Eur J Biochem 271, 3715–3728 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04312.x The HNF1b transcription factor has several domains involved in nephrogenesis and partially rescues Pax8/lim1-induced kidney malformations Guizhi Wu, Silvia Bohn and Gerhart U Ryffel Institut fuăr Zellbiologie, Universitaătsklinikum Essen, Germany The tissue-specific transcription factors HNF1a and HNF1b are closely related homeodomain proteins conserved in vertebrate evolution Heterozygous mutations in human HNF1b but not in HNF1a genes are associated with kidney malformations Overexpression of HNF1b in Xenopus embryos leads to defective pronephros development, while HNF1a has no effect We have defined the regions responsible for this functional difference between HNF1b and HNF1a in transfected HeLa cells as well as in injected Xenopus embryos Using domain swapping experiments, we located a nuclear localization signal in the POUH domain of HNF1b, and showed that the POUS and POUH domains of HNF1b mediate a high transactivation potential in transfected cells In injected Xenopus embryos three HNF1b domains are involved in nephrogenesis These include the dimerization domain, the 26 amino acid segment specific for splice variant A as well as the POUH domain As HNF1b together with Pax8 and lim1 constitute the earliest regulators in the pronephric anlage, it is possible that they cooperate during early nephrogenesis We have shown here that HNF1b can overcome the enlargement and the induction of an ectopic pronephros mediated by overexpression of Pax8 and lim1 However, the phenotype induced by Pax8 and lim1 overexpression and characterized by cyst-like structures and thickening of the pronephric tubules was not altered by HNF1b overexpression Taken together, HNF1b acts antagonistically to Pax8 and lim1 in only some processes during nephrogenesis, and a simple antagonistic relationship does not completely describe the functions of these genes We conclude that HNF1b has some distinct morphogenetic properties during nephrogenesis The tissue-specific transcription factors, HNF1a (TCF1) and HNF1b (vHNF1, TCF2), are two unique homeodomain proteins [1] The POU homeodomains (POUH) are divergent from other homeodomain proteins in that they contain an extra 21 amino acid (aa) loop between helices and [2,3] Both transcription factors are encoded in distinct genes on separate chromosomes, and are highly conserved in vertebrates with homologues in fish [4,5], frog [6,7] and mammals, including humans [8–10] The evolutionary conservation is also seen in the exon/intron patterning which remains essentially the same between Xenopus and mammals [11] Both HNF1 proteins contain a highly conserved N-terminal dimerization domain, a bipartite DNA binding region and a more divergent C-terminal transactivation domain (Fig 1) Based on the crystal structure of the dimer, the dimerization domain has been identified as an intertwined four-helix bundle that allows the formation of homo- or heterodimers of the HNF1 proteins [12,13] The DNA binding domain is composed of a POU specific domain (POUS) and the divergent POU homeodomain (POUH) Recent three-dimensional structural analysis of the HNF1a protein indicates that the POUS domain interacts with the 21 aa loop of the POUH domain to create a stable interface between the two DNA binding domains This feature distinguishes HNF1a from other, more flexible, POUH factors [14] As the primary structures of HNF1a and HNF1b are very similar within the DNA binding region, it is reasonable to assume that this structure is also present in the HNF1b protein Depending on the splice variant, there is a 26 aa insertion between the POUS and POUH domain in the HNF1b protein This variant is found in mammalian and also Xenopus HNF1b proteins (Fig 1), but never in the HNF1a proteins In contrast to these rather conserved domains, the C-terminal transactivation domain is the most divergent protein area when the HNF1a and HNF1b proteins are compared It is not resolved whether the differences between the HNF1a and HNF1b proteins that are highly conserved throughout vertebrate evolution reflect distinct functions Consistent with distinct functional roles, the temporal and spatial expression patterns of HNF1a and HNF1b differ significantly During murine embryogenesis, HNF1a is expressed in the yolk sac endoderm at day 8.5 of gestation as well as in the developing liver, kidney, intestine, pancreas and stomach [15–17] In contrast, HNF1b is expressed earlier in the primitive and visceral endoderm Starting at day 4.5 of gestation, the anterior part of the neural tube as Correspondence to G U Ryffel, Institut fur Zellbiologie (Tumoră forschung), Universitatsklinikum Essen, D-45122 Essen, Germany ¨ Fax: +49 201723 5905, Tel.: +49 201723 3110, E-mail: gerhart.ryffel@uni-essen.de Abbreviations: NLS, nuclear localization signal; POUS, POU specific domain; POUH, POU homeodomain (Received June 2004, revised 22 July 2004, accepted 29 July 2004) Keywords: HNF1b; lim1; nephrogenesis; Pax8; pronephros 3716 G Wu et al (Eur J Biochem 271) Ó FEBS 2004 Fig The related human transcription factors, HNF1a and HNF1b HNF1b and HNF1a are represented schematically (top) The domains are indicated and numbers below the domains refer to the amino acid positions Amino acid identity of the domains between HNF1a and HNF1b is 16 shown in bold (homology) The 26 aa segment between the POUS and POUH domains of the human HNF1a and HNF1b proteins as well as of the human and Xenopus HNF1b protein are aligned (bottom) with missing amino acids indicated by ‘)’ The 26 aa segment deleted in the B splice 17 variant of the HNF1b is indicated (green) Identical amino acids between b and a or human b and Xenopus b sequences are shown and conserved amino acid changes are indicated by + well as the developing kidney, liver, gut and pancreas express HNF1b [18] Additionally, HNF1b is also expressed in the primordia for the genitalia and the lung HNF1b expression persists in these organs in the adult, whereas HNF1a is never active in these tissues [19,20] The embryonic expression pattern of the HNF1 proteins is evolutionarily conserved in vertebrates The expression of HNF1b occurs prior to HNF1a in Xenopus embryos [21,22], and only HNF1b is expressed in the developing brain in Xenopus [7] as well as in zebrafish [5] In agreement with the differential embryonic expression patterns of the two HNF1 proteins, inactivation of the corresponding genes in the mouse has different effects Homozygous knock-out of the HNF1b gene led to early embryonic lethality at day 7.5 of gestation with poorly organized ectoderm and no discernible visceral endoderm [18,23] In contrast, HNF1a was not required for embryonic development, but HNF1a-deficient mice died during postnatal life due to hepatic, pancreatic and renal dysfunction [24–28] These results clearly establish different roles for the two HNF1 genes Whether differential properties of the two transcription factors are the cause of these differences, or rather the differential expression patterns, remains to be seen A functional equivalence of the HNF1a and HNF1b protein has recently been shown in embryonic stem cells, as the introduction of HNF1a restores the formation and differentiation of a mature visceral endoderm in HNF1bdeficient embryonic stem cells [29] Further support for functional differences can be deduced from human diseases Biallelic inactivation of the HNF1a gene has been described as an early step in hepatocellular carcinoma [30] However, HNF1b has not been associated with tumorigenesis to date Heterozygous mutations in both genes lead to maturity onset diabetes of the young but HNF1b mutations are additionally associated with severe nondiabetic renal defects as well as genital malformations in females [31–34] In this context, we showed the specific role of HNF1b during development of the first form of vertebrate kidney, the pronephros, using overexpression experiments in Xenopus embryos The expression of HNF1b led specifically to a reduced formation of the pronephros, whereas HNF1a had no effect [35] This indicates that