A nuclease-hypersensitive region of the promoter can adopt different intramolecular G-quadruplex conformations It was further demonstrated that destabilization or stabilization of a G-quadruplex motif resulted in increased or decreased promoter activity, respectively, in a luciferase reporter assay [30] Similarly, it was shown in KRAS [38] and PDGF-A [39] that stabilization of a G-quadruplex motif in the promoter region with a quadruplex-specific ligand resulted in decreased promoter activity We note that all of the above studies considered G-quadruplex motifs formed by sequences containing at least four tracts of three or more consecutive guanines, which, in principle, can fold into G-quadruplexes with three stacked G-tetrads The regulatory role of G-quadruplex motifs comprising two G-tetrads (Fig 1A), where the core involves only two stacked G-tetrads instead of three, has not been studied A possible reason for this could be that a stack of two G-tetrads would confer less stability than a G-quadruplex with three stacked G-tetrads Although it has not been studied in a regulatory context, the existence and biological role of G-quadruplexes with two G-tetrads has been reported in multiple cases [40–46] In the retinoblastoma susceptibility gene, it was shown that a potential two-G-tetrad structure at the 5¢-end of the gene acts as a barrier to DNA polymerase activity [46] Likewise, in an in vitro study, the thrombin-binding aptamer d(GGTTGGTGTGGTTGG) was reported to form a unimolecular stable G-quadruplex motif with two G-tetrads connected by two TT loops and a TGT loop, which inhibits thrombin-induced fibrin clot formation [43] Recently, it was found that human and Giardia telomeric DNA sequences containing four tracts of three consecutive guanines can form intramolecular Loop1 Loop2 G G G G G G G Fig G-quadruplex motif and TK1 promoter (A) Schematic representation of a G-quadruplex motif with two stacks of G-tetrad in the core connected by three loops (B) The TK1 promoter [62] showing two potential G-quadruplex-forming sequences: TKQ1 (bold) and TKQ2 (underlined) The TSS is indicated by the arrowhead G 5′ 3′ Loop3 B AAATCTCCCGCCAGGTCAGCGGCCGGGCGCTGATTGGCCCCATGGCGGCGGGGCCGGC TCGTGATTGGCCAGCACGCCGTGGTTTAAAGCGGTCGGCGCGGGAACCAGGGGCTTAC TGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAATGAGCT FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR) Journal compilation ª 2010 FEBS 4255 G-quadruplex motif in human thymidine kinase G-quadruplexes comprising only two G-tetrads in K+ solution, and, interestingly, these structures can be more stable than other G-quadruplex conformations comprising three G-tetrads [47–50] Here, we have identified a characteristic potential G-quadruplex-forming sequence element, containing several tracts of two consecutive guanines, within the promoter of human thymidine kinase (TK1) Thymidine kinase is a critical enzyme required for the production of TTP during DNA synthesis, and is therefore ubiquitously conserved in prokaryotes and eukaryotes It is tightly regulated during the cell cycle, and has been shown to increase protein promoter activity more than 10-fold during S-phase, to meet demands for increased TTP synthesis; enzymatic activity remains high until about the time of cell division, and then decreases rapidly [51] We show, by a series of biophysical and biochemical experiments, including NMR, UV and CD spectroscopy and gel electrophoresis, that this sequence forms a novel intramolecular G-quadruplex with two G-tetrads in K+ solution Using intracellular reporter experiments, we observed that the promoter activity of TK1 is directly influenced by specific nucleotide substitutions that disrupt the G-quadruplex motif Results Identification of potential G-quadruplex-forming sequences within the TK1 promoter We used a customized perl program to search for potential G-quadruplex-forming motifs G2–5L1–7G2– 5L1–7G2–5L1–7G2–5, which contained at least four runs of two to five guanines separated by linkers of one to seven nucleotides We identified two such motifs within the functional promoter of TK1, spanning from )89 to +58 of the transcription start site (TSS) [52] The two identified sequences were designated TKQ1 ()13 to +8) and TKQ2 ()47 to )68) (Table 1) Their locations within the TK1 promoter are shown in Fig 1B TKQ1 harbors two tracts of two guanines, one of three guanines and one of four guanines The G-tracts are separated by linkers composed of two, three and five Table Oligonucleotides used in the study (5¢- to 3¢) G-tracts are underlined One or two guanines were replaced by the same number of adenines in the modified oligonucleotides (bold) TKQ1 TKQ1m TKQ2 TKQ2m 4256 GGTCGGCGCGGGAACCAGGGG GGTCGGCGCAAGAACCAGGGG GGCCCCATGGCGGCGGGGCCGG GGCCCCATGACGGCGGGGCCGG R Basundra et al nucleotides, respectively TKQ2 comprises four tracts of two guanines and one of four guanines, separated by linkers of one, two or six nucleotides TKQ1 forms a G-quadruplex structure – NMR study In order to determine whether TKQ1 and TKQ2 form G-quadruplex structures, we recorded their NMR spectra in K+ solution The imino proton spectrum of TKQ1 (Fig 2A, top) displayed sharp peaks between 10 and 12 p.p.m., which were characteristic of G-quadruplex