Molecular Biotechnology Tran Ngoc Duc, PhD VIETNAM NATIONAL UNIVERSITY AT HO CHI MINH CITY INTERNATIONAL UNIVERSITY Basic techniques in DNA technology 1. Polymerase chain reaction (PCR) 2. Gel electrophoresis 3. Primer Design 4. RT-PCR 5. Digestion 6. Southern blot/Northern blot 7. Detectable signal based techniques 8. Site-directed mutagenesis  Polymerase chain reaction 1. PCR and Primer Design  Developed in 1983 by Kary Mullis  Polymerase Chain Reaction is widely held as one of the most important inventions of the 20th century in molecular biology. Small amounts of the genetic material can now be amplified to be able to a identify, manipulate DNA, detect infectious organisms, including the viruses that cause AIDS, hepatitis, tuberculosis, detect genetic variations, including mutations, in human genes and numerous other tasks.  Components in PCR reaction  Template DNA  Primers  dNTPs  Taq DNA polymerase  Buffer  Step 1: Denature DNA, 95 o C, 5min  Step 2: Annealing: - Denature DNA, 95 0 C, 30s-1min - Annealing, 55-60 o C, 1min Step 3: Extension, 70-72 o C, 30s-1min Go to step 2, 32 cycles  Step 4: Holding, 4 o C, 0s  Steps programmed in PCR [...]... contain radioactivity added for visibility, an autoradiogram can be recorded of the gel  Protein electrophoresis 3 Primer design  Steps programmed in PCR  Step 1: Denature DNA, 95oC, 5min  Step 2: Annealing: - Denature DNA, 950C, 30s-1min - Annealing, 55-60oC, 1min  Step 3: Extension, 70-72oC, 30s-1min Go to step 2, 32 cycles  Step 4: Holding, 4oC, 0s  Primers (short DNA fragments) containing... GATGGCCCTAATGCCTCCAAGATCACACCACAGGCCCTGGACCGGTGGGAGGAGCG F:? Ta=? R:? Ta=? 4 RT-PCR  Reverse transcription polymerase chain reaction (RTPCR) is a variant of polymerase chain reaction (PCR)  In RT-PCR, an RNA strand is first reverse transcribed into its DNA complement (complementary DNA, or cDNA) using the enzyme reverse transcriptase mRNA Reverse transcriptase cDNA Taq DNA polymerase DNA  Oligo dT(18) or Random Decamer Primers are used for the reverse...  A method for separating mixture of charged molecules such as DNA, RNA or proteins under an electric field when an electric field is applied to them  The gel acts like a sieve for separation of molecules according to their sizes and electric charges  Gel is made of agarose for separating large molecules of DNA, and of acrylamide for protein separation or small DNA or RNA  In the case of nucleic... primer for first strand cDNA synthesis with reverse transcriptase The primer hybridizes to the poly(A) tail of mRNA  Oligo (dT): TTTTTTTTTTTTTTTTT  Decamer: One step reaction RT-PCR Two step reaction  Components of RT-PCR Step 1: Making cDNA  44oC, 1hr  92oC, 10min  4oC, 0min Step 2: Regular PCR  Gene cloing High light High salt Nutrient deficiency Sensing Signal transduction Initiation of Secondary... Accumulating β-carotene = pro-vitamin A Green cell orange cell  PSY1 expression analysis by RT-PCR 0h HL+ Nu HL Nu 18S 6h 12h 24h 48h 5 Restriction Enzyme/Digestion  A restriction digest is a procedure used in molecular biology to prepare DNA for analysis or other processing It is sometimes termed DNA fragmentation  There are numerous types of restriction enzymes, each of which will cut DNA differently... temperature (Tm) is the temperature at which onehalf of a particular DNA duplex will dissociate and become single strand DNA  The actual (Tm) is influenced by the concentration of Mg2+, K+, and co-solvents There are numerous computer programs to assist in primer design  http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome ATGCCCTCCACTTCCGGTGCGTCGCCCTTCCTCCCAGCAGCGCCAGCACTTGCCAG... to the naturally-occurring negative charge carried by their sugarphosphate backbone  Proteins, unlike nucleic acids, can have varying charges and complex shapes, therefore they may not migrate into the polyacrylamide gel at similar rates, or at all, when placing a negative to positive on the sample  After the electrophoresis is complete, the molecules in the gel can be stained to make them visible... target region along with a DNA polymerase  One primer is complementary to one end strand of DNA  Primer length usually 18-24bp, shouldn’t be over 30  GC, 40-60%  Primer shouldn’t form hairpin or loop by themselves  Pair of primers should have similar annealing Ta, which is usually 4-50C below Tm  Ta = (2AT+ 4GC) - 4  Ta of the 2 primers shouldn’t be big different  The melting temperature (Tm) is... differently There are some that cut a three base pair sequence while others can cut four, six, and even eight  NEBcutter: http://www.neb.com/nebecomm/default.asp  Components: 1µl 10x Buffer 6.5µl H2O 2µl DNA 0.5µl Enzyme . Molecular Biotechnology Tran Ngoc Duc, PhD VIETNAM NATIONAL UNIVERSITY AT HO CHI MINH CITY INTERNATIONAL UNIVERSITY Basic techniques in DNA technology 1 cycles to copy DNA  So basically it is the cycles of heating and cooling (thermal cycling)  Applications of PCR  DNA cloning  DNA based phylogeny 