these two transcription factors have different intrinsic biochemical properties Most recently, the renalspecific inactivation of the HNF1b gene in mice [36] and the kidney-specific expression of mutated HNF1b [37] have linked the HNF1b transcriptional network to genes causing polycystic kidney disease Ó FEBS 2004 In vertebrates, three distinct types of kidneys (pronephros, mesonephros and metanephros) are formed progressively during development [38] Similar regulators are expressed in all three kidneys, and thus, the molecular processes by which the different kidneys develop appear to be closely related [39–41] The pronephros is the simplest vertebrate kidney, and consists of a single nephron with an external glomus It represents an attractive system to study molecular events during kidney development, as several key regulators have been functionally identified by injecting mRNA into Xenopus embryos [41,42] Using the Xenopus system, we have shown that overexpression of human HNF1b in the developing frog embryo leads to agenesis of the pronephric tubules and duct The same phenotype is seen for some human HNF1b mutants leading to defective renal development, whereas an enlargement of the pronephros occurs with other mutants [35,43] An enlargement of the pronephros has also been observed by the overexpression of the transcription factors, Pax8 and lim1, and this effect was additive [44] Furthermore, the artificial expression of Pax8 and lim1 in the Xenopus embryo induced ectopic pronephric structures, a phenotype never seen in embryos overexpressing HNF1b Interestingly, HNF1b, Pax8 and lim1 are the earliest known regulators in the pronephric anlage, implying that they may cooperate during early events of nephrogenesis [41,42] In the present communication, we functionally mapped the protein domains of HNF1b, specifically participating in nephrogenesis via injection of chimeric HNF1a and HNF1b proteins into Xenopus embryos We also explored whether Pax8- and lim1-mediated effects can be overcome by simultaneous HNF1b overexpression Materials and methods Plasmid constructions The pCSGFP2, myc-Rc/CMVHNF1b and myc-Rc/ CMVHNF1a expression vectors have been described previously [35] HNF1aaa and HNF1bbb were generated by inserting an EcoRI-XbaI fragment encoding 1–321 aa of the human HNF1a and 1–352 aa of the human HNF1b, respectively A BamHI site was introduced both at G69 (a) and G79 (b) without changing the amino acid sequence The EcoRI-BamHI and BamHI-XbaI fragments were derived from PCR products made with the following primers HNF1aaa: 5¢-CGGAATTCAATGG TTTCTAAACTGAGCC-3¢ (forward), 5¢-CGCGGATCC CCGAGTCTCCCCC-3¢ (reverse); 5¢-CGCGGATCCGA GGACGAGACGG-3¢ (forward), 5¢-GCTCTAGATTA GCGCACACCGTGGAC-3¢ (reverse); HNF1bbb: 5¢-CG GAATTCAATGGTGTCCAAGCTCACGT-3¢ (forward), 5¢-CGCGGATCCCTCGTCGCCGGACAA-3¢ (reverse); 5¢-CGCGGATCCGAGGACGGCGACGA-3¢ (forward), 5¢-GCTCTAGATTAGCGCACTCCTGACAGC-3¢ (reverse) The restriction sites for cloning are underlined HNF1abb and HNF1baa were generated by exchanging the EcoRI-BamHI fragments between HNF1bbb and HNF1aaa HNF1bbbD was generated by replacing the BamHI-HincII fragment of the HNF1bbb expression vector with the BamHI-HincII fragment of a PCR product HNF1b in nephrogenesis (Eur J Biochem 271) 3717 made with the forward primer, 5¢-CGCGGATCCGA GGACGGCGACGA-3¢, and the reverse primer, 5¢-GCT CTGTTGACTGAATTGTCGGAGGATCTCTCGT-3¢, containing complementary sequences upstream and downstream to a segment encoding the 26 aa to be deleted HNF1bD was generated by replacing the PvuI fragment encoding 1–251 aa of HNF1b with the corresponding fragment of HNF1bbbD HNF1aab, HNF1aabins26 and HNF1aaains26 constructs were generated using the Quickchange site-directed Mutagenesis Kit (Stratagene) and a PCR fragment generated from the HNF1bbb sequence using the following primers: HNF1aab: 5¢-GATGAGCTACCAACCAAGAA GATGCGCCGCA-3¢ (forward), 5¢-GCCGCTCTAGATT AGCGCACTC-3¢ (reverse); HNF1aabins26: 5¢-CGAGA GGTGGCGCAGCAGTTCAACCAGACAGTCCAG-3¢ (forward), 5¢-GCCGCTCTAGATTAGCGCACTC-3¢ (reverse); HNF1aaains26: 5¢-CGAGAGGTGGCGCAGCA GTTCAACCAGACAGTCCAG-3¢ (forward), 5¢-CTCC CTGCCCTGCATGGGTGAACTCTGGAAAGAGAA AC-3¢ (reverse) HNF1aabH and HNF1aabHS were generated by replacing the BamHI-XbaI fragment of HNF1aab with the BamHI-XbaI fragment of a PCR product generated using the primers 5¢-CGCGGATCCGAGGACGAGACGG-3¢ (forward) and 5¢-GCTCTAGATTAGCTATAGGCGTCC ATGG-3¢ (reverse) and 5¢-CGCGGATCCGAGGACGAG ACGG-3¢ (forward) and 5¢-GCTCTAGATTATTGCCGG AATGCCTCCT-3¢ (reverse), respectively HNF1bhomeo was amplified by PCR using the primers 5¢-CGGAA TTCAAAGAAGATGCGCCGCAAC-3¢ (forward) and 5¢-GCTCTAGATTAGCTATAGGCGTCCATGG-3¢ (reverse) All amplified HNF1 fragments were verified by sequencing, digested with EcoRI and XbaI, then inserted into the GFP-Rc/CMV and pCS2+MT [45] expression vectors GFP-Rc/CMV was constructed by inserting the HindIIIEcoRI GFP PCR fragment produced using the 5¢-GGCAAGCTTCTGGCCACCATGAGTAAAGGA-3¢ (forward) and 5¢-CGGAATTCGTTTTGTATAGTTCAT CCATGC-3¢ (reverse) primers to amplify a region of the pCSGFP2 vector [46] into the Rc/CMV expression vector (Invitrogen) The expression clone encoding Xenopus HNF1b was kindly provided by R Vignali, University of Pisa, Italy [47], and the plasmids encoding Xenopus lim1 and Pax8 were kindly supplied by P D Vize, University of Calgary, Canada [44] Cell culture, transfection and luciferase assay HeLa cells (our lab stock) were cultured at 37 °C in Dulbecco’s modified Eagle’s medium supplemented with penicillin (100 mL)1), streptomycin (100 mL)1) and 10% (v/v) heat-inactivated fetal bovine serum The cells were seeded at a density of · 105 cells per 3.3 cm dish The transfection was performed 24 h after seeding using 1.3 lg of reporter gene, 0.3 lg of expression vector, and lL of lipofectamine (Invitrogen) The final DNA concentration was equalized by the addition of Rc/CMV vector The transactivation activity was measured after 20 h using the luciferase reporter assay system (Promega) and a Lumat LB 9501 luminometer (Berthold, Wilbad, Germany) 3718 G Wu et al (Eur J Biochem 271) Embryos, microinjection of synthetic mRNA and immunohistochemistry In vitro fertilization and culture of Xenopus laevis embryos were performed as described previously [48] Adult Xenopus laevis were obtained from Xenopus I, Inc (Dexter, MI, USA) and the animal experimentation guidelines were followed (Regierungsprasidium Dusseldorf, Germany) The ă ă developmental stages are taken from the ÔNormal Table of Xenopus laevisÕ [49] The expression vectors encoding HNF1 chimeric proteins and the GFP encoding expression vector (pCSGFP2) were linearized with NotI and PvuII, respectively, then in vitro transcribed with SP6 RNA polymerase [35] A total of 250 pg of capped mRNA encoding a chimeric protein together with 100 pg of capped green fluorescent protein (GFP) mRNA were injected into one blastomere of two-cell stage embryos After days, the injected side was scored under a stereofluorescence microscope for the presence of GFP At the swimming larval stage (45), the animals were fixed in MEMFA [0.1 M MOPS, pH 7.4, mM EGTA, mM MgSO4, 3.7% (v/v) formaldehyde], subsequently dehydrated in methanol and stored at )20 °C For whole-mount immunostaining, the embryos were rehydrated in NaCl/Pi and blocked with NaCl/Pi and 0.1% (v/v) Triton X-100 (PBT)/20% (v/v) goat serum for h at room temperature Incubation with hybridoma supernatant of the monoclonal antibodies, 3G8 and 4A6 (kindly provided by E A Jones, University of Warwick, UK [50]), was performed overnight at °C after a : dilution in PBT/20% (v/v) goat serum After washing five times with 10;11 PBT at 20–25 °C, incubation with a : 1000 diluted cyanine 10;11 Cy3-conjugated rat anti-(mouse) Ig (Jackson Immuno12 Research, West Grove, PA, USA) was performed overnight Embryos were washed five times with PBT at room temperature, then analyzed by fluorescence microscopy Statistical analysis The difference between the injected and the noninjected sides was evaluated by measuring the whole area using the lateral view with the widest diameter from the dorsal to the ventral side of the