formation, whereas the imino proton spectrum of TKQ2 (Fig 2B, top) displayed peaks only at  13 p.p.m., which probably resulted from Watson– Crick base pairing For the spectrum of TKQ1, the observation of eight major sharp imino proton peaks between 10 and 12 p.p.m was consistent with formation of a major G-quadruplex structure involving two G-tetrad layers; three major sharp peaks between 12 and 14 p.p.m might come from other base pairing alignments, e.g Watson–Crick or Hoogsteen base pairs in the loops of the G-quadruplex; minor sharp peaks between 10 and 12 p.p.m should represent minor G-quadruplex conformation(s); a rather big hump in this region reflected yet other conformation(s) adopted by TKQ1 For the spectrum of TKQ2, very little signal A 14.0 13.0 12.0 11.0 10.0 p.p.m 13.0 12.0 11.0 10.0 p.p.m B 14.0 Fig NMR spectroscopy Imino proton spectra of: (A) TKQ1 (top) and TKQ1m (bottom); and (B) TKQ2 (top) and TKQ2m (bottom) Experimental conditions: DNA concentration, 0.5 mM; temperature, 25 °C; 70 mM KCl; 20 mM potassium phosphate (pH 7.0) FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR) Journal compilation ª 2010 FEBS R Basundra et al G-quadruplex motif in human thymidine kinase between 10 and 12 p.p.m was observed, indicating the presence of insignificant populations of G-quadruplex(es) Imino protons at  13 p.p.m might suggest the formation of DNA duplex(es) or hairpin(s) involving Watson–Crick base pairs, consistent with the presence of complementary fragments G1–G2–C2–C4–C5–C6 and G15–G16–G17–G18–C19–C20 in TKQ2, which would participate in the formation of the stem of a hairpin or a duplex To further probe the G-quadruplex-forming potential of TKQ1 and TKQ2, we designed two modified sequences, TKQ1m and TKQ2m (Table 1), in which a G-tract was disrupted by G-to-A substitutions For TKQ1m, no sharp imino proton peaks between 10 and 12 p.p.m were observed (Fig 2A, bottom), indicating that the TKQ1 G-quadruplex(es) were disrupted; imino protons at 12–13 p.p.m suggested the formation of a few base pairs of a residual structure such as a hairpin (see gel electrophoresis data below) The imino proton spectrum of TKQ2m (Fig 2B, bottom), like that of TKQ2, exhibited peaks only at  13 p.p.m., indicative of other types of base pairing alignments (e.g Watson–Crick base pairs), rather than those in G-tetrads In order to test the effect of flanking bases on the G-quadruplex formation of TKQ1, we analyzed the NMR spectrum of a DNA sequence containing four additional bases (two on each side) Although the imino proton spectrum of the new sequence was now not well-resolved, and peaks at 13 p.p.m were observed, the presence of peaks at 10–12 p.p.m indicated the existence of G-quadruplexes (Fig S1) TDS of TKQ1 displayed two positive maxima at 245 and 275 nm and one negative minimum at 295 nm In contrast, TDS profiles of TKQ1m, TKQ2 and TKQ2m did not present any negative peak at 295 nm, but only major positive peaks at 250–275 nm, consistent with NMR observations that these sequences did not adopt G-quadruplex structures The G-to-A mutations completely disrupted the G-quadruplex TDS signature of TKQ1, but showed little effect on the TDS of TKQ2 The CD spectra of TKQ1, TKQ1m, TKQ2 and TKQ2m are presented in Fig They show negative peaks at  240 nm and positive peaks from 265 to 290 nm It is difficult to confirm or disprove the formation of G-quadruplexes based solely on CD signatures, particularly if multiple structures coexist [49] It has been reported that parallel-stranded G-quadruplexes give a positive peak at 260 nm and a negative peak at 240 nm, whereas antiparallel-stranded G-quadruplexes give a positive peak at 290–295 nm and a negative peak at 265 nm [54] The CD spectrum of TKQ1 showed a positive peak at 290 nm, a positive shoulder at 260 nm, and a negative peak at 240 nm This spectrum could correspond to a mixture of different G-quadruplex conformations or a mixed parallel ⁄ antiparallel G-quadruplex [47,49,55] The CD profile of TKQ1 was significantly different from that of the modified sequence TKQ1m (Fig 4A), whereas modification of the TKQ2 sequence resulted in only a small spectral change (Fig 4B) This observation is consistent with the NMR and TDS data shown above, supporting the observation that, among the four sequences, only TKQ1 forms a significant population of G-quadruplex(es) A novel G-quadruplex motif of TKQ1 – TDS and CD signatures Thermal stability of TKQ1 – UV melting experiments Thermal difference spectrum (TDS) signatures of TKQ1, TKQ1m, TKQ2 and TKQ2m are shown in Fig Only the TDS profile of TKQ1 exhibited a signature compatible with G-quadruplex structures [53] A To assess the thermal stability of the structures of TKQ1, TKQ1m, TKQ2 and TKQ2m, we performed B 1 0.8 Normalized TDS Fig Normalized UV absorbance TDS of: (A) TKQ1 (continuous line) and TKQ1m (red dotted line); and (B) TKQ2 (continuous line) and TKQ2m (red dotted line) Experimental conditions: DNA concentration, lM; 70 mM KCl; 20 mM potassium phosphate (pH 7.0) Normalized TDS 0.8 0.6 0.4 0.2 0.4 0.2 –0.2 –0.2 –0.4 220 0.6 –0.4 240 260 280 300 Wavelength (nm) 320 220 240 260 280 300 320 Wavelength (nm) FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR) Journal compilation ª 2010 