Prohibitin is expressed in pancreatic b-cells and protects against oxidative and proapoptotic effects of ethanol ´ Jong Han Lee1, K Hoa Nguyen1, Suresh Mishra1,2 and B L Gregoire Nyomba1,2 Department of Physiology, Diabetes Research Group, University of Manitoba, Winnipeg, Canada Department of Internal Medicine, Diabetes Research Group, University of Manitoba, Winnipeg, Canada Keywords apoptosis; oxidative stress; prohibitin; b-cells Correspondence B L G Nyomba, Diabetes Research Group, University of Manitoba, 715 McDermot Avenue Room 834, Winnipeg, Manitoba, Canada R3E 3P4 Fax: +1 204 789 3940 Tel: +1 204 789 3697 E-mail: bnyomba@cc.umanitoba.ca (Received 19 October 2009, revised 12 November 2009, accepted 19 November 2009) doi:10.1111/j.1742-4658.2009.07505.x Pancreatic b-cell dysfunction is a prerequisite for the development of type diabetes Alcoholism is a diabetes risk factor and ethanol increases oxidative stress in b-cells, whereas the mitochondrial chaperone prohibitin (PHB) has antioxidant effects in several cell types In the present study we investigated whether PHB is expressed in b-cells and protects these cells against deleterious effects of ethanol, using INS-1E and RINm5F b-cell lines Endogenous PHB was detected by western blot and immunocytochemistry Reactive oxygen species were determined by 5-(and-6)-chloromethyl-2¢,7¢-dichlorodihydrofluorescein diacetate fluorescence assay, and mitochondrial activity was assessed by 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyl-tetrazolium bromide (MTT) reduction, uncoupling protein expression and ATP production Cell death was determined by Hoechst 33342 staining, cleaved caspase-3 levels and flow cytometry PHB was expressed in b-cells under normal conditions and colocalized with Hoechst 33342 in the nucleus and with the mitochondrial probe Mitofluor in the perinuclear area In ethanol-treated cells, MTT reduction and ATP production decreased, whereas reactive oxygen species, uncoupling protein and cleaved caspase-3 levels increased In addition, flow cytometry analysis showed an increase of apoptotic cells Ethanol treatment increased PHB expression and induced PHB translocation from the nucleus to the mitochondria PHB overexpression decreased the apoptotic effects of ethanol, whereas PHB knockdown enhanced these effects The protective effects of endogenous PHB were recapitulated by incubation of the cells with recombinant human PHB Thus, PHB is expressed in b-cells, increases with oxidative stress and protects the cells against deleterious effects of ethanol Introduction Pancreatic b-cell dysfunction is a prerequisite for the development of type diabetes The prevalence of type diabetes is related to lifestyle choices, such as high calorie diets, lack of physical activity and smoking Alcoholism is a known risk factor for type diabetes, although moderate ethanol consumption may have health benefits [1] The diabetogenic effects of ethanol may include its contribution to excess caloric intake and obesity, induction of pancreatitis and impairment of liver function [2] Recent studies have found that ethanol increases insulin resistance in liver and skeletal muscle [3–5] However, a limited number of studies Abbreviations CM-H2DCF, 5-(and-6)-chloromethyl-2¢,7¢-dichlorodihydrofluorescein; CM-H2DCFDA, 5-(and-6)-chloromethyl-2¢,7¢-dichlorodihydrofluorescein diacetate; FITC, fluorescein isothiocyanate; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; NaCl ⁄ Pi, phosphate-buffered saline; PHB, prohibitin; ROS, reactive oxygen species; SEM, standard error of the mean; siRNA, short inhibitory RNA; UCP2, uncoupling protein 488 FEBS Journal 277 (2010) 488–500 ª 2009 The Authors Journal compilation ª 2009 FEBS J H Lee et al Results Effects of ethanol and recombinant PHB on b-cell mitochondrial function and apoptosis We first generated a dose–response curve of ethanol toxicity using the 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyl-tetrazolium bromide (MTT) assay in INS-1E cells incubated with ethanol for 24–48 h (Fig 1) At 24 h there was a statistically significant deleterious effect starting at 80 mm ethanol (Fig 1A), confirming our previous report in RINm5F cells [26] At this concentration, MTT reduction was decreased by  30% (Fig 1A); this effect of ethanol did not increase further after treatment of INS-1E cells for 48 h (Fig 1B) This effect was comparable with that observed in RINm5F cells at a low glucose concentration of 5.5 mm (Fig 2A), which is much lower than glucose concentrations recommended for b-cell culture [27] We then determined ROS production in RINm5F cells and found that ethanol increased ROS production by 43%, unlike the low glucose concentration, which decreased ROS production by  80% compared with the high glucose concentration (Fig 2B) Because oxidative stress can induce uncoupling protein (UCP2) expression at the expense of ATP synthe- MTT (% of control) A 120 100 * 80 * 60 40 20 0 20 mM 40 mM 60 mM 80 mM 100 mM ETOH B 120 100 MTT (% of control) have reported on deleterious effects of ethanol on b-cells, where ethanol inhibited insulin secretion [6–8] Excessive ethanol consumption leads to cell injury through the production of reactive oxygen species (ROS) and mitochondrial dysfunction [9,10] Increased ROS production is one of the earliest events in glucose intolerance and it may be a mechanism of pancreatic b-cell dysfunction in type diabetes, as b-cells are very sensitive to oxidative stress due to their insufficient antioxidant mechanisms Prohibitin (PHB), a 30 kDa evolutionarily conserved protein, is present in multiple cellular compartments [11], including the cell nucleus [12], the plasma membrane [13–15] and lipid droplets shed from adipocytes [16] and breast cancer cells [17] PHB is an anti-inflammatory [18] and tumor suppressor protein, with mutations occurring in various cancers [19] Recent studies suggest that PHB may be a regulator of transcription, a chaperone in the mitochondria [20,21] and a secreted protein [22] found in the circulation [23] It is possible that PHB, in its role as a mitochondrial chaperone, protects cells against oxidative stress [21,24,25] However, it is not known if PHB is expressed or plays a role in pancreatic b-cells The objective