Lithium increases PGC-1a expression and mitochondrial biogenesis in primary bovine aortic endothelial cells Ian T Struewing, Corey D Barnett, Tao Tang and Catherine D Mao Graduate Center for Nutritional Sciences, University of Kentucky, Lexington, USA Keywords cell signaling; CREB; FOXO; gene expression; mitochondria Correspondence C D Mao, Graduate Center for Nutritional Sciences, University of Kentucky, 900 Limestone Street, Lexington, KY 40536, USA Fax: +1 859 257 3646 Tel: +1 859 323 4933, Ext 81377 E-mail: cdmao2@uky.edu (Received 14 January 2007, revised 13 March 2007, accepted 23 March 2007) doi:10.1111/j.1742-4658.2007.05809.x Lithium is a therapeutic agent commonly used to treat bipolar disorder and its beneficial effects are thought to be due to a combination of activation of the Wnt ⁄ b-catenin pathway via inhibition of glycogen synthase kinase-3b and depletion of the inositol pool via inhibition of the inositol monophosphatase-1 We demonstrated that lithium in primary endothelial cells induced an increase in mitochondrial mass leading to an increase in ATP production without any significant change in mitochondrial efficiency This increase in mitochondrial mass was associated with an increase in the mRNA levels of mitochondrial biogenesis transcription factors: nuclear respiratory factor-1 and -2b, as well as mitochondrial transcription factors A and B2, which lead to the coordinated upregulation of oxidative phosphorylation components encoded by either the nuclear or mitochondrial genome These effects of lithium on mitochondrial biogenesis were independent of the inhibition of glycogen synthase kinase-3b and independent of inositol depletion Also, expression of the coactivator PGC-1a was increased, whereas expression of the coactivator PRC was not affected Lithium treatment rapidly induced a decrease in activating Akt-Ser473 phosphorylation and inhibitory Forkhead box class O (FOXO1)-Thr24 phosphorylation, as well as an increase in activating c-AMP responsive element binding (CREB)-Ser133 phosphorylation, two mechanisms known to control PGC-1a expression Together, our results show that lithium induces mitochondrial biogenesis via CREB ⁄ PGC-1a and FOXO1 ⁄ PGC-1a cascades, which highlight the pleiotropic effects of lithium and reveal also novel beneficial effects via preservation of mitochondrial functions Lithium is commonly used as a therapeutic agent in the treatment of bipolar disorder (or maniac depression) [1], and as a mimic of Wnt signaling both in vivo and in vitro [2] The beneficial effects of lithium in the treatment of bipolar disorder are thought to be due to a combination of activation of the Wnt ⁄ b-catenin signaling pathway, via inhibition of the glycogen synthase kinase-3b (GSK3b) [3], and depletion of the intracellular inositol pool via the inhibition of various enzymes in the phosphoinositide pathways, for example, the rate-limiting enzyme inositol monophosphatase (IMPase-1) [4,5] In addition, evidence suggests that lithium is neuroprotective and is beneficial in the treatment of ischemia–reperfusion injuries and neurodegenerative diseases, including Alzheimer’s, Parkinson’s and Huntington’s disease [6] For Huntington’s disease, it has been proposed that lithium increases the degradation of aggregated Hungtintin-mutated Abbreviations BAEC, bovine aortic endothelial cell; COX, cytochrome c oxidase; CREB, c-AMP responsive element binding; DCF, 2¢-7¢-dichlorofluorescein; FOXO, Forkhead box class O; GSK3, glycogen synthase kinase; IMP, inositol monophosphatase; LPS, lipopolysaccharide; MTP, mitochondria transmembrane potential; NRF, nuclear respiratory factor; OXPHOS, oxidative phosphorylation; PGC, peroxisome proliferators-activated receptor-gamma coactivator; PRC, PGC-1a-related coactivator; TFAM, transcription factor A mitochondria; TFB, transcription factor B; UCP, uncoupling protein FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS 2749 Lithium increases mitochondrial biogenesis I T Struewing et al proteins via autophagy in an IMPase-1-dependent manner [7] By contrast, the preconditioning and protective effects of lithium in brain and heart ischemia–reperfusion injury models appear to depend upon the inhibition of GSK3b [8,9] Although much attention has been paid to the inhibitory effects of lithium on GSK3b and IMPase-1 activity, lithium acts as a competitive inhibitor of numerous Mg2+-dependent factors, transporters and enzymes, including a key glycolytic enzyme, phosphoglucomutase [10] Such a wide spectrum of potential