FEBS 4257 G-quadruplex motif in human thymidine kinase A R Basundra et al B 2.5 Molar ellipticity (103 deg·M–1) Molar ellipticity (103 deg·M–1) 2.5 1.5 0.5 –0.5 –1 220 240 260 280 300 Wavelength (nm) 1.5 0.5 –0.5 –1 220 320 240 260 280 300 Wavelength (nm) at 500 mm K+ (Fig 5D) In the cases of TKQ1m, TKQ2 and TKQ2m, the increase in the 295 nm absorbance when the temperature increased and ⁄ or the absence of significant cooperative transitions showed that these sequences did not form G-quadruplexes 0.19 0.185 0.185 0.16 0.17 0.15 0.165 0.14 0.16 20 30 40 50 60 70 80 90 Absorbance at 295 nm 0.175 0.18 0.165 0.175 0.16 0.17 0.165 0.155 0.13 0.16 0.15 20 30 Temperature (°C) D 0.18 0.2 0.192 50 60 70 80 0.17 0.184 0.16 0.176 0.15 0.168 0.16 55 50 Tm (°C) 0.19 0.208 Absorbance at 295 nm Absorbance at 295 nm 40 Temperature (°C) 45 40 35 0.14 20 30 40 50 60 70 Temperature (°C) 80 90 30 100 200 300 400 KCl (mM) 500 90 0.155 Absorbance at 295 nm 0.17 0.18 4258 Native PAGE was performed to assess the molecular sizes and shapes of the structures formed by TKQ1 and TKQ2 A 21-nucleotide oligonucleotide (dT21) for TKQ1 and a 22-nucleotide oligonucleotide (dT22) for TKQ2 were used as controls to check relative mobility TKQ1 migrated faster than dT21 of the same length (Fig 6A), consistent with the formation of a monomeric intramolecular G-quadruplex structure of 0.17 B 0.155 C Native gel electrophoresis 0.18 Absorbance at 295 nm Absorbance at 295 nm melting experiments Folding ⁄ unfolding processes of G-quadruplexes can be monitored by the change in UV absorption at 295 nm as a function of temperature [56] Typical denaturation profiles of TKQ1, TKQ1m, TKQ2 and TKQ2m, as measured by the 295 nm absorbance, are presented in Fig 5A,B At heating and cooling rates of 0.5 °CỈmin)1, the melting and folding profiles were superimposable, indicating equilibrium processes Only TKQ1 exhibited a characteristic profile of G-quadruplex melting curves, with a decrease in the 295 nm absorbance upon increasing temperature The G-quadruplex melting ⁄ folding transition of TKQ1 was more evident in the presence of higher K+ concentrations (Fig 5C) The stability of the structure increased as the K+ concentration increased, and its melting temperature reached 50 °C A 320 Fig CD spectra of: (A) TKQ1 (continuous line) and TKQ1m (red dotted line); and (B) TKQ2 (continuous line) and TKQ2m (red dotted line) Experimental conditions: DNA concentration, lM; temperature, 20 °C; 70 mM KCl; 20 mM potassium phosphate (pH 7.0) Fig UV melting curves recorded at 295 nm, with a DNA concentration of lM (A) TKQ1 (filled circles, left axis) and TKQ1m (red open circles, right axis) The buffer contained 70 mM KCl and 20 mM potassium phosphate (pH 7.0) (B) TKQ2 (filled circles, left axis) and TKQ2m (red open circles, right axis) The buffer contained 70 mM KCl and 20 mM potassium phosphate (pH 7.0) (C) Melting profiles of TKQ1 recorded at different KCl concentrations: 70 mM (continuous line), 300 mM (dotted line), 400 mM (green squares) and 500 mM (red open circles) All experiments were performed in the presence of 20 mM potassium phosphate (pH 7.0) Right axis for 300, 400, 500 mM KCl; left axis for 70 mM KCl (D) Plot of the melting temperature (Tm) of TKQ1 as a function of KCl concentration FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR) Journal compilation ª 2010 FEBS TKQ2m TKQ2 B dT22 dT21 A TKQ1m G-quadruplex motif in human thymidine kinase TKQ1 R Basundra et al Fig Native gel electrophoresis PAGE of potential G-quadruplexforming sequences and their modified variants under nondenaturing (native) conditions (A) dT21 marker, TKQ1, and TKQ1m (B) dT22 marker, TKQ2, and TKQ2m Experimental conditions: 15% nondenaturing polyacrylamide gel, 70 mM KCl in 1· TAE TKQ1 TKQ1m, on the other hand, migrated more slowly than TKQ1 but faster than dT21 The migration profile of TKQ1m is consistent with the disruption of the TKQ1 G-quadruplex structure, resulting in a less compact intramolecular structure (e.g a hairpin, as suggested by NMR data), induced by G-to-A substitutions In contrast, migrations of TKQ2 and TKQ2m were similar and both faster than that of dT22 (Fig 6B) This result was in agreement with NMR, UV and CD data indicating the absence of quadruplex formation by TKQ2: the G-to-A mutation that was designed to specifically disrupt potential quadruplex formation did not induce a significant conformational change A slightly faster migration of TKQ2 and TKQ2m than of dT22 could be explained by the formation of an intramolecular structure, such as a hairpin involving Watson–Crick base pairs transcription of TK1 To test this hypothesis, the functional promoter of TK1 [52] (Fig 1B) was cloned upstream of the firefly luciferase gene in the pGL2 promoter (pTK1), and the promoter activity of pTK1 was measured 24 and 48 h after transfection in A549 cells (see Experimental procedures) The difference in transfection efficiency was normalized with Renilla luciferase expression in each case As discussed above, in vitro, TKQ1 forms an intramolecular G-quadruplex, whereas TKQ1m does not We anticipated that if the G-quadruplex adopted by TKQ1 was involved in the transcription of TK1, specific nucleotide substitutions that disrupted this