immunostained pronephros The area included the pronephric tubules and the anterior part of the pronephric duct The measurements were made using the computer program KAPPA IMAGE BASE METEO (opto-electronics GmbH, Gleichen, Germany), and the noninjected side was used as a reference for each animal No size difference was set as 100 The values representing kidney size obtained from each mutant were compared to values obtained from GFP control-injected embryos Significant differences were scored using the Mann–Whitney test to calculate P-values Ó FEBS 2004 Fig 2A A second construct was created from a truncated HNF1b protein (HNF1bbb) that corresponds to the human Y352insA HNF1b mutation, that we have shown in previous experiments to be sufficient to induce agenesis of the pronephros in Xenopus [43] By deletion of the 26 aa segment from HNF1bbb we constructed a truncated protein lacking the 26 aa segment (HNF1bbbD, Fig 2A) As a third type we generated a HNF1a variant containing the 26 aa segment from HNF1b that is normally not present in HNF1a As the full-length HNF1a protein has no effect on renal development [35], we assumed that the truncated HNF1a protein (HNF1aaa) lacking the transactivation domain would not have an effect either By adding the 26 aa segment to this truncated version of HNF1a we produced the HNF1aaains26 construct (Fig 2A) The subcellular localization of these constructs was first assayed in transfected HeLa cells Previous experiments have shown that HNF1a is localized primarily in the nucleus but also to a certain extent in the cytoplasm [51] Localization of HNF1b, however, is exclusively nuclear [43] To define the subcellular distribution of these various proteins, we expressed GFP fusion proteins of these constructs in HeLa cells All HNF1b-derived constructs (HNF1b, HNF1bD, HNF1bbb and HNF1bbbD) were localized exclusively in the nucleus (Fig 2B) In contrast, the HNF1a-derived constructs (HNF1aaa and HNF1aaains26) were present in both the nucleus and the cytoplasm (Fig 2B), as observed previously for full-length HNF1a [51] Additionally, the transactivation potential of these HNF1 derivatives were investigated Expression vectors encoding these proteins were cotransfected into HeLa cells lacking endogenous HNF1 proteins together with a luciferase reporter plasmid containing an HNF1 inducible promoter Deletion of the 26 aa sequence present in HNF1b reduced the transactivation potential  30% compared to the fulllength HNF1b transcription factor (Fig 2C) As observed previously [43], the truncated HNF1b protein lacking the transactivation domain retained substantial transactivation potential (compare HNF1bbb with HNF1b in Fig 2C) Typically, HNF1bbb was less active at 10–30 ng expression vector, but as active as the full-length protein when 150– 300 ng expression vector were transfected The truncated HNF1b construct missing the sequence encoding the 26 aa segment (HNF1bbbD) transactivated similarly to HNF1bbb (Fig 2C) In contrast, the truncated HNF1a protein (HNF1aaa) had only a residual activity even when 300 ng expression vector were transfected (Fig 2C) This is consistent with the initial description of the HNF1a transcription factor and the definition of the C-terminal activation domain of HNF1a [52,53] The insertion of the b-specific 26 aa segment into the truncated HNF1a construct (HNF1aaa) abolished residual activity This indicates that the 26 aa segment plays some role in the transactivation potential Results The conserved 26 aa segment of HNF1b affects the transactivation potential We first explored whether the 26 aa segment specifically deleted in the splice variant HNF1b-B (Fig 1) could interfere with nephrogenesis The splice variant B (HNF1bD) was constructed by deleting the 26 aa segment as shown in The conserved 26 aa segment of HNF1b interferes with pronephros development in Xenopus laevis The morphogenetic potential of the various HNF1 constructs were examined in the developing Xenopus embryo by injecting mRNA encoding these proteins into one blastomere of the two-cell stage embryo As initial experiments revealed that the GFP-HNF1 fusion proteins fluoresced too Ó FEBS 2004 HNF1b in nephrogenesis (Eur J Biochem 271) 3719 Fig Subcellular localization and transactivation potential of HNF1 constructs with deletion or insertion of the 26 aa segment (A) The domains encoded by each HNF1 construct are shown diagrammatically together with their designation The black box indicates the 26 aa segment deleted in HNF1b splice variant B (B) Immunofluorescence of HeLa cells expressing GFP fusion proteins of the various constructs shown in A Bar, 10 lm (C) Increasing amounts of GFP-HNF1b expression constructs (shown in A) were cotransfected with a HNF1-dependent luciferase reporter gene into HeLa cells The fold-activation induced by each of the HNF1 expression constructs is shown Error bars indicate standard deviation of the mean of at least six replicates lacking the 26 aa segment (HNF1bD) had no effect on weakly for the identification of the injected side (data not pronephric size, implying a crucial role of this 26 aa segment shown), GFP mRNA was coinjected with RNA for the in nephrogenesis (Fig 3D) However, the truncated HNF1b myc-tagged version of the constructs (Fig 3A) as perprotein lacking this 26 aa segment (HNF1bbbD) led to a formed previously [35] Injected embryos were raised to free reduction of the pronephric size (Fig 3D), indicating swimming tadpoles (stage 45) and processed to visualize the additional nephrogenic segments in this truncated protein pronephros using a mixture of monoclonal antibodies for The insertion of the 26 aa segment into the HNF1a protein the pronephric tubules and duct [50] Only embryos that (HNF1aaains26) led to a reduction of pronephric size were otherwise phenotypically normal were scored for (Fig 3D), illustrating that the nephrogenic potential of the effects on pronephric development Examples of dorsal 26 aa segment is transferable A dramatic lethality at the views of such larvae are given in Fig 3C The pronephric injected side was observed when the truncated HNF1b size was measured in the lateral view (Fig 3B) of a whole construct lacking the 26 aa segment (HNF1bbbD) was series of larvae, and the quantification of these phenotypic overexpressed (Fig 3E,F) More than 90% of the injected changes together with the statistical analysis for significance embryos died during gastrulation Even when the amount of are summarized in Fig 3D HNF1bbbD mRNA was halved, 70% of the embryos still As found previously [35,43], full length HNF1b led to a died during gastrulation The majority of the surviving significant reduction of the size of the pronephros (Fig 3D), tadpoles were distorted (Fig 3H–J) compared to control and this effect was even more pronounced for the truncated HNF1b protein (HNF1bbb, Fig 3D) As expected, the 13 animals (Fig 3G) Therefore, a relatively small number (36) of healthy larvae were available for immunostaining and the truncated HNF1a protein (HNF1aaa) did not interfere with examination of the pronephros-specific effects Neverthepronephros development (Fig 3D) The HNF1b protein 3720 G Wu et al (Eur J Biochem 271) Ó FEBS 2004 Fig Pronephric phenotype in Xenopus larvae after expression of HNF1 proteins lacking or containing the HNF1b-specific 26 aa segment (A) Control neurula expressing GFP on the injected side (B) Lateral view of a larvae (stage 45) expressing full-length HNF1b protein (C) Dorsal view of larvae (stage 45) expressing the HNF1 protein designated Whole-mount immunostaining for the pronephric tubules and duct using a Cy3-conjugated secondary antibody is shown as red fluorescence The injected side is marked by an arrow Bar, 300 lm (D) Statistical analysis of pronephric size in injected vs noninjected sides after expression of various HNF1 proteins Boxes include 75% of the values, and the vertical line represents the group median, and whiskers represent the outer quartile The P-value calculated using the Mann–Whitney test and the animal number scored per group shown at the far right The reference indicates the GFP-injected control