targets is consistent with the narrow range of lithium doses that can be used therapeutically in the absence of toxicity and with limited side effects [1] GSK3b plays a pivotal role in the canonical Wnt ⁄ b-catenin signaling pathway by phosphorylating and targeting b-catenin to the proteasomal degradation pathway in the absence of Wnt signals In the presence of Wnt signals, GSK3b becomes phosphorylated on Ser9 and is inactivated, allowing the cytosolic stabilization and nuclear translocation of b-catenin In the nucleus, b-catenin interacts with the TCF ⁄ LEF transcription factors and activates the transcription of genes involved in cell proliferation and adhesion [11] Lithium, via inhibition of GSK3b, increases b-catenin ⁄ TCF transcriptional activity and induces proliferation in various tumor cell lines [2,12] By contrast, lithium did not induce proliferation or activation of the transcriptional activity of b-catenin ⁄ TCF complexes in primary bovine aortic endothelial cells (BAEC), but rather induced G2 ⁄ M cell-cycle arrest leading to a cell senescence-like phenotype [13] In these cells, lithium treatment activated the tumor suppressor p53 resulting in increased expression of the cyclin-dependent kinase inhibitor p21cip at both the mRNA and protein levels; this was found to be independent of depletion of the intracellular inositol pool [13] Similarly, an increase in p21cip protein stability was also seen in human endothelial cells in response to lithium and this was shown to be dependent upon inhibition of GSK3b [14] The antiproliferative effects of lithium have also been seen in other primary cells, including human umbilical vein endothelial cells [15], vascular smooth muscle cells [13], lens epithelial cells [16], and some tumor cell lines such as B16 melanoma [17] and P19 embryonal carcinoma cells [18] Both GSK3b and p53 have been shown to localize to mitochondria GSK3b was localized to the mitochondria of cerebellar cells [19] and enrichment of active GSK3b in mitochondria and nuclei has also been observed in neuronal cells [20] In the immortalized neuronal cell line SH-SY5Y, mitochondrial and active GSK3b was shown to interact with p53 and thereby promote the pro-apoptotic activities of p53 [21] 2750 By contrast, activation ⁄ inhibition of GSK3b was shown to control glycolysis–oxidative phosphorylation (OXPHOS) coupling and apoptosis in HeLa tumor cells via the release ⁄ binding of hexokinase II from the mitochondria outer membrane [22] However, these effects appear to be cell-type dependent, because lithium had the opposite effect in B16 melanoma cells in association with a cell-cycle arrest [17] Recently, a novel p53 target has been identified, synthesis of cytochrome oxidase (SCO2), which is responsible for biogenesis of the cytochrome oxidase complex in the inner mitochondrial membrane and thus links the tumor suppressor p53 with the control of energy metabolism and glycolysis switching in tumor cells [23] Although lithium has been shown to affect glycolysis via direct inhibition of phosphoglucomutase [10], its effects on mitochondrial energy metabolism and biogenesis have not been addressed Mitochondrial biogenesis is highly orchestrated, and involves signal cross-talk between the nucleus and mitochondria leading to the coordinated regulation of gene expression [24,25] The mitochondrial genome encodes only 13 OXPHOS components; the other OXPHOX components and all the factors required for assembly of the OXPHOX complexes and for replication and transcription of the mitochondrial genome are encoded by the nuclear genome The nuclear transcription factors, nuclear respiratory factor (NRF)-1 and -2, in conjunction with the coactivators peroxisome proliferators activated receptor-c coactivator (PGC)-1a and PGC-1a-related coactivator (PRC), control the expression of nuclear-encoded OXPHOX genes and transcription factor A mitochondria (TFAM), transcription factor B (TFB)-1 and TFB-2 These mitochondrial transcription factors in turn control transcription and replication of the mitochondrial genome [25] Under physiological conditions, changes in mitochondrial biogenesis and mass within cells and tissues reflect changes in energy demand and hormonal status, and depend mainly on changes in the activity and ⁄ or expression of the transcription factors NRF1 and NRF2 and coactivator PGC-1a [25,26] By contrast, under pathological conditions, such as oxidative stress [27], an increase in mitochondrial biogenesis can occur as a compensatory mechanism in response to