G-quadruplex (e.g TKQ1m) would alter the luciferase activity We found 2-fold and 2.7-fold increases in promoter activity at 24 and 48 h, respectively, for promoter pTKQ1m (carrying the TKQ1m modification) relative to pTK1 (Fig 7) Furthermore, as an additional control, we studied the sequence TKQ2 (Table 1) Although TKQ2 contains several G-tracts, it was shown that this sequence does not form G-quadruplexes in vitro Therefore, in contrast the situation with TKQ1, we expected that a mutation within TKQ2 would not affect TK1 promoter activity Indeed, we noted no change in the promoter activity of pTKQ2m (carrying the TKQ2m modification) relative to that of pTK1 at 24 h, whereas there was a marginal decrease at 48 h (Fig 7) Taken together, these results suggested that the G-quadruplex adopted by TKQ1 may be involved in suppression of TK1 promoter activity 24 h 48 h Previously, it has been reported that stabilization of a G-quadruplex motif in the c-MYC promoter by the specific ligand TMPyP4 results in decreased promoter activity On the other hand, substitution of a single nucleotide (G to A) that was critical for the G-quadruplex motif gave approximately three-fold increased promoter activity [30] Another such example is PDGF-A, where a stable parallel G-quadruplex motif in the promoter was shown to regulate PDGF-A expression [39] Regulation of transcription by a G-quadruplex motif has also been demonstrated in the case of the KRAS proto-oncogene, where, in the presence of the cationic porphyrin TMPyP4, promoter activity is reduced to 20% of the normal value [38] We hypothesized that formation of a G-quadruplex structure by TKQ1 could be of significance in the Relative fold change 2.5 Base substitutions in TKQ1 result in increased promoter activity 1.5 0.5 pTK1 pTKQ1m pTKQ2m Fig G-quadruplex motif alters the activity of the TK1 promoter Normalized luciferase activity of pTKQ1m and pTKQ2m relative to pTK1 at 24 and 48 h following transfection in human lung cancer cells A549 Error bars in all experiments denote standard deviation observed across three independent experiments FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR) Journal compilation ª 2010 FEBS 4259 G-quadruplex motif in human thymidine kinase Discussion We identified two potential G-quadruplex-forming sequences, TKQ1 and TKQ2 (Fig 1B), within the minimal functional promoter of human TK1, which was taken from )89 to +58 with reference to the TSS In a study by Arcot et al [52], it was shown that progressive deletion of upstream regions from the promoter ()457 to +34 with respect to the TSS) of human TK1 resulted in decreased chloramphenicol acetyltransferase activity, wherein the minimal promoter region from )88 to +34 was shown to have an activity of 28 (normalized chloramphenicol acetyltransferase activity) We were interested in deciphering the effect of two potential G-quadruplex-forming sequences found in this minimal promoter region on promoter activity Of these, TKQ1 showed characteristics of a novel G-quadruplex motif in vitro, whereas TKQ2 did not This was confirmed by incorporating specific nucleotide substitutions within TKQ1 and TKQ2 (TKQ1m and TKQ2m, respectively) that were intended to disrupt the G-quadruplex motif TKQ1m showed clear signs of losing secondary structure; in contrast, TKQ2m did not show any noticeable change These findings were supported by biophysical and biochemical experiments, including NMR, UV and CD spectroscopy and gel electrophoresis Interestingly, we observed that TKQ1, but not TKQ2, appeared to affect the promoter activity of TK1 in A549 cells The fact that disruption of TKQ1, but not TKQ2, leads to an appreciable change in the promoter activity of pTK1 suggests involvement of the G-quadruplex motif formed by TKQ1 in regulating TK1 expression Interestingly, to the best of our knowledge, TKQ1 is the first G-quadruplex motif overlapping a TSS to be reported, and it is therefore possible that it functions independently of any transcription factor binding In line with this, we did not find any transcription factorbinding site overlapping the TKQ1 sequence (searched for with transfac 2.1) The characteristic nature of the TK1 G-quadruplex motif with tracts of two guanines is noteworthy Although this is the first time that it has been studied in a regulatory context, examples of its biological role have been reported Apart from the retinoblastoma susceptibility gene and the thrombin-binding aptamer (see above), GGA triplet repeats that may adopt G-quadruplex motifs with a core of two G-tetrads [44] are widely dispersed throughout eukaryotic genomes, and are frequently located within biologically important gene regulatory regions and recombination hot spots The Bombyx mori telomere repeat d(TTAGG) [42,57] and the yeast telomeric repeat d(TGGTGGC) 4260 R Basundra et al [45] were also shown to form stable G-quadruplex motifs Interestingly, the nick site for adenoassociated virus type on human chromosome 19 was observed to fold into a quadruplex structure The sequence, GGCGGCGGTTGGGGCTCG, indicates a quadruplex motif comprising two G-tetrads in the core [41] In addition to this, RNA sequences containing runs of two guanines could also form quadruplex motifs and be physiological