animals (E, F) Example of embryo exhibiting defects at gastrulation illuminated at normal light (E) or under green fluorescence (F) Note cell death was only observed in the injected (GFP positive) region Bar, 300 lm (G) Stage 44 control embryo injected with GFP alone Bar, mm (H–J) Developmental defects of different degrees were observed in tadpoles expressing the truncated HNF1b protein lacking the 26 aa segment (HNF1bbbD) Animals shown in panel H and I could not be scored for pronephric morphology (K) Western blot of protein extracts derived from neurulae stage embryos injected with RNA 18 encoding HNF1aaa, HNF1bbb, HNF1aab or GFP alone using the myc-tag specific antibody GE10 [35] Each sample was an aliquot representing one embryo of a pool of 60 injected embryos At later stages, the amount of HNF1 proteins was too low to be quantified less, this group was sufficient for significant analysis This abnormal development was not observed with any of the other constructs To control the efficiency of protein production, we tested the amount of HNF1 proteins made by Western blots As exemplified in Fig 3K, very similar levels were found in the injected embryos The truncated HNF1a protein (HNF1aaa) was as abundant as the truncated HNF1b protein (HNF1bbb) demonstrating that both proteins are equally expressed Thus, the presence of HNF1aaa has in contrast to HNF1bbb no effect on pronephric development Function of the dimerization domain of HNF1b As overexpression of the truncated HNF1b derivative lacking the 26 aa segment (HNF1bbbD) also reduced the pronephric size (Fig 3D), we postulated that other segments present in this molecule may interfere with nephrogenesis To explore the function of the dimerization domain of the HNF1b protein, we constructed chimeras of the HNF1a and HNF1b proteins as shown in Fig 4A The molecular and cellular properties of these chimeric constructs were assayed in transfected HeLa cells as well as in developing Xenopus embryos The construct encoding the HNF1b-derived POUS and POUH domains fused to the HNF1a dimerization domain (HNF1abb) was localized exclusively in the nucleus of transfected HeLa cells In contrast, the construct encoding the HNF1a-derived POUS and POUH domains fused to the HNF1b dimerization domain (HNF1baa) was localized both in the nucleus and the cytoplasm (Fig 4B) These data indicate that the POUS and POUH, but not the HNF1b- Ó FEBS 2004 HNF1b in nephrogenesis (Eur J Biochem 271) 3721 A B liz ca n io at tiv n io at pe ty c sa o en lo - HNF1aaa HNF1baa HNF1abb reference (95) 11.1 4.6 e-24 (226) N/C Dim HNF1bbb - N 4.4 0.129 (147) N/C 4.4 0.001 (114) N GFP n tra 11.2 5.7 e-8 (151) ph POUH POUS 351 1 80 71 70 321 321 81 351 50 100 150 200 relative pronephros size C 12 HNF1bbb fold induction 10 D HNF1abb HNF1baa HNF1abb HNF1baa HNF1aaa 0 50 100 150 200 250 300 ng expression vector Fig Function of the dimerization domain of HNF1b (A) The domains included in the HNF1 constructs are shown diagrammatically HNF1b is shown in purple and HNF1a in blue The black box indicates the 26 aa segment deleted from the HNF1b splice variant B (B) Molecular and cellular properties of HNF1 constructs were assayed in transfected cells as well as in developing embryos On the left, N and N/C refer to nuclear and nuclear plus cytoplasmic localization, respectively In the middle, the fold induction of the HNF1-dependent luciferase reporter after transfection of the HNF1 constructs into HeLa cells is shown On the right, statistical analysis of pronephric size in injected vs noninjected sides after expression of various HNF1 proteins Boxes include 75% of the values, and the vertical line represents the group median, and whiskers represent the outer quartile The P-value calculated using the Mann–Whitney test and the animal number scored per group shown at the far right The reference indicates the GFP-injected control animals (C) Increasing amounts of HNF1 expression constructs were cotransfected together with a HNF1dependent luciferase reporter into HeLa cells Mean of fold-activation of the reporter is represented by points, and error bars represent standard deviation of at least six replicates (D) Whole-mount immunostaining for pronephric tubules and duct in Xenopus larvae overexpressing the HNF1 protein indicated on one side The injected side is marked by an arrow Bar, 300 lm derived dimerization domain, determine the exclusively nuclear localization Transfection of the chimeric HNF1 constructs together with an HNF1 dependent luciferase reporter plasmid was used to measure the transactivation activity in HeLa cells Only the construct encoding the POUS and POUH of the HNF1b protein (HNF1abb) resulted in transactivation of the reporter gene similar to that mediated by the truncated HNF1b construct (HNF1bbb, Fig 4C) The presence of the HNF1b-derived dimerization domain in the chimeric protein (HNF1baa) failed to increase the transactivation of the reporter compared to the truncated HNF1a protein (HNF1aaa, Fig 4C) The influence of the chimeric constructs on kidney development was tested in overexpression experiments in Xenopus embryos Injection of mRNA encoding chimeric proteins with either the HNF1b-specific dimerization domain (HNF1baa) or the b-specific DNA binding domains (HNF1abb) of the HNF1b protein led to a reduction in pronephric size (Fig 4D) This indicates that the dimerization domain as well as the DNA binding domain of HNF1b interfere with pronephric development Ó FEBS 2004 3722 G Wu et al (Eur J Biochem 271) B A al c lo Dim HNF1aab POUS 183 HNF1aabH HNF1aabHS e ph ta N 3.2 8.5e-9 (148) N 5.5 2.7 e-14 (45) N 4.3 2.3e-14 (42) N 2.0 0.182 (85) - - 0.641 (81) reference (95) 351 196 229 319 196 229 a ns e yp t no - POUH 351 176 229 itio iv ct - GFP HNF1aabins26 n n io t iza 311 196 229 HNF1βHomeo 319 50 100 150 200 relative pronephros size C D fold induction HNF1aab HNF1aabH HNF1aabins26 HNF1aabH HNF1aab HNF1aabHS HNF1aabins26 HNF1aabHS 50 100 150 200 ng expression vector 250 300 Fig The homeodomain of HNF1b is essential for nuclear localization and interferes with pronephric development (A) The domains included in the HNF1 constructs are shown diagrammatically HNF1b is shown in purple and HNF1a in blue The black box indicates the 26 aa segment of the HNF1b splice variant B (B) Molecular and cellular properties of HNF1 constructs were assayed in transfected cells as well as in developing 19 embryos See Fig legend for details (C) Increasing amounts of HNF1 expression constructs were cotransfected together with a HNF1-dependent luciferase reporter into HeLa cells Mean of fold-activation of the reporter is represented by points, and error bars represent standard deviation of at least six replicates (D) Whole-mount immunostaining for pronephric tubules and duct in Xenopus larvae overexpressing the HNF1 protein indicated on one side The injected side is marked by an arrow Bar, 300 lm However, the quantification shows a clear distinction in the extent of the effect (Fig 4B), as the construct containing only the dimerization domain of HNF1b (HNF1baa) was considerably less efficient than the construct containing the POUS and POUH domains of HNF1b (HNF1abb) The homeodomain of HNF1b is essential for nuclear localization and interferes with pronephric development To explore the function of the HNF1b homeodomain (POUH) in more detail, chimeric constructs were created containing various parts of the HNF1b homeodomain region The chimeric gene constructs generated are shown diagrammatically in Fig 5A Functional performance as measured by subcellular localization, transactivation activity and effect on kidney development is summarized in Fig 5B All chimeric constructs containing the HNF1b homeodomain were found exclusively in the nuclear compartment, implying that this domain contributes to nuclear localization (Fig 5B) With regard to the transactivation potential, we observed that all chimeric constructs (Fig 5C) were less active than the truncated HNF1b protein Ó FEBS 2004 (HNF1bbb) in transfection assays (Fig 4C) While the constructs containing the HNF1b homeodomain but lacking the 26 aa segment (HNF1aab) gave approximately a fivefold transactivation of the reporter plasmid, the corresponding construct containing the 26 aa segment (HNF1aabins26) gave a threefold activation Successive truncation at the C-terminal end of the homeodomain in the constructs lacking the 26 aa segment (HNF1aabH, HNF1aabHS) led to a further decrease in the transactivation, but was still twofold above base level (Fig 5C) To identify whether the homeodomain influences kidney development in Xenopus embryos, mRNA from the chimeric constructs were injected into one cell at the two-cell stage, and the pronephric size was measured (Fig 5B,D) Three chimeric constructs with the HNF1bspecific homeodomain (HNF1aab, HNF1aabins26 and HNF1aabH) led to a reduction of the pronephric size with the constructs lacking the 26 aa segment (HNF1aab and HNF1aabH) being most effective (Fig 5B) In contrast, the construct lacking eight amino acid at the C-terminal part of the homedomain (HNF1aabHS) had no effect on pronephric size indicating the critical C-terminal border A construct producing the homeodomain alone (HNF1bHomeo) had no effect on pronephric size (Fig 5B), indicating that the HNF1 backbone is required to allow the protein function that interferes with kidney development We observed that both chimeric constructs lacking the 26 aa segment (HNF1aab and HNF1aabH) had an adverse effect on normal development as found for the truncated HNF1b lacking the 26 aa segment (HNF1bbbD, Fig 3E–J) In fact, most surviving animals were distorted allowing only a minority to be analyzed at stage 45 This adverse effect on embryogenesis was absent in the construct with the C-terminal truncation (HNF1aabHS) that has also lost its effect on nephrogenesis Partial rescue of Pax8/lim1-mediated pronephros malformation by HNF1b injection It has been reported that overexpression of the transcription factors, Pax8 and lim1, in Xenopus embryos led to the development of an abnormally large pronephros, and to the formation of ectopic pronephric tissue [44] As both these transcription factors are expressed at the neurula stage together with HNF1b in the pronephric anlage, we wondered whether simultaneous overexpression of HNF1b could overcome the effects of Pax8 and lim1 Overexpression of Pax8 or lim1 by themselves led only to marginal effects, but synergized to have a pronounced effect [44] We coinjected RNA encoding Pax8 and lim1 into one blastomere of the two-cell stage embryo together with GFP mRNA as a tracer Injected embryos were raised to the swimming tadpole stage, and processed to visualize pronephric tubules and duct Overexpression of Pax8 together with lim1 led to an enlargement of the pronephros as compared to embryos injected with GFP alone (Fig 6A) This size difference was shown to be significant using the Mann–Whitney test (Fig 6G) More importantly, ectopic pronephric tubules and small cysts close to the main pronephric body were observed using immunostaining on the injected side (Fig 6B) Such structures were seen in 16% of the injected embryos (Table 1), but never observed in HNF1b in nephrogenesis (Eur J Biochem 271) 3723 injections with mRNA encoding GFP or any HNF1 derivative Furthermore, 24% of the larvae coinjected with Pax8 and lim1 displayed cyst-like structures or a thickening of the tubules on the injected side (Table 1) Such abnormalities were seen in only 4% of larvae injected with the truncated HNF1b protein (HNF1bbb) Our results are similar to those using a different injection protocol reported previously [44] We coinjected mRNAs encoding Pax8 and lim1 together with HNF1b and GFP as a tracer into one cell of the two-cell stage Xenopus embryos Immunostaining for the pronephric tubules and duct at the tadpole stage showed that these embryos had pronephric structures similar to embryos injected with Pax8 and lim1 alone (Fig 6C,D) The pronephros appeared smaller in some larvae, but the size difference was not significant when compared with larvae injected with Pax8 and lim1 alone (Fig 6G) Furthermore, 17% of the samples were found to have ectopic tubules (Table 1) Cyst-like structures or thickening of the tubules were also found in 27% of the samples These data imply that the overexpression of Pax8 and lim1 is dominant to the effect of HNF1b It was not possible to inject higher concentrations of HNF1b mRNA, but as the truncated HNF1b protein (HNF1bbb) was more active in reducing the pronephric size (Fig 3C), this construct was coinjected together with Pax8 and lim1 These larvae had slightly smaller pronephroi in the injected side (Fig 6F), suggesting that HNF1bbb coinjection could overcome the effect mediated by Pax8 and lim1 More importantly, no larvae had ectopic tubules (Table 1) However, 28% of the samples were found to have cyst-like structures or thickening of the tubules (Fig 6E,F), similar to the fraction showing this phenotype in Pax8 and lim1 coinjected embryos (Table 1) Therefore, cyst-like structures and thicker tubules mediated by Pax8 and lim1 were not rescued by HNF1bbb Taken together these results indicate that the Pax8- and lim1-induced phenotype has two separate qualities One is the enlargement and ectopic formation of pronephros which could be antagonized by HNF1b and the other is the induction of cyst-like structures which could not be antagonized by HNF1b Discussion The transcription factors, HNF1a and HNF1b, display extensive structural similarities with indistinguishable DNA sequence binding specificity [2] Our data imply that they have acquired distinct functions during evolution as homologous domains of these two factors display disparate properties These include the subcellular localization, the transactivation potential as well as the ability to affect nephrogenesis HNF1b has a nuclear localization sequence located in the homeodomain Analyzing the subcellular localization of various chimeric HNF1 proteins, we observed an exclusively nuclear staining in transfected HeLa cells in all constructs containing the POU homeodomain (POUH) of the HNF1b protein This finding is consistent with our previous data showing nuclear localization of all truncated HNF1b transcription factors retaining the POUH domain [43] The occurrence of a 3724 G Wu et al (Eur J Biochem 271) Ó FEBS 2004 Fig Partial rescue of Pax8/lim1-induced kidney malformation by HNF1b (A–F) Lateral views of two representative larvae expressing the proteins listed at the left on one side Larvae are immunostained to visualize the pronephric tubules and duct (A, B) Enlarged pronephroi in Pax8/ lim1 (125 pg mRNA each per embryo) coinjected embryos (C, D) Enlarged pronephroi in embryos coinjected with Pax8 (125 pg mRNA per embryo), lim1 (125 pg mRNA per embryo), and HNF1b (250 pg mRNA per embryo) (E, F) Reduced pronephric size in embryos coinjected with Pax8 (125 pg mRNA per embryo), lim1 (125 pg mRNA per embryo) and truncated HNF1b (HNF1bbb, 250 pg mRNA per embryo) Anterior is to the left for the injected sides, and to the right for the noninjected sides, and dorsal is up Thickened tubules (T) characterized by a wider diameter and cyst-like structures or bubbles (B) are indicated by arrows Ectopic pronephric tubules are indicated by arrow heads Bar, 200 lm (G) Statistical analysis of pronephric size in injected vs noninjected sides after expression of various HNF1 proteins Boxes include 75% of the values, and the vertical line represents the group median, and whiskers represent the outer quartile The P-value calculated using the Mann–Whitney test and the animal number scored per group shown at the far right The reference indicates the GFP-injected control animals nuclear localization signal (NLS) in the homeodomain of the HNF1b protein is supported by the presence in the N-terminal region of the homeodomain (amino acid 229–235, Fig 7) of the amino acid sequence, KKMRRNR, predicted to be a NLS (PredictNLS Online, http:// cubic.bioc.columbia.edu) The NLS of the HNF1b protein and the HNF1a protein (KKGRRNR) differ by only one amino acid (M fi G) This change may hinder efficient nuclear translocation of HNF1a in transfected HeLa cells, and probably results in the