of the present study was to investigate the expression and antioxidant effects of PHB in pancreatic b-cells exposed to ethanol Effects of prohibitin in b-cells * 80 * * * * 60 40 20 0 20 mM 40 mM 80 mM 120mM 160 mM 200 mM ETOH Fig Effect of ethanol on MTT reduction in INS-1E cells INS-1E cells were incubated for 24 (A) or 48 h (B) in RPMI 1640 medium containing various concentrations of ethanol The results are expressed as a percentage of the control (no ethanol) and shown as the mean ± SEM N = experiments *P < 0.05 versus control sis [28], we then determined the level of UCP2 protein and ATP production in RINm5F cells Ethanol increased the UCP2 protein level by 42% (Fig 2C), in direct proportion with ROS production, whereas ATP production decreased by  40% (Fig 2D), in inverse proportion with the UCP2 protein level Because exogenously applied PHB has been shown to regulate cell metabolism in adipocytes [29], we were also interested in the effects of recombinant PHB on b-cells In ethanol-exposed cells, ROS production (Fig 2B) and UCP2 protein levels (Fig 2C) were both significantly reduced, whereas ATP production was increased, by exogenous PHB treatment (Fig 2D) To explore ethanol toxicity further, we examined b-cell apoptosis using flow cytometry with fluorescein isothiocyanate (FITC)–annexin V staining, the cleaved caspase-3 assay and Hoechst 33342 nuclear staining In cells exposed to ethanol, flow cytometry revealed the apoptotic cell number to be increased by approximately twofold (Fig 3A–F), whereas the cleaved caspase-3 level increased by  40% (Fig 3G) Recombinant PHB prevented b-cell apoptosis, as demonstrated by the normal number of apoptotic cells shown by flow cytometry FEBS Journal 277 (2010) 488–500 ª 2009 The Authors Journal compilation ª 2009 FEBS 489 Effects of prohibitin in b-cells n=7 A n=3 P < 0.01 120 J H Lee et al B P < 0.01 180 P = 0.08 P < 0.01 140 ROS (% of control) MTT (% of control) P < 0.05 P < 0.01 160 100 80 60 40 120 100 80 60 40 20 20 0 G1 C 1.4 G2 G2E P < 0.01 G2P G2EP P < 0.01 P < 0.01 G1 P < 0.01 800 0.8 0.6 0.4 0.2 G1 G2 G2E G2P G2EP ATP (nmol·mg–1 protein) UCP2 (arbitrary units) G2P G2EP P < 0.01 P < 0.05 1.0 G2E D P < 0.05 1.2 G2 P < 0.01 600 400 200 UCP2 Actin G1 G2 (Fig 3A–F) and a reduction in the cleaved caspase-3 level (Fig 3G) In addition, with Hoechst staining the nuclei appeared small and condensed after ethanol exposure (Fig 4A), also consistent with increased apoptosis, but had a normal appearance after PHB treatment Cellular distribution of exogenous PHB The fact that exogenous PHB had protective effects against ethanol prompted us to determine the cellular distribution of recombinant His-tagged PHB Using a fluorescence microscope, the His-tagged PHB did not localize to the nucleus, but showed a perinuclear distribution and colocalized with the mitochondrial dye MitofluorTM Red 589, confirming translocation of exogenous PHB to the mitochondria (Fig 4B,C) A western blot of total cellular protein extracts using anti-PHB serum showed two bands in cells incubated with recombinant PHB, the top band corresponding to His-tagged PHB (Fig 5A) These data indicate that exogenous PHB enters the cells PHB is expressed in b-cells and increased by ethanol To determine the expression of PHB in b-cells we first analyzed the PHB protein level by western blot and mRNA expression We confirmed that PHB protein was present in b-cells, had a tendency to increase at 490 G2E G2P G2EP Fig Effect of ethanol and PHB in RINm5F cells RINm5F cells were incubated for 24 h with or without ethanol (E, 80 mM) and with or without PHB (P, 10 nM) in the presence of glucose (G1: 5.5 mM, G2: 25 mM) MTT (A; n = 3–7 experiments), ROS level (B; n = experiments); UCP2 protein level (C; n = experiments) and ATP production (D; n = experiments) were determined as described in Materials and methods The results are expressed as the mean ± SEM percentage of G2 for (A) and (B); as the mean ± SEM arbitrary units relative to actin for (C); and as the mean ± SEM for (D) the low (5.5 mm) compared with the high (25 mm) glucose concentrations, and clearly increased by 92% in cells treated with ethanol (Fig 5A,B) PHB mRNA expression showed a similar expression pattern as the protein level (Fig 5C) To confirm mitochondrial localization, cell extracts were fractionated prior to western blot analysis In cells exposed to ethanol, western blot analysis showed a decrease in PHB protein in the nuclear fraction (Fig 5D) and an increase in the cytoplasmic fraction (Fig 5E), suggesting PHB protein exclusion from the nucleus, whereas examination of mitochondrial extracts indicated localization of PHB to the mitochondria (Fig 5F,G) We also used immunocytochemistry and found endogenous PHB to be present in the nucleus and in the perinuclear area (Fig 6C), the latter suggesting mitochondrial localization Endogenous PHB protects b-cells against ethanol toxicity Because endogenous PHB has been reported to have antiapoptotic effects in other cell systems [12,30], we sought to investigate whether it protects b-cells against ethanol toxicity PHB overexpression (Fig 7A) decreased the cleaved caspase-3 level (Fig 7B) and increased MTT reduction (Fig 7C) in ethanol-treated cells PHB had a similar effect in cells treated with H2O2 In other experiments, cells were transfected with FEBS Journal 277 (2010) 488–500 ª 2009 The Authors Journal compilation ª 2009 FEBS J H Lee et al Effects of prohibitin in b-cells 100 101 102 103 Annexin V-FITC log G 3.1% 100 101 102 103 PI log F 23.7% F 10.6% G 12.4% 126 60 D 124 C 76 F 9.7% G 3.7% Cleaved caspase (arbitrary units) 100 101 102 103 100 101 102 103 Annexin V-FITC log PI log 132 G 5.6% Cell number F 13.7% G 54 118 B 54 A P < 0.05 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 G1 G2 G1 100 101 102 103 100 101 102 103 PI log Annexin V-FITC log 100 101 102 103 100 101 102 103 Annexin V-FITC log PI log F 100 101 102 103 Annexin V-FITC log G 2.5% P < 0.05 P < 0.01 100 101 102 103 PI log Cleaved caspase P < 0.01 G2P G2EP G2 G2E G2P G2EP ~ 19 kDa ~ 17 kDa Actin 40 % of apoptotic cells F 10.4% 158 80 E G2E 35 30 25 20 15 10 G1 G2 G2E G2P G2EP Fig Effect of ethanol and PHB on apoptosis in RINm5F cells RINm5F cells were incubated for 24 h as