targets of the fragile X mental retardation protein [40] However, we note that the presence of several tracts of two guanines or three guanines does not necessarily imply the formation of two-G-tetrad or three-G-tetrad structures, respectively Recent structural studies of G-quadruplexes [58,59] revealed various unusual folding patterns: for a G-quadruplex formed in the c-MYC promoter [58], a guanine in a continuous G-tract is not involved in the G-tetrad core, but is displaced by a ‘snap-back’ guanine further downstream in the sequence; for a G-quadruplex in the c-KIT promoter [59], an isolated guanine is involved in G-tetrad core formation, despite the presence of four-three-guanine tracts In an analogous way, it is possible that the G-quadruplex motif adopted by the TKQ1 sequence involves not only G-tracts but also one or more isolated guanines in the tetrad formation Consistent with the expectation that a G-quadruplex motif with only two stacked G-tetrads would be of low stability, the melting temperature of the G-quadruplex motif adopted by TKQ1 was  35–40 °C at 90 mm K+, and increased at higher K+ concentrations In contrast to the general belief that such structures may be of limited significance, we observed a significant change in promoter activity that was influenced by the presence ⁄ absence of the G-quadruplex motif formed by TKQ1 Furthermore, one must consider that the formation of such structures in vivo may be facilitated by various cellular factors, proteins or other intracellular ligands Consistent with this, several proteins that bind G-quadruplex motifs have been reported [60], supporting the possibility that quadruplex motifs are sequestered by proteins inside cells, in which case protein recognition would be critical relative to stability per se It can also be argued that motifs of moderate ⁄ low stability could be useful, in relation to stable ones, in potential regulatory roles where the contextual presence ⁄ absence of the structure could be significant However, more evidence is required to distinguish between these possibilities In conclusion, our results identify a novel G-quadruplex motif in the promoter of TK1 and suggest its role as a ‘repressor’ element in the transcription of TK1, as specific disruption of the quadruplex motif resulted in FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR) Journal compilation ª 2010 FEBS R Basundra et al increased promoter activity A role for a G-quadruplex motif constituting two stacks of G-tetrads in gene transcription has not been reported before, and therefore this study opens yet another avenue for exploration of the role of quadruplex motifs Experimental procedures DNA sample preparation Oligonucleotides (Table 1) were chemically synthesized at a lmol scale on an ABI 394 synthesizer, and purified with cartridges (Poly Pack II; Glen Research) as described by the manufacturer All concentrations were expressed in strand molarity, using a nearest-neighbor approximation for the absorption coefficients of the unfolded species [61] Samples were dialyzed successively against  50 mm KCl solution and against water Unless otherwise stated, experiments were carried out in a buffer containing 20 mm potassium phosphate (pH 7) and 70 mm KCl NMR spectroscopy NMR experiments were performed on 600 MHz and 700 MHz Bruker spectrometers at 25 °C Proton spectra in H2O were recorded using JR-type pulse sequences for water suppression [62,63] The DNA concentration in NMR samples was typically 0.5 mm The solution contained 90% H2O and 10% D2O The oligonucleotides were heated at 95 °C for 10 min, and allowed to slowly cool down to room temperature overnight UV melting experiments The thermal stability of different oligonucleotides was characterized in heating ⁄ cooling experiments by recording the UV absorbance at 295 nm as a function of temperature [53], with a Cary 300 VARIAN Bio UV ⁄ Vis spectrophotometer The heating and cooling rates were 0.5 °CỈmin)1 Experiments were performed with cm pathlength quartz cuvettes The DNA concentration was lm All melting profiles were perfectly reversible at the chosen temperature gradient, indicating that these curves corresponded to the equilibrium curves TDSs The TDS of a nucleic acid is obtained by simply recording the UV absorbance spectra of the unfolded and folded states at temperatures, respectively, above and below its melting temperature (Tm) The difference between these two spectra is defined as the TDS The TDS can provide specific signatures of different DNA and RNA structural conformations [50] Spectra were recorded between 220 and G-quadruplex motif in human thymidine kinase 320 nm on a Cary 300 VARIAN Bio UV ⁄ Vis spectrophotometer, using quartz cuvettes with an optical pathlength of cm The DNA concentration was lm CD CD spectra were recorded on a JASCO-810 spectropolarimeter, using a cm pathlength quartz cuvette in a reaction volume of 800 lL The concentration of oligonucleotides was lm They were heated at 95 °C for 10 min, and allowed to slowly cool down to room temperature overnight Scans were performed at 20 °C over a wavelength range of 220–320 nm, with a scanning speed of 200 nm min)1 An average of three scans was taken, the spectrum of the buffer was