mitochondrial dysfunction and damage, however, ATP production is usually impaired Mitochondrial dysfunction or loss is a common characteristic of many neurodegenerative diseases such as Alzheimer’s and Parkinson’s [28], and has also been seen in postmortem brain biopsies from subjects with bipolar disorder [29] Mutated huntingtin protein, responsible for the development of Huntington’s disease, was shown to cause FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS I T Struewing et al Results Lithium increases mitochondrial mass in BAEC A B Fold increase of ATP levels BAEC were treated with 10 mm lithium, a dose commonly used to achieve GSK3b inhibition and activation of Wnt ⁄ b-catenin signaling [33], and the levels of ATP were measured using a standard luminescent luciferin ⁄ luciferase assay Lithium treatment resulted in a significant 1.4 ± 0.1- and 1.49 ± 0.2-fold increase in ATP production at 24 and 36 h, respectively (P < 0.01), whereas treatment with mm valproate, another mood stabilizer [33], had a weaker effect, with a 1.23 ± 0.1-fold increase at both 24 and 36 h of 24h 36h 1.75 * 1.5 * * 1.25 0.75 0.5 0.25 Relative levels of the Mitochondria Transmembrane Potential Fig Lithium increases mitochondrial mass in BAEC (A) Lithium increases ATP production BAEC were plated h prior to treatment with either 10 mM NaCl (Na), 10 mM LiCl (Li) or mM Na-valproate (VPA) for 24 or 36 h After cell lysis, levels of ATP per lg of protein were determined as described in Experimental procedures The graph represents mean ± SEM of the fold increase in treated versus control NaCl-treated cells obtained in 6–8 independent experiments performed in duplicate (B) Lithium increases the mitochondria membrane potential BAEC were treated with the indicated doses of NaCl, LiCl or VPA for 36 h prior to staining with 500 nM of Mitotracker-CMXRos for 45 The accumulation of Mitotracker-CMXRos in active mitochondria was determined by measuring the fluorescence intensity at kexc550 ⁄ kem590 and the cell number was quantified subsequently using CyQuant staining and measurement of the fluorescence intensity at kexc485 ⁄ kem535 The MTP levels were corrected for the variation in cell number and the results are expressed as relative levels with the control NaCl-treated cells equal to The graph represents mean ± SEM obtained in eight independent experiments preformed in triplicate (C) Lithium increases mitochondrial mass in BAEC BAEC were treated with 10 mM NaCl (Na), 10 mM LiCl (Li) or mM valproate (VPA) for 36 h prior to isolation of total DNA Levels of mitochondrial DNA and levels of nuclear DNA were quantified by real-time PCR with specific bovine primers for the mitochondrial encoded genes, cytochrome b (cyt-b) and 12S rRNA, as well as for the mitochondria genome control region (CR) and for the nuclear encoded genes: TFAM, ribosome biogenesis regulator-1 (RRS1) and ATP synthase-b (ATP-beta) The ratio of mitochondrial DNA to nuclear DNA was determined for each treatment and for each of the pair of MitDNA ⁄ NuDNA: 12S ⁄ TFAM, Cytb ⁄ ATPb and CR ⁄ RRS1 Results are expressed in relative levels with the control NaCl equal to Mean ± SEM obtained from 3–4 independent experiments are reported in the graph In all cases, after Student’s t-test analysis, the results were considered significant at P < 0.05 (*) and of inositol depletion Moreover, our results reveal that lithium treatment affects two cascades known to converge to the upregulation of PGC-1a expression by CREB and Forkhead box class O (FOXO1) transcription factors and hence to increase mitochondrial biogenesis Na Li VPA * 1.5 0.5 mM Li 10 mM Na C 10 mM Li Na mM VPA Li VPA 1.75 Relative Mitochondria Mass (AU) Mit-DNA versus Nu-DNA mitochondrial dysfunction by interfering with cAMPresponsive element binding (CREB) transcription factor-dependent regulation of PGC-1a expression [30] Inversely, increasing the expression of PGC-1a was shown to be neuroprotective in the mutated-hungtintin transgenic mouse model of Huntington disease [30] Interestingly, the preconditioning effects of various substances and factors in brain, heart and vessel ischemic–reperfusion injuries also seem to be mediated in part by an increase in mitochondrial biogenesis and preservation of mitochondrial function [31,32] The protective effects of lithium, both during preconditioning in heart and brain ischemic–reperfusion injury models [8,9], and in neurodegenerative disease models [6], have been studied only in relation to the apoptotic function of mitochondria, and not their