described in Fig Apoptosis was then determined by flow cytometry Histograms from representative flow cytometry experiments are shown in (A)–(E): (A) G1; (B) G2; (C) G2E; (D) G2P; (E) G2EP The percentage of apoptotic cells (percentage of FITC–annexin V versus propidium iodide-positive cells) obtained from four independent experiments using each treatment are shown as the mean ± SEM in (F) As an additional proof of apoptosis, cleaved caspase-3 was determined in cell extracts by western blot (G) Representative blot of n = experiments showing 17 and 19 kDa caspase-3 cleavage bands and the levels of 19 kDa cleaved caspase-3 expressed as the mean ± SEM arbitrary units relative to actin PHB short inhibitory RNA (siRNA) (Fig 8A,B) prior to ethanol treatment, and this caused an increase in cleaved caspase-3 in both RINm5F (Fig 8C) and INS-E1 cells (Fig 8D) In a different approach, apoptosis of RINm5F cells was determined by counting free floating cells (Fig 8E) and found to be enhanced in ethanol-treated cells transfected with PHB siRNA Discussion Here we report for the first time that PHB is expressed in pancreatic b-cells and may protect these cells against oxidative stress and apoptosis We induced oxidative stress and apoptosis with ethanol, which has been demonstrated in other cell types to cause such deleterious effects [31,32] Ethanol has also been shown in a small number of studies to alter pancreatic b-cell function Rats chroni- cally fed ethanol showed reduced b-cell volume [33], and it has been reported that ethanol inhibits basal and glucose-stimulated insulin secretion in rat islets [6,34,35] In a recent report, ethanol inhibited b-cell metabolic activity judged by the MTT assay [34], in agreement with the current study We found that ethanol resulted in b-cell apoptosis with mitochondrial dysfunction shown by decreased MTT metabolism and ATP production, and increased ROS production and UCP2 levels These alterations occurred at a physiologically relevant ethanol level of 80 mm (368 mgỈdL)1) found in the blood of clinically nonintoxicated alcohol drinkers [36] ROS have been implicated in b-cell dysfunction and apoptosis in rodent models of diabetes [37–40], and changes in mitochondrial function, including increased ROS and UCP2 expression, lower ATP and a decreased ATP ⁄ ADP ratio have also been documented in b-cells from patients with type diabetes FEBS Journal 277 (2010) 488–500 ª 2009 The Authors Journal compilation ª 2009 FEBS 491 Effects of prohibitin in b-cells G1 G2 J H Lee et al G2E G2P G2EP A B C Fig Localization of exogenous PHB in RINm5F cells RINm5F cells were incubated for 24 h as described in Fig (n = experiments) (A) Hoechst 33342 (nuclei) staining; (B) Mitofluor Red 589 (mitochondria) staining; (C) anti-His (exogenous PHB)-FITC staining; (D) merge The arrows indicate staining of His-tagged PHB in (C) or both PHB and Mitofluor in (D) D [41] Our recent study [26] and present data indicate that ethanol causes oxidative stress in b-cells, which could be deleterious, especially because these cells have very low expression of antioxidant enzymes and are particularly sensitive to oxidative stress [42] RINm5F cell mitochondrial metabolism, as determined by MTT, at a 5.5 mm glucose concentration was  35% less than that recorded at a 25 mm glucose concentration, whereas ROS production at the lower glucose concentration was  80% less than that found at the high glucose concentration These results are consistent with increased oxidative phosphorylation, which is the source of ROS, at glucose concentrations significantly greater than 5.5 mm in these cells Although PHB is known to be expressed in many tissues, this is the first report of its expression in pancreatic b-cells Under normal conditions, PHB is found in cell nuclei and the perinuclear area corresponding to mitochondria, as reported in other cells [12,30] In b-cells treated with ethanol, the PHB protein level increased and was predominantly found in the mitochondria This finding is consistent with reports in breast cancer cells showing that PHB is exported from 492 the nucleus upon apoptotic signaling [12,30] The increase in PHB and its export from the nucleus with subsequent mitochondrial localization following ethanol exposure prompted us to investigate whether PHB affected mitochondrial function in these cells Because PHB is found in the circulation, we hypothesized that it may enter the cells His-tagged recombinant human PHB was shown to enter the cells and localize to the mitochondria, especially in ethanol-treated cells In addition, exogenous PHB or overexpression of endogenous PHB prevented metabolic alterations caused by ethanol, whereas PHB deletion by siRNA enhanced ethanol toxicity These findings are reminiscent of recent reports in granulosa cells, where overexpression of PHB attenuated the ability of staurosporine and serum withdrawal to induce apoptosis [12,25,30,43] When granulosa cells were transfected with a PHB– green fluorescence protein fusion construct, this fusion protein moved from the cytoplasm into the mitochondria and inhibited apoptosis In a more recent study, Theiss et al [24] reported that in inflammatory bowel diseases, PHB localizes primarily FEBS Journal 277 (2010) 488–500 ª 2009 The Authors Journal compilation ª 2009 FEBS J H Lee et al Effects of prohibitin in b-cells G1 A G2 G2E G2P G2EP His -PHB D His-PHB 30 kDa PHB G1 G2 G2E G2P G2EP PHB Histone H1 Actin PHB (arbitrary units) B E P < 0.05 1.4 G2 G2E G2P G2EP PHB Actin 1.2 1.0 0.8 F 0.6 1.4 0.4 1.2 G1 G2 G2E G2P G2EP P < 0.05 C 1.6 P < 0.01 Arbitrary units 0.2 P < 0.05 P = 0.06 1.0 0.8 0.6 0.4 1.4 0.2 1.2 Fold over G2 G1 1.6 G1 1.0 G2 G2E G2P G2EP 0.8 G 0.6 0.4 G1 G2 G2E G2P G2EP PHB 0.2 Heat shock protein 60 G1 G2 G2E G2P G2EP Fig Effect of ethanol and exogenous PHB on PHB expression and localization of endogenous PHB in RINm5F cells RINm5F cells were incubated for 24 h as described in Fig Cell extracts were immunoblotted with anti-PHB (A) A representative western blot of recombinant human PHB run in parallel with cell extracts The 30 kDa endogenous PHB band is seen below the His-tagged recombinant PHB (exogenous PHB) (B) Endogenous PHB protein (30 kDa) expressed as the mean ± SEM arbitrary units relative