subtracted, and the data were zero-corrected at 320 nm The spectra were finally normalized to the concentration of the DNA samples Nondenaturing gel electrophoresis Oligonucleotides were end-labeled with [32P]ATP[cP], using T4 polynucleotide kinase Labeled oligonucleotides were purified with Sephadex G25 columns to remove free ATP Corresponding 21-nucleotide and 22-nucleotide marker oligonucleotides (dT21 and dT22) were prepared similarly Labeled oligonucleotides were heated at 95 °C in 20 mm potassium phosphate buffer (pH 7.0) containing 70 mm KCl for 10 min, and then gradually cooled to room temperature overnight The samples were run on nondenaturing 15% polyacrylamide gel containing 70 mm KCl in 1· TAE buffer at 100 V for h Plasmid construction and site-directed mutagenesis The promoter sequence of  151 base pairs, including the minimal functional promoter region based on previous experimental characterization of TK1 [61], was amplified from genomic DNA with forward (5¢-AAATCTCCCCTC GAGTCAGCGG-3¢) and reverse (5¢-AGCTCATTAAGCT TCCGGGAAGTTC-3¢) primers harboring restriction sites for XhoI and HindIII, respectively The amplified product was purified from gel, and then subjected to restriction digestion with both enzymes The digested product was cloned upstream of the firefly luciferase gene in the pGL2 (basic) vector from Promega (Madison, WI, USA), which was also digested with XhoI and HindIII The clones obtained were then screened by restriction digestion with XhoI and HindIII and further confirmed by sequencing Two independent site-directed mutants were made, representing: (a) TKQ1m (with a GG to AA substitution in TKQ1); and (b) TKQ2m (with a G to A substitution in TKQ2; see Table 1) Substitutions were incorporated by the use of primers containing the desired mutation, with the Quick Change Site-Directed mutagenesis Kit from Stratagene, according to the FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR) Journal compilation ª 2010 FEBS 4261 G-quadruplex motif in human thymidine kinase manufacturer’s protocol Plasmids were sequencing to obtain the desired mutant R Basundra et al screened by Transfection and luciferase assay Human lung cancer cell line A549 was cultured in DMEM One day prior to transfection  · 105 cells per well were seeded in a six-well plate to obtain  90–95% confluent cells before transfection Transfection was performed with Lipofectamine 2000 (Invitrogen, Invitrogen BioServices India Pvt Ltd, Whitefield, Bangalore), according to the manufacturer’s protocol For normalization of transfection efficiency, Renilla luciferase plasmid (pGL4 from Promega) was cotransfected in each well Cells were lysed either 24 or 48 h after transfection, and luciferase assays were performed for both firefly (pGL2) and Renilla (pGL4) luciferase in each sample, with the dual luciferase assay kit from Promega, according to the manufacturer’s protocol Firefly luciferase counts were normalized with Renilla luciferase counts Three independent experiments were performed in triplicate, and the results were used for the measurement of standard deviation All reporter assays were conducted at 25 °C Acknowledgements We thank members of the Chowdhury laboratory for helpful discussion and comments on the manuscript, and V Yadav for assistance with making some of the figures This research was supported by fellowships from CSIR (A Kumar and A Verma) and research grants to S Chowdhury from the Department of Science and Technology (DST ⁄ SJF ⁄ LS-03) R Basundra is in receipt of a project fellowship from CMM 0017 (CSIR Task Force Project) Research performed in the Phan laboratory was supported by Singapore Ministry of Education grant ARC30 ⁄ 07, Nanyang Technological University (NTU) grant RG62 ⁄ 07 and Singapore Biomedical Research Council grant 07 ⁄ ⁄ 22 ⁄ 19 ⁄ 542 to A T Phan We thank the Division of Chemistry and Biological Chemistry (NTU School of Physical and Mathematical Sciences) and the NTU School of Biological Sciences for granting us access to their CD spectropolarimeter and NMR spectrometers We thank Professor L Nordenskiold (NTU School of Biological ¨ Sciences) for allowing us to use the UV spectrophotometer of his laboratory References Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES & Kellis M (2005) Systematic discovery of regulatory motifs in human promoters and 3¢ UTRs by comparison of several mammals Nature 434, 338–345 4262 Bacolla A & Wells RD (2004) Non-B DNA conformations, genomic rearrangements, and human disease J Biol Chem 279, 47411–47414 Pedersen AG, Jensen LJ, Brunak S, Staerfeldt HH & Ussery DW (2000) A DNA structural atlas for Escherichia coli J Mol Biol 299, 907–930 Perez-Martin J & de Lorenzo V (1997) Clues and consequences of DNA bending in transcription Annu Rev Microbiol 51, 593–628 Sinden RR (1994) DNA: Structure and Function Academic Press, San Diego Wells RD (2007) Non-B DNA conformations, mutagenesis and disease Trends Biochem Sci 32, 271–278 Hatfield GW & Benham CJ (2002) DNA topology-mediated control of global gene expression in Escherichia coli Annu Rev Genet 36, 175–203 Rich A & Zhang S (2003) Timeline: Z-DNA: the long road to biological function Nat Rev Genet 4, 566–572 Huppert JL & Balasubramanian S (2007) G-quadruplexes