energy homeostatic function In this study, we show that lithium increases mitochondrial biogenesis in BAEC leading to an increase in ATP production Unexpectedly, this novel effect of lithium was independent of the inhibition of GSK3b Lithium increases mitochondrial biogenesis FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS 1.5 * * 12S/TFAM Cytb/ATPbeta * 1.25 0.75 0.5 0.25 CR/RRS1 2751 I T Struewing et al 2752 LiCl DETA-NO treatment (P < 0.05) (Fig 1A) Because lithium was shown to inhibit various enzymes of the glycolytic and tricarboxylic acid pathways and to decrease ATP production via glycolysis [17,34], we first tested whether lithium increases ATP production via changes in mitochondrial activity and ⁄ or mass in BAEC The mitochondria transmembrane potential (MTP) is a marker of mitochondrial OXPHOS activity that can be assessed using fluorescent probes accumulating in mitochondria depending on the MTP such as Mitotracker-CMXRos [35] In this study, the fluorescent probes, nonyl acridine orange and Mitotracker-Green, usually used for mitochondria staining independent of MTP, were also sensitive to the uncoupler carbonyl cyanide 3-chlorophenylhydrazone (not shown) and thus were not used to directly determine mitochondrial mass per cell Also, we have previously shown that BAEC treated with lithium were arrested in the G2 ⁄ M phase and displayed a reduced cell number compared with sodium-treated cells [13] Therefore, cell number was determined using CYQUANT staining and fluorescence quantification, and MTP levels were corrected by the cell number The increase in ATP production induced by lithium was associated with a significant, 1.33 ± 0.05-fold, increase in the relative MTP levels per cell in BAEC treated for 36 h (P < 0.05), whereas valproate had no significant effect (Fig 1B) Because an increase in MTP can reflect either an increase in mitochondrial mass or an increase in the efficiency of mitochondrial OXPHOS, we determined the effects of lithium on mitochondrial mass using a real-time PCRbased assay Relative levels of mitochondrial DNA versus nuclear DNA were determined using three different genes encoded by the mitochondrial genome and three encoded by the nuclear genome to avoid bias of differential efficiency of amplification between primer sets As shown in Fig 1C, lithium treatment increased significantly the relative levels of mitochondrial DNA, about 1.35 ± 0.14, 1.4 ± 0.07 and 1.49 ± 0.07-fold for 12S ⁄ TFAM, cytochrome b ⁄ ATP synthase-b and CR ⁄ RRS1 MitDNA ⁄ NuDNA pairs, respectively, which indicated an increase of the mitochondrial mass, whereas VPA had no significant effect Taken together, these results show that lithium treatment in BAEC increases mitochondrial mass significantly, leading to an increase in ATP production without changes in mitochondrial efficiency This lithium-induced increase in mitochondrial mass was not accompanied by any significant changes in mitochondrial morphology or distribution, as shown by immunofluorescence microscopy of BAEC stained with Mitotracker-Deep Red (Fig 2) Mitochondria in lithium-treated BAEC were found around the nucleus and protrusion, as in control cells, NaCl Lithium increases mitochondrial biogenesis Fig Lithium does not affect mitochondrial distribution in BAEC BAEC were grown on glass chamber slides and treated with 10 mM NaCl, 10 mM LiCl or the NO donor DETA-NO for 72 h prior to addition of 100 nM Mitotracker-Deep Red633 for 45 at 37 °C After removal of the staining solution, fresh medium was added for 10 incubation prior to cell fixation in 3.7% formaldehyde and slide mounting Immunofluorescence confocal images of several fields (n ¼ 10) were taken and representative images are shown (scale bars: 20 lm) repeated treatments with 50 lm of the NO donor, DETA-NO, a known inducer of mitochondrial biogenesis [36], also increased the mitochondrial mass but the mitochondria were mainly perinuclear (Fig 2) Lithium increases mitochondrial biogenesis markers To determine whether the increase in mitochondrial mass was due to an increase in mitochondrial biogenesis, the mRNA levels of various OXPHOS components encoded by either the nuclear genome or the mitochondrial genome were assessed using real-time RT-PCR As shown in Fig 3, after 24 or 36 h treatment of BAEC with lithium, the mRNA levels of mitochondrial-encoded genes such as cytochrome oxidase II (1.65 ± 0.07-fold, complex IV), ATP synthase subunit-6 (2.5 ± 0.32-fold, complex V), and cytochrome b (3.4 ± 0.4-fold, complex III) were increased FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS I T Struewing et al Fold increase of mRNA levels of mitochondrial enclosed genes A 24h 36h * * * * * ATP synthase-6 COX-II B Fold increase of mRNA levels of nuclear enclosed genes Fig Lithium increases the mRNA levels of oxidative phosphorylation components BAEC were treated with either 10 mM NaCl or 10 mM LiCl for the indicated times prior to RNA extraction, and the levels of target mRNAs were quantified using real-time PCR as described in Experimental procedures Levels of target mRNAs were corrected for variation of the mRNA levels with the internal control rpL30 and for each target gene the ratio of the corrected level obtained in LiCl-treated versus NaCl-treated cells was determined The fold induction of the target mRNA is reported in the graph in (A) for OXPHOS genes encoded by the mitochondrial genome: cytochrome oxidase subunit II (COX-II), ATP synthase-6 and cytochrome b (cyt-b), and in the graph in (B) for OXPHOS genes encoded by the nuclear genome: ATP synthase-b, cytochrome oxidase subunits VIa and VIc (COX VIa and VIc), cytochrome c (cyt-c) and mitochondria DNA polymerase (MitDNA polymerase) Mean ± SEM values obtained from 3–5 independent experiments are reported in the graphs and the results were considered significant at P < 0.05 (*) (Student’s t-test) (C) Lithium increases the level of ATP synthase-b protein BAEC were treated for 36 h with 10 mM NaCl, 10 mM LiCl or mM VPA prior to cell lysis and western blot analysis of the levels of ATP synthase-b and the loading control a-tubulin The intensity of the protein bands was evaluated by densitometry and the ratio of ATP synthase-b intensity to a-tubulin intensity was determined for each treatment A representative experiment is shown and the mean ± SEM results obtained from seven independent experiments are reported in the graph Results were considered significant at P < 0.05 (*) (Student’s t-test) Lithium increases mitochondrial biogenesis 24h cyt-b 36h * * * * * * ATP COX-VIc synthase−β β C COX-VIa Na Li cyt-c Mit-DNA polymerase VPA ATP synthase-β α-Tubulin significantly, however, no significant difference was observed between the two treatment times Similarly, 36 h lithium treatment led to a significant increase in the RNA levels of nuclear-encoded genes such as cytochrome oxidase VIc and VIa by 1.85 ± 0.08 and 1.56 ± 0.1-fold, respectively (complex IV), and ATPsynthase subunit-b by 2.66 ± 0.57-fold (complex V), whereas the mRNA levels of cytochrome c and mitochondria DNA polymerase were increased slightly, by  1.3 ± 0.04 and 1.33 ± 0.1-fold, respectively, without reaching statistical significance (Fig 3) Levels of uncoupling protein (UCP2) mRNA were also significantly increased after 36 h lithium treatment  1.4 ± 0.1 fold, which was similar to the increase observed for the mitochondrial biogenesis markers This coordinated increase in mRNA levels for the mitochondrial biogenesis markers and UCP2 is in agreement with the unaffected OXPHOS efficiency observed after lithium treatment (Fig 1) To confirm that the increase in mRNA was accompanied by an increase in protein levels, we assessed the expression of the ATP synthase-b protein by immunoblotting A significant, 1.7 ± 0.3-fold, increase in ATP synthase-b was observed after lithium treatment, although valproate had no effect (Fig 3C) Our results show that lithium increased the expression of mitochondrial biogenesis markers in a coordinated fashion, although the effects Ratio 0.96 * 1.75 1.5 1.25 0.75 0.5 0.25 Na Li VPA of lithium on mRNA levels for mitochondrial-encoded genes are stronger than the effects on the expression of nuclear-encoded genes This may be due to an increase in mitochondrial mass (Fig 1) and ⁄ or a greater increase in the expression of mitochondrial transcription factors Lithium increases mRNA levels for transcription factors involved in mitochondrial biogenesis Expression of OXPHOS genes encoded by the mitochondrial genome is under the control of specific transcription factors: TFAM, TFB1 and TFB2, whose expression, as well as expression of the nuclear-encoded OXPHOS genes, is mainly under the control of the NRF1 and NRF2 transcription factors [25] FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS 2753 Lithium increases mitochondrial biogenesis I T Struewing et al c-Myc, a b-catenin target gene [37], has also been shown to increase the levels and activity of TFAM [38] Therefore, we tested the mRNA levels of all these transcription factors in response to lithium A significant