to actin (n = experiments) (C) PHB mRNA expressed as the mean ± SEM fold of G2 (n = experiments) (D) A representative western blot of PHB in the nuclear fraction with histone H1 as the nuclear marker (n = experiments) (E) A representative western blot of PHB in the cytoplasmic fraction (n = experiments) (F) Endogenous PHB protein in the mitochondrial fraction, expressed as the mean ± SEM arbitrary units relative to the mitochondrial marker heat shock protein 60 (n = experiments) (G) A representative western blot of endogenous PHB protein in the mitochondrial fraction to the mitochondria and that PHB overexpression decreases ROS accumulation in intestinal epithelial cells and protects these cells from oxidant-induced depletion of glutathione It has been reported that PHB plays a chaperone role in the stabilization of newly synthesized subunits of mitochondrial respiratory enzymes [44] PHB is essential for normal mitochondrial development and its deficiency in yeasts and Caenorhabditis elegans is associated with deficient mitochondrial function [44] and a reduced life span [45,46] Our findings in b-cells, which are in agreement with findings in yeasts, C elegans, and granulosa and intestinal cells, are in contradiction with recent observations in other cell types Vessal et al [29] reported that PHB, when added to fibroblasts or adipocytes, is a potent inhibitor of mitochondrial function Furthermore, they reported that PHB inhibits the mitochondrial enzyme pyruvate carboxylase, thereby depleting oxaloacetate and inhibiting anaplerosis and, consequently, oxidative phosphorylation As a consequence, mitochondrial glucose and fatty acid oxidation was inhibited [29] Through this mechanism, PHB would be expected to have deleterious effects on glucose-induced insulin secretion from pancreatic b-cells, which is dependent on glucose oxidation and mitochondrial ATP biosynthesis [47] Taken together, these observations suggest cell type differences in PHB action that need to be confirmed in further studies The present study did not address the mechanism whereby PHB is excluded from the nucleus or internalized Rastogi et al [48] recently reported that PHB contains a leucine-rich nuclear export signal that facilitates its cytoplasmic translocation PHB internalization has not been previously reported and its mechanisms are still unknown, but could involve a lipid raft or caveolin-dependent process, as PHB is present on the cell membrane in lipid rafts [17,49]; in some cells, PHB is abundant in the caveolin-1-rich fractions [50] Caveolins and lipid rafts are involved in the internalization of various molecules [51,52] Vessal et al [29] identified EH domain as a binding partner for PHB, and both EH domain and PHB have been identified in lipid droplets released from 3T3L1 cells [16] EH domain FEBS Journal 277 (2010) 488–500 ª 2009 The Authors Journal compilation ª 2009 FEBS 493 Effects of prohibitin in b-cells G1 G2 J H Lee et al G2E G2P G2EP A B C Fig Cellular distribution of endogenous PHB in RINm5F cells RINm5F cells were incubated for 24 h as described in Fig and then processed for immunocytochemistry as described in the Materials and methods (n = experiments) (A) Hoechst 33342 (nuclei) staining; (B) Mitofluor Red 589 (mitochondria) staining; (C) anti-PHB ⁄ anti-rabbit-FITC staining; (D) merge Arrows indicate staining of PHB D proteins have been shown to be involved in endocytosis and vesicle recycling [53] In summary, we found that PHB is expressed in pancreatic b-cells and increases with oxidative stress induced by ethanol exposure, possibly to protect b-cells against oxidative and proapoptotic effects of this drug If PHB protects against oxidative stress induced by other b-cell toxins, it could be a target for diabetes prevention or treatment Materials and methods Materials His-tagged recombinant human PHB was purchased from AmProx American Proteomics (Carlsbad, CA, USA) For overexpression of PHB, pCMV6 XL5 vector containing the human PHB gene was obtained from Origene Technologies (Rockville, MD, USA) The following antibodies or reagents were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA): a rabbit polyclonal anti-PHB serum (sc-28259), His-probe antibody (sc-10806), anti-histone H1 serum (sc-803), heat shock protein 60 antibody (sc-13966), anti-rabbit-FITC (sc-2012), mouse PHB siRNA (sc-37630), control siRNA-A (sc-37007), siRNA transfec- 494 tion reagent (sc-29528), siRNA transfection medium (sc-36868) and horseradish peroxidase-conjugated secondary antibody (sc-2004) Anti-UCP2 serum (ucp21-s) was obtained from Alpha Diagnostic International (San Antonio, TX, USA) Anti-cleaved caspase-3 serum (# 9661) and anti-caspase-3 serum (# 9665) were obtained from Cell Signaling Technology (Danvers, MA, USA) RINm5F rat insulinoma cells (ATCC # CRL-11605) and RPMI 1640 medium (ATCC # 30-2001) were purchased from the American Type Culture Collection (Manassas, VA, USA) INS-1E cells were provided by M Wheeler (University of Toronto) with permission from C Wollheim (University of Geneva) Fetal bovine serum, trypsin ⁄ EDTA, penicillin, streptomycin and the Vybrant apoptosis assay kit (#V13242) were obtained from Invitrogen (Burlington, Canada) Electrophoresis and electroblotting materials were obtained from Bio-Rad (Hercules, CA, USA) The enhanced chemiluminescence kit was obtained from Amersham Biosciences (Piscataway, NJ, USA) Protease inhibitor cocktail tablets were purchased from Roche Diagnostics (Penzberg, Germany) Microplates and cell culture flasks were obtained from Corning Incorporated (Corning, NY, USA) The mitochondrial dye MitofluorTM Red 589 (M22424), anti-His-FITC (C6826), Hoechst 33342 (H3570) and 5-(and-6)-chloromethyl-2Â,7Â-dichlorodihydrouorescein FEBS Journal 277 (2010) 488500 ê 2009 The Authors Journal compilation ª 2009 FEBS J H Lee et al Effects of prohibitin in b-cells Vector A streptomycin at 5% CO2 and 37 °C For INS-1E cells, the medium also contained 50 lm 2-mercaptoethanol Briefly, cells were cultured for 1–2 days until  70% confluence The cells were subsequently incubated for 24 h with or without ethanol or recombinant human PHB (10 nm) This PHB concentration was chosen as it corresponds to the half-maximal concentration shown to inhibit