nuclear as well as cytoplasmic localization typical for HNF1a Differential transactivation potential of the HNF1a and HNF1b protein The C-terminal transactivation domains of HNF1a and HNF1b are only weakly conserved (Fig 1), and in most transactivation assays HNF1a is approximately twofold Ó FEBS 2004 HNF1b in nephrogenesis (Eur J Biochem 271) 3725 Table Frequency of enlarged or ectopic pronephric tubules in mRNA-injected embryos Enlarged, enlarged relative pronephros size of injected side/ uninjected side > 120% Normal, normal relative to pronephros size of injected side/uninjected side between 80–120% Smaller, smaller relative to pronephros size of injected side/uninjected side < 80% Pronephric tubules (%) Embryos Enlarged Normal Smaller Ectopic Cyst-like structures or thickening (%) N Pax8 + lim1 Pax8 + lim1 + HNF1b Pax8 + lim1 + HNF1bbb HNF1bbb 49 40 20 34 38 38 17 42 78 16 17 0 24 27 28 83 77 111 226 Fig The nephrogenic effects of domains in the human HNF1b transcription factor and its mutants Functional domains are indicated above the schematic representation of HNF1b, and numbers refer to the amino acid positions The black box indicates the 26 aa segment deleted in the HNF1b splice variant B The three regions involved in nephrogenesis are marked by black lines beneath the HNF1b diagram The NLS is marked by a red line above the HNF1b diagram Naturally occuring HNF1b mutations are shown below as line diagrams to indicate what regions of the protein are missing Whether these HNF1b mutants cause an enlargement or a reduction of pronephric size [43] is indicated at the far right We showed that the dimerization domain of the HNF1b more potent than HNF1b [2] The truncated HNF1b protein failed to increase the transactivation potential of the protein (HNF1bbb) transactivated the reporter gene truncated HNF1a protein However, the replacement of strongly at saturating amounts, implying transactivational either the POUS and POUH domains or of the POUH properties outside of the classical transactivation domain This is distinct from HNF1a where the deletion of the domain alone with those from the HNF1b protein was transactivation domain results in low activity even at high sufficient to increase transactivation activity (Figs and 5) vector concentrations This confirms initial reports that Even though both domains are highly conserved between transactivation activity is confined to the C-terminal the two proteins there appears to be functional differences region in HNF1a, leading to the designation as transAs there is a progressive increase in the transactivation activation domain in both HNF1a and HNF1b proteins potential with the length of the HNF1b protein derived [52,53] segment, we deduce that several features contribute to the The 26 aa segment located between the POUS and POUH transactivation potential of the POUS and POUH domains of HNF1b domains of the HNF1b protein is highly evolutionarily conserved, and is the most striking difference between the HNF1a and HNF1b proteins (Fig 1) Our transactivation Domains of HNF1b involved in nephrogenesis assays showed that this b-specific segment plays distinct roles dependent on the HNF1 protein background In the full- 14 The simplicity of the Xenopus system allowed us to length HNF1b protein, it accentuated the transactivation differentiate the properties of the HNF1a and HNF1b activity (Fig 2), which is consistent with previous results proteins during kidney development The analysis of the [29,54] In the truncated HNF1b protein (HNF1bbb), molecular properties of the HNF1 proteins in cell cultures is deletion of this segment made no difference on its transtoo simplistic to evaluate functional properties in a develactivation potential Finally, in truncated HNF1a protein oping organism Our analysis of the morphogenetic poten(HNF1aaa), the insertion of the 26 aa segment (HNF1aaatial of chimeric HNF1 proteins during kidney development ins26) abolished the residual transactivation potential in Xenopus is most meaningful to this end Although we (Fig 2) These results imply that the 26 aa segment may concentrated our analysis on HNF1 proteins of human interact in a context-dependent manner with other factors origin, it is unlikely that protein functions are species and/or alters the conformation of the overall protein specific In fact, we have shown that the overexpression of structure Xenopus HNF1b protein in Xenopus embryos also led to a 3726 G Wu et al (Eur J Biochem 271) Ó FEBS 2004 proportion of defects starting at gastrulation It is not clear reduction in pronephric size (data not shown), supporting why the expression of these HNF1 proteins caused these the conserved function of HNF1b from Xenopus to humans early developmental problems A possible explanation is, As summarized in Fig 7, we identified three domains of the that HNF1b has several functions in early embryogenesis HNF1b protein that interfere with pronephric development distinct from nephrogenesis Knock-out experiments in the when swapped into the HNF1a protein These include the mouse established that HNF1b is required for yolk sac dimerization domain, the 26 aa segment and the homeodifferentiation [18,23], and overexpression in Xenopus of a domain It is noteworthy that the dimerization domain of dominant negative form of HNF1b interferes with mesothe HNF1b protein interferes with pronephros formation, derm induction [47] Furthermore, HNF1b mRNA injection despite that swapping of this region had no effect on the into zebrafish showed it to be involved in the specification of transactivation potential in transient transfection assays the rhombomeres identity in the hindbrain [55] It is possible (Fig 4C) This indicates that the nephrogenic effect is that some of our constructs may have disturbed similar distinct from the simple ability to transactive a reporter early developmental processes outside of the pronephric gene This emphasizes the importance of a complex anlage in the frog transcription factor background present in an appropriate In a recent report, we have found that the introduction of developmental context We also showed that the 26 aa HNF1b-specific segment plays an important role in pro- 15 human HNF1b mutant genes into Xenopus embryos leads to either a reduction or an enlargement of the pronephros nephric development This is most interesting, as this 26 aa [43] These observed phenotypes could not be correlated segment is the characteristic feature of the splice variant A directly to the structure of the mutated HNF1b protein Whereas the full-length splice variant A of HNF1b led to (summarized in Fig 7) All truncated HNF1b proteins agenesis of the pronephros in Xenopus embryos [35,43], the retaining the DNA binding domain (e.g Y352insA) as well splice variant B (HNF1bD) lacking the 26 aa segment did as a HNF1b mutant with an in-frame internal deletion in not interfere with pronephric development (Fig 3D) As the the POUS domain (R137–K161) that destroys DNA ratio of splice variant A : B alters during kidney development [15], our data support that this differential splicing binding resulted in a reduction in pronephric size In pattern plays a key role in nephrogenesis The functional contrast, all truncated HNF1b proteins with impaired DNA difference between the A and B splice variants in nephrobinding (e.g A263insGG and E101X) resulted in an genesis contrasts to their role during early embryogenesis, enlargement of the pronephros In this report we have where either variant can compensate for the loss of the identified three regions having a nephrogenic potential We native HNF1b gene during the differentiation of visceral deduce that these three regions must be present in a HNF1b endoderm from embryonic stem cells [29] mutant for a reduction in pronephric size, otherwise an Although the insertion of the 26 aa segment into enlargement occurs truncated HNF1a protein (HNF1aaa) generated a HNF1 protein (HNF1aaains26) with nephrogenic properties, delePartial cooperation of Pax8, lim1 and HNF1b tion of this segment from the truncated HNF1b protein in nephrogenesis (HNF1bbb) did not affect its