increase in mRNA levels for TFAM and TFB2 was seen after 24 h lithium treatment,  2.2 ± 0.5and 1.7 ± 0.2-fold, respectively, and these effects were even more pronounced at 36 h with a 4.4 ± 1.1and 4.1 ± 1-fold increase, respectively (Fig 4A) Among the nuclear transcription factors, only NRF2b mRNA levels were increased significantly at 24 h, by Fold increase of target mRNA levels in LiCl vs NaCl treated BAEC A 24h 36h * * * * * * * * TFAM TFB2 NRF-2β β NRF-1 c-myc Fold change of hydrogen peroxide levels B 30 1.6 2h * 1.4 * 1.2 1.6 ± 0.14-fold (Fig 4A) After 36 h lithium treatment, NRF2b mRNA levels were further increased by 3.3 ± 0.5-fold, whereas mRNA levels of NRF1 and c-myc were increased only approximately twofold Thus, the increased expression of the mitochondrial markers observed at 24 h (Fig 2) was mainly associated with increased expression of TFAM and TFB2, as well as of NRF2b Redox-dependent activation of NRF1 and NRF2 is known to mediate the increase in expression of the mitochondrial biogenesis transcription factors observed in response to various oxidative stresses such as lipopolysacharride (LPS) treatment [27] Therefore, we assessed the effects of short lithium treatments on intracellular levels of H2O2 using a 5- (and 6)-chloromethyl-2¢-7¢-dichlorodihydrofluorescein diacetate (CMH2DCFDA) probe, which is deacetylated by cellular esterase and oxidized in the presence of H2O2 to give a fluorescent 2¢-7¢-dichlorofluorescein (DCF) compound Treatment of BAEC with 10 mm lithium for between 30 and h had no significant effect on intracellular H2O2 levels, whereas treatment with lm LPS resulted in a small but significant increase after h treatment ( 1.36 ± 0.1-fold; Fig 4B) Longer lithium treatments resulted in a decrease in peroxide production (not shown) Therefore, lithium-induced mitochondrial biogenesis was not due to a compensatory mechanism following mitochondrial damage induced by an increase in oxidative stress Lithium effects on mitochondrial biogenesis are partially dependent on inositol depletion 0.8 0.6 0.4 0.2 NaCl LiCl LPS Fig Lithium increases the mRNA levels of transcription factors involved in the control of mitochondrial biogenesis in the absence of oxidative stress (A) Lithium increases the mRNA levels of mitochondrial biogenesis transcription factors BAEC were treated for the indicated times with either 10 mM NaCl as a control or 10 mM LiCl prior to RNA extraction, and the levels of target mRNAs were quantified using real-time RT-PCR The graph represents mean ± SEM results obtained from five independent experiments (B) Lithium does not induce oxidative stress in BAEC Equal numbers of BAEC were treated for the indicated times with 10 mM NaCl as control, 10 mM LiCl or lM LPS as positive control for oxidative stress prior to staining with 2.5 lM CM-H2DCFDA for 30 in the dark The fluorescence intensities were measured at kexc485 ⁄ kem535 Mean ± SEM results obtained from 4–6 independent experiments performed in triplicate are reported in the graphs Results were considered significant at P < 0.05 (*) (Student’s t-test) 2754 Lithium is a competitive inhibitor of various enzymes of the inositol pathway including the limiting enzyme IMPase-1, resulting in a marked depletion of the intracellular inositol pool that can be restored by the addition of myo-inositol [5] We tested whether lithium was able to increase the expression of mitochondrial biogenesis markers after pretreatment with mm myoinositol As shown in Fig 5A, addition of mm myo-inositol attenuated the effects of lithium with a 20–25% decrease in mRNA levels for TFAM, cytochrome b and ATP synthase-6, although it did not significantly affect these levels in NaCl-treated cells However, the changes between LiCl + myo-inositoltreated cells and LiCl-treated cells were not statistically significant using one-way anova To further assess the involvement of inositol depletion in lithium-induced mitochondrial biogenesis, lithium-dependent changes in mitochondrial mass were monitored in the absence or presence of mm myo-inositol pretreatment As shown in Fig 5B, myo-inositol pretreatment did not FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS I T Struewing et al Lithium increases mitochondrial biogenesis Fold increase of target mRNA levels in treated versus control NaCl treated BAEC A Na Na + myo-inositol Li Li + myo-inositol * * * * * * * * ATP synthase-6 cyt-b ATP − synthase−β COX-VIc TFAM Relative levels of mitochondrial DNA vs nuclear DNA B 1.75 1.5 1.25 0.75 0.5 0.25 NaCl NaCl + myo-inositol LiCl LiCl + myo-inositol Fig Maintenance of the inositol pool had minimal effects on lithium-induced mitochondrial biogenesis After pretreatment with mM myo-inositol to maintain the intracellular inositol pool, BAEC were treated for 36 h with either 10 mM NaCl or 10 mM LiCl prior to either RNA extraction (A) or DNA isolation (B) (A) mRNA levels of the indicated genes were determined using real-time PCR Mean ± SEM results obtained from six independent experiments are reported in the graphs Results were considered significant at P < 0.05 (*) (one-way ANOVA followed by posthoc Bonferroni’s test) (B) Mitochondrial mass was determined from the ratio mitochondrial DNA ⁄ nuclear DNA using real-time PCR as described in Experimental procedures Mean ± SEM results obtained from three independent experiments are reported in the graph Results were considered significant at P < 0.05 (*) (Student’s t-test) affect the lithium-dependent increase of mitochondrial mass as determined by the ratio of MitDNA ⁄ NuDNA These results indicated that myo-inositol pretreatment did not prevent lithium-induced mitochondrial biogenesis Lithium effects on mitochondrial biogenesis are independent of GSK3b inhibition Active GSK3b has been shown to be localized in mitochondria [20], we also examined whether the effects of lithium on the expression of mitochondrial biogenesis markers were dependent upon GSK3b inhibition by comparing the effects of two other unrelated inhibitors of GSK3b, valproate and indirubin-3¢-monoxime Valproate has been shown to indirectly inhibit GSK3b [39], although its activation of the Wnt ⁄ b-catenin signaling pathway in various cells appears to depend mainly on histone deacetylases inhibition [40] Among these various inhibitors, only lithium treatment led to a significant increase in the mRNA levels of mitochondrial-encoded genes, ATP synthase-6 and cytochrome b, nuclear-encoded genes, ATP synthase-b, cytochrome oxidase VIc and TFAM (Fig 6A) By contrast, indirubin had no effect, whereas valproate increased,  1.5-fold, mRNA levels for the nuclearencoded genes cytochrome oxidase VIc and TFAM (Fig 6A) These results were in agreement with a weak or lack of effect of valproate on ATP production and mitochondrial mass, respectively (Fig 1) To further rule out a role for GSK3b in the lithium-dependent increase in mitochondrial biogenesis markers, BAEC were transfected with wild-type GSK3b, constitutive active S9A-GSK3b and the inactive kinase-dead K85A-GSK3b for 36 h prior to the analysis of mitochondrial and nuclear gene expression If the effects of lithium on mitochondrial biogenesis were dependent on GSK3b inhibition, expression of the catalytic inactive K86R-GSK3b form should also increase expression of the mitochondrial biogenesis markers However, mRNA levels of the nuclear genes ATP synthase-b, cytochrome oxidase VIc and TFAM, and of the mitochondrial genes ATP synthase-6 and cytochrome b, were not significantly affected by expression of any forms of GSK3b including the inactive K86RGSK3b form (Fig 6B) By contrast, levels of interleukin-8 mRNA were increased  3.6 ± 1.3 fold in response to expression of the inactive K85-GSK3b, as expected for a target gene of GSK3b inhibition [41] Our results with the various inhibitors of GSK3b and expression of the inactive form of GSK3b indicate that the lithium-induced increase of mitochondrial biogenesis is independent of GSK3b inhibition Lithium increases cell size in the absence of Akt activation Of the various inhibitors used in this study, only lithium led to a significant increase in cell size and spreading in BAEC (Fig 7A), as well as cell-cycle arrest [13] Although activation of the Akt pathway via Akt phosphorylation on Ser473 and Akt-dependent inactivation of GSK3b by phosphorylation on Ser9 have been implicated in skeletal and cardiac hypertrophy [42,43], lithium treatment was associated with a decrease in FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS 2755 Lithium increases mitochondrial biogenesis A Li Val I T Struewing et al Ind Fold increase of target mRNA levels in treated Vs control NaCl treated BAEC * * * * * ATP synthase-6 B Fold increase of target mRNA levels in GSK3β versus control transfected BAEC * cyt-b Control ATP β synthase–β WT COX-VIc S9A TFAM K85R ATP COX-VIc ATP cyt-b synthase-6 synthase–β C TFAM IL-8 GSK3β PCR3 Wt S9A K85R Phospho-S9 GSK3β His-Tag Fig Lithium effects on mitochondrial biogenesis are independent of GSK3b inhibition BAEC were either treated for 36 h with various known