insulin-stimulated glucose oxidation and pyruvate carboxylase in adipocytes [29] The ethanol dosage was determined using a dose–response curve in RINm5F [26] and INS-1E cells (see Results) PHB PHB Actin PH B Ve Ve c cto tor r _E TO PH B_ ET OH H B Caspase Cleaved caspase PHB siRNA transfection Actin To transfect with siRNA, INS-1E and RINm5F cells were cultured in antibiotic-free RPMI 1640 medium for 24 h The transfection was performed at  70% of cell confluency to increase the transfection efficiency The transfection was completed by incubating the cells for h in siRNA transfection medium supplied by the manufacturer without serum and antibiotics According to the manufacturer, the PHB siRNA is a pool of three target-specific 19–25 nucleotide siRNAs with the following sequences: 120 MTT (% of control) C 100 * * 80 60 40 20 B_ H 2O OH ET B_ PH PH B PH 2O r_H cto Ve Ve cto r_E Ve TO cto r H Fig Effect of overexpression of PHB on ethanol-induced apoptosis in INS-1E cells INS-1E cells were transfected with pCMV6-XL5 vector containing the human PHB clone and subsequently incubated with 80 mM ethanol for 24 h (A) A representative western blot of three experiments showing the PHB protein expression level after transfection (B) A representative western blot of caspase-3 and cleaved caspase-3 in cell extracts (n = experiments) (C) MTT reduction after incubation with 80 mM ethanol (ETOH) or 10 lM H2O2, expressed as the mean ± SEM percentage of vector *P < 0.05 versus siRNA control diacetate (CM-H2DCFDA; P ⁄ N46-0309) were obtained from Molecular Probes (Burlington, Canada) Ethanol was obtained from the Pharmaceutical Services of the Health Sciences Centre (Winnipeg, Canada) Anti-actin serum (A5441), MTT, ATP bioluminescent assay kit (FL-AA) and all other chemicals were purchased from Sigma-Aldrich (Mississauga, Canada) For real-time PCR, Optical 96-well reaction plates (4306737), Power SYBR green PCR master mix (4367659) and Optical adhesive film (4311971) were purchased from Applied Biosystems (Foster City, CA, USA) 360 CAGCTTCCTCGTATCTACATTCAAGAGATG TAGATACGAGGAAGCTGTTTTT; 1179 CCATTCTGCCGTATATTGATTCAAGAGA TCAATATACGGCAGAATGGTTTTT; 1624 CTCAGAGATTGCCCTTTCTTTCAAGAGA AGAAAGGGCAATCTCTGAGTTTTT The cells were then washed and replaced in fresh normal growth medium After 24 h, the cells were incubated in the medium with or without ethanol for 24 h Floating (apoptotic) cells were resuspended by gently swirling the culture medium and harvested by mild centrifugation; attached cells were collected after mild trypsinization [54,55] Cell counting was performed using a Beckman Coulter Z2 particule count and size analyzer The ratio of floating to attached cells was used as an index of apoptosis PHB overexpression INS-1E cells were cultured for 24 h before transfection with a pCMV6-XL5 vector containing a human PHB clone The transfection was performed at  70% of cell confluency using a FuGENE HD transfection reagent (Roche Applied Science, Laval, Canada) according to the protocol supplied with the manufacturer’s instructions The cells were then washed at 24 h and replaced in fresh normal growth medium with or without ethanol or 10 lm H2O2 for 24 h MTT assay Cell culture and treatment INS-1E and RINm5F cells were grown in RPMI 1640 medium containing 10% fetal bovine serum, 1% penicillin and For the MTT assay, culture media were replaced by phosphate-buffered saline (NaCl ⁄ Pi) containing 0.5 mgỈmL)1 MTT and the incubation continued for h The MTT- FEBS Journal 277 (2010) 488–500 ª 2009 The Authors Journal compilation ª 2009 FEBS 495 Effects of prohibitin in b-cells siRNA Control siRNA PHB siRNA Control siRNA PHB B PHB Actin PHB PH B_ ET OH TO H NA siR tro AP HB l_E siR N ol Ac on ntr co siR A NA PH PH B B_ ET OH D siR N s iR NA siR NA siR NA tro l C tro l_E TO H Actin siR N A J H Lee et al Caspase Caspase Cleaved caspase Cleaved caspase Fig Effect of PHB siRNA on ethanolinduced apoptosis in RINm5F and INS-1E cells RINm5F (A,C,E) and INS-1E (B,D) cells were transfected with PHB gene siRNA or control siRNA and subsequently incubated with 80 mM ethanol for 24 h Representative western blot of PHB protein expression (A,B) and caspase-3 (C,D) after siRNA transfection in RINm5F (A,C) and INS-1E (B,D) cells (E) Percentage ratio of floating ⁄ attached cells expressed as the mean ± SEM *P < 0.05 versus siRNA control, **P < 0.01 versus siRNA control, #P < 0.05 versus siRNA control_EtOH, $P = 0.056 versus PHB siRNA For each condition, n = experiments Actin Actin E 300 **# $ Floating/attached cells Ratio (% of siRNA control) 250 200 * 150 * 100 50 siRNA Control siRNA Control_ETOH siRNA PHB siRNA PHB_ETOH containing medium was removed after h and replaced with 200 lL dimethyl sulfoxide to dissolve the formazan The cells were left for 30 at room temperature The reduction of MTT to formazan was quantified by measuring the absorbance at 540 and 630 nm using a Spectra Max 340 plate reader (Molecular Devices, Sunnyvale, CA, USA) Each experiment was conducted at least three times, as shown in the Results, and each treatment was conducted in triplicate ROS assay The production of ROS was determined using the fluorescent probe CM-H2DCFDA This probe passes freely through the cell membrane and is cleaved by intracellular esterase into its nonfluorescent form 5-(and-6)-chloromethyl-2¢,7¢-dichlorodihydrofluorescein (CM-H2DCF) CMH2DCF is oxidized into the highly fluorescent compound CM-DCF [5-(and-6)-chloromethyl-2¢,7¢-dichlorofluorescein] in the presence of ROS [56] Briefly, after cell culture and treatment, the media were replaced by RPMI 1640 containing lm CM-H2DCFDA and the plates were incubated at 37 °C for h The medium containing CM-H2DCFDA was removed and replaced with 100 lL NaCl ⁄ Pi The oxidized fluorescent compound was measured at the excitation length 488 nm and emission length 505 nm using the SpectraMax 496 Gemini XS fluorescence microplate reader with the softmax pro software (Molecular Devices) Flow cytometry Cells were washed with cold NaCl ⁄ Pi, resuspended in 100 lL annexin-binding buffer and serially stained with lL FITC–annexin V and lL propidium iodide for 15 at room temperature according to the manufacturer’s instructions After 15 min, the reaction was stopped by adding 400 lL