in promoters throughout the human genome Nucleic Acids Res 35, 406–413 10 Simonsson T, Pecinka P & Kubista M (1998) DNA tetraplex formation in the control region of c-myc Nucleic Acids Res 26, 1167–1172 11 Burge S, Parkinson GN, Hazel P, Todd AK & Neidle S (2006) Quadruplex DNA: sequence, topology and structure Nucleic Acids Res 34, 5402–5415 12 Davis JT (2004) G-quartets 40 years later: from 5¢-GMP to molecular biology and supramolecular chemistry Angew Chem Int Ed Engl 43, 668–698 13 Gellert M, Lipsett MN & Davies DR (1962) Helix formation by guanylic acid Proc Natl Acad Sci USA 48, 2013–2018 14 Patel DJ, Phan AT & Kuryavyi V (2007) Human telomere, oncogenic promoter and 5¢-UTR G-quadruplexes: diverse higher order DNA and RNA targets for cancer therapeutics Nucleic Acids Res 35, 7429–7455 15 Sen D & Gilbert W (1988) Formation of parallel fourstranded complexes by guanine-rich motifs in DNA and its implications for meiosis Nature 334, 364–366 16 Williamson JR, Raghuraman MK & Cech TR (1989) Monovalent cation-induced structure of telomeric DNA: the G-quartet model Cell 59, 871–880 17 Dunnick W, Hertz GZ, Scappino L & Gritzmacher C (1993) DNA sequences at immunoglobulin switch region recombination sites Nucleic Acids Res 21, 365– 372 18 Weitzmann MN, Woodford KJ & Usdin K (1997) DNA secondary structures and the evolution of hypervariable tandem arrays J Biol Chem 272, 9517–9523 19 Hanakahi LA, Sun H & Maizels N (1999) High affinity interactions of nucleolin with G-G-paired rDNA J Biol Chem 274, 15908–15912 20 Mani P, Yadav VK, Das SK & Chowdhury S (2009) Genome-wide analyses of recombination prone regions FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR) Journal compilation ª 2010 FEBS R Basundra et al 21 22 23 24 25 26 27 28 29 30 31 32 predict role of DNA structural motif in recombination PLoS ONE 4, e4399 Halder K, Halder R & Chowdhury S (2009) Genomewide analysis predicts DNA structural motifs as nucleosome exclusion signals Mol Biosyst 5, 1703–1712 Howell RM, Woodford KJ, Weitzmann MN & Usdin K (1996) The chicken beta-globin gene promoter forms a novel ‘cinched’ tetrahelical structure J Biol Chem 271, 5208–5214 Murchie AI & Lilley DM (1992) Retinoblastoma susceptibility genes contain 5¢ sequences with a high propensity to form guanine-tetrad structures Nucleic Acids Res 20, 49–53 Catasti P, Chen X, Moyzis RK, Bradbury EM & Gupta G (1996) Structure–function correlations of the insulin-linked polymorphic region J Mol Biol 264, 534–545 Kilpatrick MW, Torri A, Kang DS, Engler JA & Wells RD (1986) Unusual DNA structures in the adenovirus genome J Biol Chem 261, 11350–11354 Ma D, Xing Z, Liu B, Pedigo NG, Zimmer SG, Bai Z, Postel EH & Kaetzel DM (2002) NM23-H1 and NM23H2 repress transcriptional activities of nuclease-hypersensitive elements in the platelet-derived growth factorA promoter J Biol Chem 277, 1560–1567 Rankin S, Reszka AP, Huppert J, Zloh M, Parkinson GN, Todd AK, Ladame S, Balasubramanian S & Neidle S (2005) Putative DNA quadruplex formation within the human c-kit oncogene J Am Chem Soc 127, 10584–10589 De AR, Wood S, Sun D, Hurley LH & Ebbinghaus SW (2005) Evidence for the presence of a guanine quadruplex forming region within a polypurine tract of the hypoxia inducible factor 1alpha promoter Biochemistry 44, 16341–16350 Dexheimer TS, Sun D & Hurley LH (2006) Deconvoluting the structural and drug-recognition complexity of the G-quadruplex-forming region upstream of the bcl-2 P1 promoter J Am Chem Soc 128, 5404–5415 Siddiqui-Jain A, Grand CL, Bearss DJ & Hurley LH (2002) Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription Proc Natl Acad Sci USA 99, 11593–11598 Thakur RK, Kumar P, Halder K, Verma A, Kar A, Parent JL, Basundra R, Kumar A & Chowdhury S (2009) Metastases suppressor NM23-H2 interaction with G-quadruplex DNA within c-MYC promoter nuclease hypersensitive element induces c-MYC expression Nucleic Acids Res 37, 172–183 Rawal P, Kummarasetti VB, Ravindran J, Kumar N, Halder K, Sharma R, Mukerji M, Das SK & Chowdhury S (2006) Genome-wide prediction of G4 DNA as regulatory motifs: role in Escherichia coli global regulation Genome Res 16, 644–655 G-quadruplex motif in human thymidine kinase 33 Du Z, Kong P, Gao Y & Li N (2007) Enrichment of G4 DNA motif in transcriptional regulatory region of chicken genome Biochem Biophys Res Commun 354, 1067–1070 34 Yadav VK, Abraham JK, Mani P, Kulshrestha R & Chowdhury S (2008) QuadBase: genome-wide database of G4 DNA – occurrence and conservation in human, chimpanzee, mouse and rat promoters and 146 microbes Nucleic Acids Res 36, D381–D385 35 Zhao Y, Du Z & Li N (2007) Extensive selection for the enrichment of G4 DNA motifs in transcriptional regulatory regions of warm blooded animals FEBS Lett 581, 1951–1956 36 Verma A, Yadav VK, Basundra R, Kumar A & Chowdhury S (2009) Evidence of genome-wide G4 DNA-mediated gene expression in human cancer cells Nucleic Acids Res 37, 4194–4204 37 Verma A, Halder K, Halder R, Yadav VK, Rawal P, Thakur RK, Mohd F, Sharma A & Chowdhury S (2008) Genome-wide computational and expression analyses reveal G-quadruplex DNA motifs as conserved cis-regulatory elements in human and related species J Med Chem 51, 5641–5649 38 Cogoi S & Xodo LE (2006) G-quadruplex formation