ability to reduce the pronephric size (HNF1bbbD in Fig 3D) This indicates There are at least two other early expressed transcription that other regions of HNF1b protein contribute to the factors involved in kidney development in vertebrates In nephrogenic properties of HNF1b In fact, chimeric the Xenopus embryo, both Pax8 and lim1 are expressed proteins both containing the homeodomain of HNF1b, initially in the pronephric anlage at the time when HNF1b is but lacking the 26 aa segment (HNF1aab and expressed [41] Both these transcription factors are funcHNF1aabH), led to agenesis of the pronephros (Fig 5B), tionally important, as overexpression of either protein led to thus, demonstrating the importance of the HNF1b homean enlarged pronephros with ectopic pronephric structures odomain in kidney development We were able to restrict [44] This effect was additive when both transcription factors the region of the homeodomain responsible for this effect to were coexpressed, and the effect of Pax8 could be mimicked the POUH domain from 229 to 319 (Fig 5B) However, the by Pax2 [44], whose expression starts shortly after Pax8 in the pronephric anlage [56] The importance of lim1 [57] and homeodomain alone was unable to reduce pronephric size, Pax2 [58] in mammalian development was shown in knockindicating that the homeodomain of HNF1b functions only out mice that had severe defects in organogenesis including in the context of the HNF1 backbone Deletion of the Cagenesis of the kidney The nephrogenic role of Pax8 has terminal amino acids of the HNF1b homeodomain (311– only been identified in a Pax2-deficient background Mice 319) abolished its potential to interfere with pronephric lacking Pax8 additionally are unable to form any nephric formation The corresponding eight amino acid in the structure due to a block in the mesenchymal-epithelial HNF1a protein are not required for DNA binding [14] As transition [59] two amino acids within this eight amino acid region (Q311 In an effort to evaluate whether HNF1b cooperates with and A317) are different in the HNF1a and HNF1b protein, Pax8 and lim1 during kidney development, we coinjected all it is possible that one or both of these two amino acids play three transcription factors into Xenopus embryos We a functional role of the HNF1b POUH domain during confirmed that overexpression of Pax8 together with lim1 nephrogenesis Alternatively, the entire POUH homeoresults in an enlargement of the pronephros and the domain of HNF1b may be necessary for proper function development of ectopic pronephric tubules [44] As HNF1b Expression of all truncated HNF1 proteins lacking the overexpression inhibits kidney formation and Pax8/lim1 26 aa segment but containing the HNF1b homeodomain overexpression is nephrogenic, it is possible that a simple (HNF1bbbD, HNF1aabH or HNF1aab) had an adverse antagonism exists between these factors during kidney effect on the survival of the embryos and resulted in a high Ó FEBS 2004 development We show here that HNF1b can only partially rescue Pax8/lim1-induced nephrogenesis The truncated HNF1b protein rescued the Pax8/lim1-induced enlargement and ectopic tubule formation However, Pax8/lim1-induced thickening of tubules and cyst-like structure formation remained essentially unchanged These results suggest that HNF1b activity can overcome part of the nephrogenic potential of Pax8 and lim1 Most importantly, the data also reveal that Pax8/lim1 and HNF1b are not simple antagonists during nephrogenesis, but that Pax8/lim1 also have distinct morphogenetic properties Acknowledgements We are most grateful to R Vignali and P.D Vize for the Xenopus HNF1b and lim1, Pax2/8 cDNAs, respectively, and Elizabeth A Jones for antibodies 3G8 and 4A6 We thank Kathy Astrahantseff, Christoph Waldner and Karin Dudziak for critical reading of the manuscript This work was supported by the Deutsche Forschungsgemeinschaft (Ry5/7–2) References Gehring, W.J., Affolter, M & Burglin, T (1994) Homeodomain proteins Annu Rev Biochem 63, 487–526 Cereghini, S (1996) Liver-enriched transcription factors and hepatocyte differentiation FASEB J 10, 267–282 Pontoglio, M (2000) Hepatocyte nuclear factor 1, a transcription factor at the crossroads of glucose homeostasis J Am Soc Nephrol 11 (Suppl 16), S140–S143 Deryckere, F., Byrnes, L., Wagner, A., McMorrow, T & Gannon, F (1995) Salmon HNF1: cDNA sequence, evolution, tissue specificity and binding to the salmon serum albumin promoter J Mol Biol 247, 1–10 Sun, Z & Hopkins, N (2001) vhnf1, the MODY5 and familial GCKD-associated gene, regulates regional specification of the zebrafish gut, pronephros, and hindbrain Genes Dev 15, 3217– 3229 Bartkowski, S., Zapp, D., Weber, H., Eberle, G., Zoidl, C., Senkel, S., Klein-Hitpass, L & Ryffel, G.U (1993) Developmental regulation and tissue distribution of the liver transcription factor LFB1 (HNF1) in Xenopus laevis Mol Cell Biol 13, 421–431 Demartis, A., Maffei, M., Vignali, R., Barsacchi, G & De Simone, V (1994) Cloning and developmental expression of LFB3/HNF1 beta transcription factor in Xenopus laevis Mech Dev 47, 19–28 Frain, M., Swart, G., Monaci, P., Nicosia, A., Stampfli, S., Frank, R & Cortese, R (1989) The liver-specific transcription factor LF-B1 contains a highly diverged homeobox DNA binding domain Cell 59, 145–157 Bach, I., Mattei, M.G., Cereghini, S & Yaniv, M (1991) Two members of an HNF1 homeoprotein family are expressed in human liver Nucleic Acids Res 19, 3553–3559 10 Baumhueter, S., Mendel, D.B., Conley, P.B., Kuo, C.J., Turk, C., Graves, M.K., Edwards, C.A., Courtois, G & Crabtree, G.R (1990) HNF-1 shares three sequence motifs with the POU domain proteins and is identical to LF-B1 and APF Genes Dev 4, 372–379 11 Zapp, D., Bartkowski, S., Zoidl, C., Klein-Hitpass, L & Ryffel, G.U (1993) Genomic structure of the Xenopus laevis liver transcription factor LFB1 Gene 134, 251–256 12 Rose, R.B., Endrizzi, J.A., Cronk, J.D., Holton, J & Alber, T (2000) High-resolution structure of the HNF-1alpha dimerization domain Biochemistry 39, 15062–15070 13 Narayana, N., Hua, Q & Weiss, M.A (2001) The dimerization domain of HNF-1alpha: Structure and plasticity of an intertwined HNF1b in nephrogenesis (Eur J Biochem 271) 3727 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 four-helix bundle with application to diabetes mellitus J Mol Biol 310, 635–658 Chi, Y.I., Frantz, J.D., Oh, B.C., Hansen, L., Dhe-Paganon, S & Shoelson, S.E (2002) Diabetes mutations delineate an atypical POU domain in HNF-1alpha Mol Cell 10, 1129–1137 Cereghini, S., Ott, M.O., Power, S & Maury, M (1992) Expression patterns of vHNF1 and HNF1 homeoproteins in early postimplantation embryos suggest distinct and sequential developmental roles Development 116, 783–797 Ott, M.O., Rey-Campos, J., Cereghini, S & Yaniv, M (1991) vHNF1 is expressed in epithelial cells of distinct embryonic origin during development and precedes HNF1 expression Mech Dev 36, 47–58 Lazzaro, D., De Simone, V., De Magistris, L., Lehtonen, E & Cortese, R (1992) LFB1 and LFB3 homeoproteins are sequentially expressed during kidney development Development 114, 469–479 Barbacci, E., Reber, M., Ott, M., Breillat, C., Huetz, F & Cereghini, S (1999) Variant hepatocyte nuclear factor is required for visceral endoderm specification Development 126, 4795–4805 Coffinier, C., Barra, J., Babinet, C & Yaniv, M (1999) Expression of the vHNF1/HNF1beta homeoprotein gene during mouse organogenesis Mech Dev 89, 211–213 Reber, M & Cereghini, S (2001) Variant hepatocyte nuclear factor expression in the mouse genital tract Mech Dev 100, 75–78 Pogge, V., Strandmann, E., Nastos, A., Holewa, B., Senkel, S., Weber, H & Ryffel, G.U (1997) Patterning the expression of a tissue-specific transcription factor in embryogenesis: HNF1 alpha gene activation during Xenopus development Mech Dev 64, 7–17 Weber, H., Strandmann, E.P., Holewa, B., Bartkowski, S., Zapp, D., Zoidl, C & Ryffel, G.U (1996) Regulation and function of the tissue-specific transcription factor HNF1 alpha (LFB1) during Xenopus development Int J Dev Biol 40, 297–304 ´ Coffinier, C., Thepot, D., Babinet, C., Yaniv, M & Barra, J (1999) Essential role for the homeoprotein vHNF1/HNF1b in visceral endoderm differentiation Development 126, 4785–4794 Pontoglio, M., Barra, J., Hadchouel, M., Doyen, A., Kress, C., Bach, J.P., Babinet, C & Yaniv, M (1996) Hepatocyte nuclear factor inactivation results in hepatic dysfunction, phenylketonuria, and renal Fanconi syndrome Cell 84, 575–585 Pontoglio, M., Sreenan, S., Roe, M., Pugh, W., Ostrega, D., Doyen, A., Pick, A.J., Baldwin, A., Velho, G., Froguel, P., Levisetti, M., Bonner-Weir, S., Bell, G.I., Yaniv, M & Polonsky, K.S (1998) Defective insulin secretion in hepatocyte nuclear factor 1alpha- deficient mice J Clin Invest 101, 2215–2222 Pontoglio, M., Prie, D., Cheret, C., Doyen, A., Leroy, C., Froguel, P., Velho, G., Yaniv, M & Friedlander, G (2001) HNF1alpha controls renal glucose reabsorption in mouse and man EMBO Reports 1, 359–365 Shih, D.Q., Screenan, S., Munoz, K.N., Philipson, L., Pontoglio, M., Yaniv, M., Polonsky, K.S & Stoffel, M (2001) Loss of HNF-1alpha function in mice leads to abnormal expression of genes involved in pancreatic islet development and metabolism Diabetes 50, 2472–2480 Lee, Y.H., Sauer, B & Gonzalez, F.J (1998) Laron dwarfism and non-insulin-dependent diabetes mellitus in the Hnf-1alpha knockout mouse Mol Cell Biol 18, 3059–3068 Haumaitre, C., Reber, M & Cereghini, S (2003) Functions of HNF1 family members in differentiation of the visceral endoderm cell lineage J Biol Chem 278, 40933–40942 Bluteau, O., Jeannot, E., Bioulac-Sage, P., Marques, J.M., Blanc, J.F., Bui, H., Beaudoin, J.C., Franco, D., Balabaud, C., Laurent-Puig, P & Zucman-Rossi, J (2002) Bi-allelic inactivation of TCF1 in hepatic adenomas Nat Genet 32, 312–315 Ó FEBS 2004 3728 G Wu et al (Eur J Biochem 271) 31 Ryffel, G.U (2001) Mutations in the human genes encoding the transcription factors of the hepatocyte nuclear factor (HNF) and HNF4 families functional and pathological consequences J Mol Endocrinol 27, 11–29 32 Bingham, C., Ellard, S., Cole, T.R., Jones, K.E., Allen, L.I., Goodship, J.A., Goodship, T.H., Bakalinova-Pugh, D., Russell, G.I., Woolf, A.S., Nicholls, A.J & Hattersley, A.T (2002) Solitary functioning kidney and diverse genital tract malformations associated with hepatocyte nuclear factor-1beta mutations Kidney Int 61, 1243–1251 33 Bingham, C., Ellard, S., Van’t Hoff, W.G., Simmonds, H.A., Marinaki, A.M., Badman, M.K., Winocour, P.H., Stride, A., Lockwood, C.R., Nicholls, A.J., Owen, K.R., Spyer, G., Pearson, E.R & Hattersley, A.T (2003) Atypical familial juvenile hyperuricemic nephropathy associated with a hepatocyte nuclear factor1beta gene mutation Kidney Int 63, 1645–1651 34 Woolf, A.S., Wynyard, P.J.D., Hermanns, M.M & Welham, S.J.M (2003) Maldevelopment of the human kidney and lower urinary tract: An Overview In The Kidney: from Normal Development to Congenital Disease (Vize, P.D., Woolf, A.S & Bard, J.B.L., eds), pp 377–393 Academic Press, Amsterdam 35 Wild, W., Pogge, V., Strandmann, E., Nastos, A., Senkel, S., Lingott-Frieg, A., Bulman, M., Bingham, C., Ellard, S., Hattersley, A.T & Ryffel, G.U (2000) The mutated human gene encoding hepatocyte nuclear factor 1beta inhibits kidney formation in developing Xenopus embryos Proc Natl Acad Sci USA 97, 4695–4700 36 Gresh, L., Fischer, E., Reimann, A., Tanguy, M., Garbay, S., Shao, X., Hiesberger, T., Fiette, L., Igarashi, P., Yaniv, M & Pontoglio, M (2004) A transcriptional network in polycystic kidney disease EMBO J 37 Hiesberger, T., Bai, Y., Shao, X., McNally, B.T., Sinclair, A.M., Tian, X., Somlo, S & Igarashi, P (2004) Mutation of hepatocyte nuclear factor-1beta inhibits Pkhd1 gene expression and produces renal cysts in mice J Clin Invest 113, 814–825 38 Vize, P.D., Carroll, T.J & Wallingford, J.B (2003) Introduction: Embryonic Kidneys and other nephrogenic models In The Kidney From Normal Development to Congenital Disease (Vize, P.D., Woolf, A.S & Bard, J.B.L., eds), pp 1–6 Academic Press, Amsterdam 39 Jones, E.A (2003) Molecular control of pronephric development: An overview In The Kidney From Normal Development to Congenital Disease (Vize, P.D., Woolf, A.S & Bard, J.B.L., eds), pp 93–118 Academic Press, Amsterdam 40 Carroll, T.J & McMahon, A.P (2003) Overview: The Molecular Basis of Kidney Development In The Kidney: from Normal Development to Congenital Disease (Vize, P.D., Woolf, A.S & Bard, J.B.L., eds), pp 343–376 Academic Press, Amsterdam 41 Ryffel, G.U (2003) What can a frog tell us about human kidney development Nephron Exp Nephrol 94, e35–e43 42 Brandli, A.W (1999) Towards a molecular anatomy of the Xenă opus pronephric kidney Int J Dev Biol 43, 381–395 43 Bohn, S., Thomas, H., Turan, G., Ellard, S., Bingham, C., Hattersley, A.T & Ryffel, G.U (2003) Distinct molecular and morphogenetic properties of mutations in the human HNF1beta 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 gene that lead to defective kidney development J Am Soc Nephrol 14, 2033–2041 Carroll, T.J & Vize, P.D (1999) Synergism between Pax-8 and lim-1 in embryonic kidney development Dev Biol 214, 46–59 Rupp, R.A., Snider, L & Weintraub, H (1994) Xenopus embryos regulate the nuclear localization of XMyoD Genes Dev 8, 1311– 1323 Ryffel, G.U & Lingott, A (2000) Distinct promoter elements mediate endodermal and mesodermal expression of the HNF1alpha promoter in transgenic Xenopus Mech Dev 90, 65–75 Vignali, R., Poggi, L., Madeddu, F & Barsacchi, G (2000) HNF1beta is required for mesoderm induction in the Xenopus embryo Development 127, 1455–1465 Peng, H.B (1991) Xenopus laevis: Practical uses in cell and molecular biology Solutions and protocols Methods Cell Biol 36, 657–662 Nieuwkoop, P.D & Faber, J (1975) Normal Table of Xenopus Laevis (Daudin) Elsevier/North-Holland Publishing Co, Amsterdam, the Netherlands Vize, P.D., Jones, E.A & Pfister, R (1995) Development of the Xenopus pronephric system Dev Biol 171, 531–540 Thomas, H., Badenberg, B., Bulman, M., Lemm, I., Lausen, J., Kind, L., Roosen, S., Ellard, S., Hattersley, A.T & Ryffel, G.U (2002) Evidence for haploinsufficiency of the human HNF1alpha gene revealed by functional characterization of MODY3-associated mutations Biol Chem 383, 1691–1700 Nicosia, A., Monaci, P., Tomei, L., De Francesco, R., Nuzzo, M., Stunnenberg, H & Cortese, R (1990) A myosin-like dimerization helix and an extra-large homeodomain are essential elements of the tripartite DNA binding structure of LFB1 Cell 61, 1225–1236 Sourdive, D.J., Chouard, T & Yaniv, M (1993) The HNF1 C-terminal domain contributes to transcriptional activity and modulates nuclear localisation C R Acad Sci III 316, 385–394 Ringeisen, F., Rey-Campos, J & Yaniv, M (1993) The transactivation potential of variant hepatocyte nuclear factor is modified by alternative splicing J Biol Chem 268, 25706– 25711 Wiellette, E.L & Sive, H (2003) vhnf1 and Fgf signals synergize to specify rhombomere identity in the zebrafish hindbrain Development 130, 3821–3829 Heller, N & Brandli, A.W (1999) Xenopus Pax-2/5/8 orthologues ¨ novel insights into Pax gene evolution and identification of Pax-8 as the earliest marker for otic and pronephric cell lineages Dev Genet 24, 208–219 Shawlot, W & Behringer, R.R (1995) Requirement for Lim1 in head-organizer function Nature 374, 425–430 Torres, M., Gomez-Pardo, E., Dressler, G.R & Gruss, P (1995) Pax-2 controls multiple steps of urogenital development Development 121, 4057–4065 Bouchard, M., Souabni, A., Mandler, M., Neubuser, A & Busslinger, M (2002) Nephric lineage specification by Pax2 and Pax8 Genes Dev 16, 2958–2970  ... 2004 Fig The related human transcription factors, HNF1a and HNF1b HNF1b and HNF1a are represented schematically (top) The domains are indicated and numbers below the domains refer to the amino acid... DNA binding domains (HNF1abb) of the HNF1b protein led to a reduction in pronephric size (Fig 4D) This indicates that the dimerization domain as well as the DNA binding domain of HNF1b interfere... construct containing only the dimerization domain of HNF1b (HNF1baa) was considerably less efficient than the construct containing the POUS and POUH domains of HNF1b (HNF1abb) The homeodomain of HNF1b