annexin-binding buffer The stained cells were immediately analyzed by flow cytometry using a highspeed Beckman Coulter EPICS ALTRA flow cytometer (Beckman Coulter Canada Inc., Mississauga, Canada) randomly analyzing up to · 104 cells Histograms were acquired and analyzed using the expo 32 multi comp mfa software, version 1.2B, supplied with the instrument ATP measurement The cellular ATP concentration was measured using an ATP bioluminescent assay kit according to the manufacturer’s instructions The calibration curve was generated using serial dilutions of an ATP standard from · 10)7 to · 10)3 m The same amount of cell extract was mixed with 100 lL luciferase assay reagent in disposable polystyrene FEBS Journal 277 (2010) 488–500 ª 2009 The Authors Journal compilation ª 2009 FEBS J H Lee et al tubes, and incubated at room temperature for The light produced was immediately measured for 30 s with an LB 9507 Lumat luminometer (Berthold, Bad Wildbad, Germany) Protein extraction To prepare the total protein fraction, culture media were removed and the cells were incubated with 0.05% trypsin ⁄ 0.02% EDTA After washing, the cells were resuspended in 30 lL lysis buffer (1% Igepal, 0.1% SDS, 0.5% deoxycholic acid, mm phenylmethanesulfonyl fluoride in NaCl ⁄ Pi, pH 7.2 and protease inhibitors) After vigorous vortexing, the cells were placed on ice for 30 min, and then the homogenates were centrifuged at 16 000 g, °C, for 20 The supernatants were collected and stored at – 25 °C until use The nuclear fraction was prepared as described previously [57] After incubation with 0.05% trypsin ⁄ 0.02% EDTA, the cells were resuspended in 400 lL cold buffer A (10 mm KCl, 0.1 mm EGTA, 0.1 mm EDTA, mm dithiothreitol, 10 mm Hepes, pH 7.9 and protease inhibitors) by gently mixing The cells were placed to swell on ice for 15 min, and then 10 lL 1% Igepal was added After vigorous vortexing for 10 s, the homogenates were centrifuged at 16 000 g, °C, for 30 s The supernatants (cytoplasm fractions) were stored at )25 °C until use The pellets were resuspended in 50 lL ice-cold buffer B (0.4 m NaCl, mm EGTA, mm EDTA, mm dithiothreitol, 20 mm Hepes, pH 7.9 and protease inhibitors) by gently mixing The nuclear homogenates were centrifuged at 16 000 g, °C, for The supernatants (nuclear fractions) were stored as above The mitochondria fraction was prepared as described previously [58] Briefly, cells were collected with 0.05% trypsin ⁄ 0.02% EDTA After washing, the cells were homogenized in 100 lL isotonic buffer (25 mm mannitol, 70 mm sucrose, mm dithiothreitol, mm EGTA, mm Hepes, pH 7.4 and protease inhibitors) The homogenates were centrifuged at 600 g, °C, for to remove nuclear and cell debris The resulting supernatant was subsequently centrifuged at 5500 g, °C, for 10 to yield the mitochondrial fraction The mitochondrial fraction was stored at –25 °C until use The protein concentration in each fraction was determined by using the Bio-Rad assay with BSA as the standard Western blot analysis Equal amounts of protein were subjected to SDS ⁄ PAGE after boiling at 95 °C for and then transferred to a nitrocellulose membrane using a semidry blot apparatus (Trans-Blot SD Cell, Bio-Rad) After transfer, the membrane was blocked for h at room temperature with 5% nonfat dry milk in Tris-buffered saline ⁄ 0.1% Tween 20 The membrane was then rinsed twice with Tris-buffered saline ⁄ 0.1% Effects of prohibitin in b-cells Tween 20 and incubated with a primary antibody at room temperature for h After further washing, the membrane was incubated with horseradish peroxidase-conjugated secondary antibody for h and washed twice for with Tris-buffered saline ⁄ 0.1% Tween 20 Immune complexes were detected using the enhanced chemiluminescence detection kit The same membrane was subsequently stripped with 15 mL strip buffer (100 mm 2-mercaptoethanol, 2% SDS, 62.5 mm Tris ⁄ HCl, pH 6.7) at 50 °C for 30 and reprobed with anti-actin, anti-heat shock protein 60 or anti-histone H1 serum as appropriate Quantitative image analysis was performed using NIH image j software to determine the intensity of the individual proteins Determination of mRNA expression PHB and actin gene expression was also determined by real-time PCR, using as primers: PHB: 5¢-GATTTACAG ACAGTGGTGCACACA-3¢ (forward), 5¢-GGGTTCGTAT GGCTGGAAAA-3¢ (reverse); actin: 5¢-AGGGAAATCG TGCGTGACAT-3¢ (forward), 5¢-GAACCGCTCATTGCC GATAG -3¢ (reverse) The cDNA was synthesized with lg total RNA using SuperScriptII RNaseH reverse transcriptase and random primer (Invitrogen) The primers used in real-time PCR were designed using primer express software (version 3.0, Applied Biosystems) The reactions were performed in triplicate under the following conditions: at 94 °C, 15 s at 94 °C, 20 s at 60 °C, 40 s at 72 °C for 40 cycles Data were analyzed by the DDCt method using abi 7500 system software, and mRNA levels were normalized to actin mRNA Immunocytochemistry For immunostaining, RINm5F cells were cultured on chamber slides (Nalge Nunc International, Tokyo, Japan) in RPMI 1640 medium supplemented with 10% fetal bovine serum, 1% penicillin and streptomycin until 70– 80% confluence After rinsing with NaCl ⁄ Pi, the cells were incubated for 24 h with or without ethanol (80 mm) in the presence of glucose (5.5 or 25 mm) with or without PHB (10 nm) To detect exogenous His-tagged PHB, the cells were fixed with 4% paraformaldehyde for 30 and incubated with NaCl ⁄ Pi ⁄ 1% BSA ⁄ 0.1% Tween 20 for h The cells were then serially incubated with the mitochondrial dye MitofluorTM Red 589 (final concentration lgỈmL)1) for 20 min, anti-His-FITC (1 : 650) for h and Hoechst 33342 (final concentration 2.5 lgỈmL)1) for To detect the distribution of endogenous PHB, the cells were fixed and then incubated with NaCl ⁄ Pi ⁄ 1% BSA ⁄ 0.1% Tween 20 for h They were then serially incubated with rabbit anti-PHB serum (1 : 650) for h, MitofluorTM Red 589 for 20 min, anti-rabbit FITC (1 : 650) for h and Hoechst 33342 for The cells were then examined under a Nikon Eclipse TE2000-E fluorescence microscope FEBS Journal 277 (2010) 488–500 ª 2009 The Authors Journal compilation ª 2009 FEBS 497 Effects of prohibitin in b-cells J H Lee et al Statistical analysis The data were analyzed by one-way ANOVA