within the promoter of the KRAS proto-oncogene and its effect on transcription Nucleic Acids Res 34, 2536– 2549 39 Qin Y, Rezler EM, Gokhale V, Sun D & Hurley LH (2007) Characterization of the G-quadruplexes in the duplex nuclease hypersensitive element of the PDGF-A promoter and modulation of PDGF-A promoter activity by TMPyP4 Nucleic Acids Res 35, 7698–7713 40 Darnell JC, Jensen KB, Jin P, Brown V, Warren ST & Darnell RB (2001) Fragile X mental retardation protein targets G quartet mRNAs important for neuronal function Cell 107, 489–499 41 Jang MY, Yarborough OH III, Conyers GB, McPhie P & Owens RA (2005) Stable secondary structure near the nicking site for adeno-associated virus type Rep proteins on human chromosome 19 J Virol 79, 3544– 3556 42 Kettani A, Bouaziz S, Wang W, Jones RA & Patel DJ (1997) Bombyx mori single repeat telomeric DNA sequence forms a G-quadruplex capped by base triads Nat Struct Biol 4, 382–389 43 Macaya RF, Schultze P, Smith FW, Roe JA & Feigon J (1993) Thrombin-binding DNA aptamer forms a unimolecular quadruplex structure in solution Proc Natl Acad Sci USA 90, 3745–3749 44 Matsugami A, Okuizumi T, Uesugi S & Katahira M (2003) Intramolecular higher order packing of parallel quadruplexes comprising a G:G:G:G tetrad and a G(:A):G(:A):G(:A):G heptad of GGA triplet repeat DNA J Biol Chem 278, 28147–28153 FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR) Journal compilation ª 2010 FEBS 4263 G-quadruplex motif in human thymidine kinase 45 Patel PK & Hosur RV (1999) NMR observation of T-tetrads in a parallel stranded DNA quadruplex formed by Saccharomyces cerevisiae telomere repeats Nucleic Acids Res 27, 2457–2464 46 Xu Y & Sugiyama H (2006) Formation of the G-quadruplex and i-motif structures in retinoblastoma susceptibility genes (Rb) Nucleic Acids Res 34, 949–954 47 Lim KW, Amrane S, Bouaziz S, Xu W, Mu Y, Patel DJ, Luu KN & Phan AT (2009) Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers J Am Chem Soc 131, 4301–4309 48 Lim KW, Alberti P, Guedin A, Lacroix L, Riou JF, Royle NJ, Mergny JL & Phan AT (2009) Sequence variant (CTAGGG)n in the human telomere favors a G-quadruplex structure containing a G.C.G.C tetrad Nucleic Acids Res 37, 6239–6248 49 Hu L, Lim KW, Bouaziz S & Phan AT (2009) Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology J Am Chem Soc 131, 16824–16831 50 Phan AT (2010) Human telomeric G-quadruplex: structures of DNA and RNA sequences FEBS J 277, 1107– 1117 51 Bello LJ (1974) Regulation of thymidine kinase synthesis in human cells Exp Cell Res 89, 263–274 52 Arcot SS, Flemington EK & Deininger PL (1989) The human thymidine kinase gene promoter Deletion analysis and specific protein binding J Biol Chem 264, 2343– 2349 53 Mergny JL, Li J, Lacroix L, Amrane S & Chaires JB (2005) Thermal difference spectra: a specific signature for nucleic acid structures Nucleic Acids Res 33, e138 54 Balagurumoorthy P, Brahmachari SK, Mohanty D, Bansal M & Sasisekharan V (1992) Hairpin and parallel quartet structures for telomeric sequences Nucleic Acids Res 20, 4061–4067 ´ ´ 55 Kypr J, Kejnovska I, Renciuk D & Vorlı´ ckova M (2009) Circular dichroism and conformational polymorphism of DNA Nucleic Acids Res 37, 1713–1725 4264 R Basundra et al 56 Mergny JL, Phan AT & Lacroix L (1998) Following G-quartet formation by UV-spectroscopy FEBS Lett 435, 74–78 57 Amrane S, Ang RW, Tan ZM, Li C, Lim JK, Lim JM, Lim KW & Phan AT (2009) A novel chair-type Gquadruplex formed by a Bombyx mori telomeric sequence Nucleic Acids Res 37, 931–938 58 Phan AT, Kuryavyi V, Gaw HY & Patel DJ (2005) Small-molecule interaction with a five-guanine-tract G-quadruplex structure from the human MYC promoter Nat Chem Biol 1, 167–173 59 Phan AT, Kuryavyi V, Burge S, Neidle S & Patel DJ (2007) Structure of an unprecedented G-quadruplex scaffold in the human c-kit promoter J Am Chem Soc 129, 4386–4392 60 Fry M (2007) Tetraplex DNA and its interacting proteins Front Biosci 12, 4336–4351 61 Cantor CR, Warshaw MM & Shapiro H (1970) Oligonucleotide interactions Circular dichroism studies of the conformation of deoxyoligonucleotides Biopolymers 9, 1059–1077 62 Phan AT, Gueron M & Leroy JL (2001) Investigation of unusual DNA motifs Methods Enzymol 338, 341–371 63 Plateau P & Gueron M (1982) Exchangeable proton NMR without base line distortion, using strong pulse sequences J Am Chem Soc 104, 7310–7311 Supporting information The following supplementary material is available: Fig S1 Imino proton spectrum of an extended sequence from TKQ1 This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR) Journal compilation ª 2010 FEBS ...R Basundra et al G-quadruplex motif in human thymidine kinase structural conformations formed by consecutive stacking of coplanar arrays of four cyclic hydrogen-bonded guanines [11 ? ?15 ] G-quadruplex. .. TCGTGATTGGCCAGCACGCCGTGGTTTAAAGCGGTCGGCGCGGGAACCAGGGGCTTAC TGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAATGAGCT FEBS Journal 277 (2 010 ) 4254–4264 ª 2 010 Council of Scientific and industrial research... 0 .19 0 .18 5 0 .18 5 0 .16 0 .17 0 .15 0 .16 5 0 .14 0 .16 20 30 40 50 60 70 80 90 Absorbance at 295 nm 0 .17 5 0 .18 0 .16 5 0 .17 5 0 .16 0 .17 0 .16 5 0 .15 5 0 .13 0 .16 0 .15 20 30 Temperature (°C) D 0 .18 0.2 0 .19 2