with Tukey multiple comparisons or Student’s t-test and are presented as the mean ± standard error of the mean (SEM) P < 0.05 was considered significant Acknowledgement This study was supported by a grant from the Canadian Institutes of Health Research (MOP60632) References Goldberg IJ (2003) To drink or not to drink? N Engl J Med 348, 163–164 Kao WH, Puddey IB, Boland LL, Watson RL & Brancati FL (2001) Alcohol consumption and the risk of type diabetes mellitus: atherosclerosis risk in communities study Am J Epidemiol 154, 748–757 Onishi Y, Honda M, Ogihara T, Sakoda H, Anai M, Fujishiro M, Ono H, Shojima N, Fukushima Y, Inukai K et al (2003) Ethanol feeding induces insulin resistance with enhanced PI 3-kinase activation Biochem Biophys Res Commun 303, 788–794 Sasaki Y & Wands JR (1994) Ethanol impairs insulin receptor substrate-1 mediated signal transduction during rat liver regeneration Biochem Biophys Res Commun 199, 403–409 Wan Q, Liu Y, Guan Q, Gao L, Lee KO & Zhao J (2005) Ethanol feeding impairs insulin-stimulated glucose uptake in isolated rat skeletal muscle: role of Gs alpha and cAMP Alcohol Clin Exp Res 29, 1450– 1456 Patel DG & Singh SP (1979) Effect of ethanol and its metabolites on glucose mediated insulin release from isolated islets of rats Metabolism 28, 85–89 Singh SP, Patel DG & Snyder AK (1980) Ethanol inhibition of insulin secretion by perifused rat islets Acta Endocrinol (Copenh) 93, 61–66 Singh SP, Patel DG, Snyder AK & Pullen GL (1986) Ethanol influence on insulin secretion from isolated rat islets Experientia 42, 58–60 de la Monte SM, Neely TR, Cannon J & Wands JR (2001) Ethanol impairs insulin-stimulated mitochondrial function in cerebellar granule neurons Cell Mol Life Sci 58, 1950–1960 10 Suh SK, Hood BL, Kim BJ, Conrads TP, Veenstra TD & Song BJ (2004) Identification of oxidized mitochondrial proteins in alcohol-exposed human hepatoma cells and mouse liver Proteomics 4, 3401–3412 11 Mishra S, Murphy LC, Nyomba BL & Murphy LJ (2005) Prohibitin: a potential target for new therapeutics Trends Mol Med 11, 192–197 498 12 Fusaro G, Dasgupta P, Rastogi S, Joshi B & Chellappan S (2003) Prohibitin induces the transcriptional activity of p53 and is exported from the nucleus upon apoptotic signaling J Biol Chem 278, 47853–47861 13 Wang S, Nath N, Adlam M & Chellappan S (1999) Prohibitin, a potential tumor suppressor, interacts with RB and regulates E2F function Oncogene 18, 3501– 3510 14 Kolonin MG, Saha PK, Chan L, Pasqualini R & Arap W (2004) Reversal of obesity by targeted ablation of adipose tissue Nat Med 10, 625–632 15 Terashima M, Kim KM, Adachi T, Nielsen PJ, Reth M, Kohler G & Lamers MC (1994) The IgM antigen receptor of B lymphocytes is associated with prohibitin and a prohibitin-related protein EMBO J 13, 3782– 3792 16 Brasaemle DL, Dolios G, Shapiro L & Wang R (2004) Proteomic analysis of proteins associated with lipid droplets of basal and lipolytically stimulated 3T3-L1 adipocytes J Biol Chem 279, 46835–46842 17 Staubach S, Razawi H & Hanisch FG (2009) Proteomics of MUC1-containing lipid rafts from plasma membranes and exosomes of human breast carcinoma cells MCF-7 Proteomics 9, 2820–2835 18 Sharma A & Qadri A (2004) Vi polysaccharide of Salmonella typhi targets the prohibitin family of molecules in intestinal epithelial cells and suppresses early inflammatory responses Proc Natl Acad Sci USA 101, 17492–17497 19 Sato T, Sakamoto T, Takita K, Saito H, Okui K & Nakamura Y (1993) The human prohibitin (PHB) gene family and its somatic mutations in human tumors Genomics 17, 762–764 20 Nijtmans LG, Artal SM, Grivell LA & Coates PJ (2002) The mitochondrial PHB complex: roles in mitochondrial respiratory complex assembly, ageing and degenerative disease Cell Mol Life Sci 59, 143–155 21 Nijtmans LG, de Jong L, rtal Sanz M, Coates PJ, Berden JA, Back JW, Muijsers AO, van der Spek H & Grivell LA (2000) Prohibitins act as a membrane-bound chaperone for the stabilization of mitochondrial proteins EMBO J 19, 2444–2451 22 Wang P, Mariman E, Keijer J, Bouwman F, Noben JP, Robben J & Renes J (2004) Profiling of the secreted proteins during 3T3-L1 adipocyte differentiation leads to the identification of novel adipokines Cell Mol Life Sci 61, 2405–2417 23 Mengwasser J, Piau A, Schlag P & Sleeman JP (2004) Differential immunization identifies PHB1 ⁄ PHB2 as blood-borne tumor antigens Oncogene 23, 7430–7435 24 Theiss AL, Idell RD, Srinivasan S, Klapproth JM, Jones DP, Merlin D & Sitaraman SV (2007) Prohibitin protects against oxidative stress in intestinal epithelial cells FASEB J 21, 197–206 FEBS Journal 277 (2010) 488–500 ª 2009 The Authors Journal compilation ª 2009 FEBS J H Lee et al 25 Liu X, Ren Z, Zhan R, Wang X, Wang X, Zhang Z, Leng X, Yang Z & Qian L (2009) Prohibitin protects against oxidative stress-induced cell injury in cultured neonatal cardiomyocyte Cell Stress Chaperones 14, 311–319 26 Dembele K, Nguyen KH, Hernandez TA & Nyomba BL (2009) Effects of ethanol on pancreatic beta-cell death: interaction with glucose and fatty acids Cell Biol Toxicol 25, 141–152 27 Hoorens A, Van de Casteele M, Kloppel G & Pipeleers D (1996) Glucose promotes survival of rat pancreatic beta cells by activating synthesis of proteins which suppress a constitutive apoptotic program J Clin Invest 98, 1568–1574 28 Chan CB & Kashemsant N (2006) Regulation of insulin secretion by uncoupling protein Biochem Soc Trans 34, 802–805 29 Vessal M, Mishra S, Moulik S & Murphy LJ (2006) Prohibitin attenuates insulin-stimulated glucose and fatty acid oxidation in adipose tissue by inhibition of pyruvate carboxylase FEBS J 273, 568–576 30 Zhu B, Zhai J, Zhu H & Kyprianou N (2010) Prohibitin regulates TGF-beta induced apoptosis as a downstream effector of smad-dependent and -independent signaling Prostate 70, 17–26 31 McDonough KH (2003) Antioxidant nutrients and alcohol Toxicology 189, 89–97 32 Wu D & Cederbaum AI (2005) Oxidative stress mediated toxicity exerted by ethanol-inducible CYP2E1 Toxicol Appl Pharmacol 207, 70–76 33 Koko V, Todorovic V, Nikolic JA, Glisic R, Cakic M, Lackovic V, Petronijevic L, Stojkovic M, Varagic J & Janic B (1995) Rat pancreatic B-cells after chronic alcohol feeding A morphometric and fine structural study Histol Histopathol 10, 325–337 34 Shin JS, Lee JJ, Yang JW & Kim CW (2002) Ethanol decreases basal insulin secretion from HIT-T15 cells Life Sci 70, 1989–1997 35 Tiengo A, Valerio A, Molinari M, Meneghel A & Lapolla A (1981) Effect of ethanol, acetaldehyde, and acetate on insulin and glucagon secretion in the perfused rat pancreas Diabetes 30, 705–709 36 Urso T, Gavaler JS & Van Thiel DH (1981) Blood ethanol levels in sober alcohol users seen in an emergency room Life Sci 28, 1053–1056 37 Ihara Y, Toyokuni S, Uchida K, Odaka H, Tanaka T, Ikeda H, Hiai H, Seino Y & Yamada Y (1999) Hyperglycemia causes oxidative stress in pancreatic beta-cells of GK rats, a model of type diabetes Diabetes 48, 927–932 38 Kaneto H, Kajimoto Y, Fujitani Y, Matsuoka T, Sakamoto K, Matsuhisa M, Yamasaki Y & Hori M (1999) Oxidative stress induces p21 expression in pancreatic islet cells: possible implication in beta-cell dysfunction Diabetologia 42, 1093–1097 Effects of prohibitin in b-cells 39 Matsuoka T, Kajimoto Y, Watada H, Kaneto H, Kishimoto M, Umayahara Y, Fujitani Y, Kamada T, Kawamori R & Yamasaki Y (1997) Glycation-dependent, reactive oxygen species-mediated suppression of the insulin gene promoter activity in HIT cells J Clin Invest 99, 144–150 40 Tanaka Y, Gleason CE, Tran PO, Harmon JS & Robertson RP (1999) Prevention of glucose toxicity in HITT15 cells and Zucker diabetic fatty rats by antioxidants Proc Natl Acad Sci USA 96, 10857–10862 41 Anello M, Lupi R, Spampinato D, Piro S, Masini M, Boggi U, Del PS, Rabuazzo AM, Purrello F & Marchetti P (2005) Functional and morphological alterations of mitochondria in pancreatic beta cells from type diabetic patients Diabetologia 48, 282–289 42 Lortz S, Tiedge M, Nachtwey T, Karlsen AE, Nerup J & Lenzen S (2000) Protection of insulin-producing RINm5F cells against cytokine-mediated toxicity through overexpression of antioxidant enzymes Diabetes 49, 1123–1130 43 Chowdhury I, Xu W, Stiles JK, Zeleznik A, Yao X, Matthews R, Thomas K & Thompson WE (2007) Apoptosis of rat granulosa cells after staurosporine and serum withdrawal is suppressed by adenovirus-directed overexpression of prohibitin Endocrinology 148, 206– 217 44 Artal-Sanz M, Tsang WY, Willems EM, Grivell LA, Lemire BD, van der SH & Nijtmans LG (2003) The mitochondrial prohibitin complex is essential for embryonic viability and germline function in Caenorhabditis elegans J Biol Chem 278, 32091–32099 45 Coates PJ, Jamieson DJ, Smart K, Prescott AR & Hall PA (1997) The prohibitin family of mitochondrial proteins regulate replicative lifespan Curr Biol 7, 607–610 46 Piper PW, Jones GW, Bringloe D, Harris N, MacLean M & Mollapour M (2002) The shortened replicative life span of prohibitin mutants of yeast appears to be due to defective mitochondrial segregation in old mother cells Aging Cell 1, 149–157 47 MacDonald MJ, Fahien LA, Brown LJ, Hasan NM, Buss JD & Kendrick MA (2005) Perspective: emerging evidence for signaling roles of mitochondrial anaplerotic products in insulin secretion Am J Physiol Endocrinol Metab 288, E1–15 48 Rastogi S, Joshi B, Fusaro G & Chellappan S (2006) Camptothecin induces nuclear export of prohibitin preferentially in transformed cells through a CRM-1-dependent mechanism J Biol Chem 281, 2951–2959 49 Mielenz D, Vettermann C, Hampel M, Lang C, Avramidou A, Karas M & Jack HM (2005) Lipid rafts associate with intracellular B cell receptors and exhibit a B cell stage-specific protein composition J Immunol 174, 3508–3517 50 Rajalingam K, Wunder C, Brinkmann V, Churin Y, Hekman M, Sievers C, Rapp UR & Rudel T (2005) FEBS Journal 277 (2010) 488–500 ª 2009 The Authors Journal compilation ª 2009 FEBS 499 Effects of prohibitin in b-cells 51 52 53 54 500 J H Lee et al Prohibitin is required for Ras-induced Raf-MEK-ERK activation and epithelial cell migration Nat Cell Biol 7, 837–843 Choi KS, Aizaki H & Lai MM (2005) Murine coronavirus requires lipid rafts for virus entry and cell-cell fusion but not for virus release J Virol 79, 9862–9871 Hansen GH, Dalskov SM, Rasmussen CR, Immerdal L, Niels-Christiansen LL & Danielsen EM (2005) Cholera toxin entry into pig enterocytes occurs via a lipid raft- and clathrin-dependent mechanism Biochemistry 44, 873–882 George M, Ying G, Rainey MA, Solomon A, Parikh PT, Gao Q, Band V & Band H (2007) Shared as well as distinct roles of EHD proteins revealed by biochemical and functional comparisons in mammalian cells and C elegans BMC Cell Biol 8, McGuire TF, Trump DL & Johnson CS (2001) Vitamin D(3)-induced apoptosis of murine squamous cell carcinoma cells Selective induction of caspase-dependent MEK cleavage and up-regulation of MEKK-1 J Biol Chem 276, 26365–26373 55 Zamora M, Merono C, Vinas O & Mampel T (2004) Recruitment of NF-kappaB into mitochondria is involved in adenine nucleotide translocase (ANT1)-induced apoptosis J Biol Chem 279, 38415–38423 56 Kasono K, Yasu T, Kakehashi A, Kinoshita N, Tamemoto H, Namai K, Ohno R, Ueba H, Kuroki M, Ishikawa S et al (2004) Nicorandil improves diabetes and rat islet beta-cell damage induced by streptozotocin in vivo and in vitro Eur J Endocrinol 151, 277–285 57 Ma Z, Zhang S, Turk J & Ramanadham S (2002) Stimulation of insulin secretion and associated nuclear accumulation of iPLA(2)beta in INS-1 insulinoma cells Am J Physiol Endocrinol Metab 282, E820– E833 58 Veluthakal R, Palanivel R, Zhao Y, McDonald P, Gruber S & Kowluru A (2005) Ceramide induces mitochondrial abnormalities in insulin-secreting INS-1 cells: potential mechanisms underlying ceramide-mediated metabolic dysfunction of the beta cell Apoptosis 10, 841–850 FEBS Journal 277 (2010) 488–500 ª 2009 The Authors Journal compilation ª 2009 FEBS ... role in pancreatic b-cells The objective of the present study was to investigate the expression and antioxidant effects of PHB in pancreatic b-cells exposed to ethanol Effects of prohibitin in b-cells. .. endocytosis and vesicle recycling [53] In summary, we found that PHB is expressed in pancreatic b-cells and increases with oxidative stress induced by ethanol exposure, possibly to protect b-cells against. .. staining; (B) Mitofluor Red 589 (mitochondria) staining; (C) anti-His (exogenous PHB)-FITC staining; (D) merge The arrows indicate staining of His-tagged PHB in (C) or both PHB and Mitofluor in