inhibitors of GSK3b, 10 mM LiCl, mM VPA, and lM indirubin (IND) (A) or transfected for 36 h with either wildtypeGSK3b (WT), the constitutive active S9A-GSK3b (S9A) or the inactive K85R-GSK3b (K85R) prior to RNA extraction mRNA levels of the indicated genes were determined by real-time PCR Levels of IL-8 mRNAs were determined as a control for the dominant effects of the inactive K85R-GSK3b Mean ± SEM results obtained from four independent experiments are reported in the graphs Results were considered significant at P < 0.05 (*) (Student’s t-test) (C) The expression of the histidine-tagged GSK3b proteins and their Ser9 phosphorylation status were controlled by western blotting Akt-S473 phosphorylation rather than an increase in BAEC As shown in Fig 7B, lithium had no significant effect on inhibitory GSK3b-S9 phosphorylation early during treatment, between and 30 min, but increased it significantly at later times with a twofold 2756 increase at 24 h These results are in agreement with the effects of chronic lithium treatment on GSK3b-S9 phosphorylation in various cell lines, including neuronal cells [44] However, in BAEC, lithium decreased activating Akt-S473 phosphorylation significantly, about twofold, as early as 30 into treatment (Fig 7B), and this decrease persisted over 24 (Fig 7B) and 36 h (not shown) This decrease in active Akt was consequently associated with a decrease at h in the transcription factor FOXO1 phosphorylation on Thr24, an Akt substrate site in vivo [45] (Fig 7B) Valproate, like lithium, did not induce an increase but rather a decrease in Akt-S473 phosphorylation, although the latter occurred later after 24 h treatment (Fig 7B) Similarly, although to a lesser extent than lithium, valproate increased inhibitory GSK3b-S9 phosphorylation By contrast, indirubin induced rapid disappearance of both the activating Akt-S473 and the inhibitory GSK3b-S9 phosphorylations at treatment periods between and 24 h, compared with control-treated cells (Fig 7B) Therefore, valproate and lithium appeared to induce similar changes in the Akt ⁄ FOXO1 signaling cascade in primary BAEC except for stronger and faster effects with lithium Lithium increases the expression of PGC-1a in BAEC The finding that the Akt ⁄ FOXO1 cascade is affected by lithium in BAEC prompted us to investigate the effects of lithium on the expression of PGC-1a as it has previously been shown that activation of Akt led to downregulation of PGC-1a expression via nuclear exclusion of FOXO1 in skeletal muscle cells [46] Levels of PGC1-a mRNA, as well as those of the related coactivator PRC, were determined using real-time PCR after BAEC treatments (Fig 8A) As expected for valproate, a short branched-chain fatty acid, there was a strong increase in the mRNA levels of PGC-1a,  3.1 ± 0.7-fold at 36 h treatment (Fig 8A) Indeed, these results, although novel for valproate, are consistent with the regulation of PGC-1a expression by nutrient availability and, in particular, by various fatty acids [26,47] Surprisingly, lithium treatment was also associated with an increase in PGC-1a mRNA levels,  2.6 ± 0.6-fold, although no statistically significant change in PRC expression was observed (Fig 8A) In addition to being regulated by FOXO1 transcription factor, PGC-1a expression is also upregulated by active CREB transcription factor [26] Lithium is a wellknown inducer of CREB activation via an increase in activating CREB-S133 phosphorylation in neuronal cells [48] Therefore, we tested the effects of lithium on FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS I T Struewing et al Lithium increases mitochondrial biogenesis A NaCl LiCl B VPA 30 min Treatments Na Li Indirubin VPA Ind Na Li 24 h 2h VPA Ind Na Li VPA Ind Na Li VPA Ind phosphoS9-GSK3β GSK3β phosphoS473-Akt Akt β-actin Fold changes versus NaCl C PhosphoS9-GSK/GSK Li PhosphoS473-AKT/AKT 3.5 VPA Li PhosphoT24-FOXO1/FOXO1 VPA 2.5 2.5 Li VPA 2.5 2 1.5 1.5 1.5 1 0.5 0.5 0 30 2h 6h 24 h 0.5 30 2h 6h 24 h 30 2h 6h 24 h Fig Lithium increases BAEC cell size and affects Akt ⁄ FOXO1 signaling cascade (A) Lithium increases the spreading and size of BAEC BAEC were plated for 12 h prior to being treated with 10 mM NaCl, 10 mM LiCl, mM VPA or lM indirubin for 36 h Phase-contrast microscope images were taken and representative images are shown for each treatment (B) Lithium increases the inhibitory phosphorylation of GSK3b on Ser9 in absence of Akt activation BAEC were treated as indicated in (A) for min, 30 min, h and 24 h prior to cell harvesting and analysis of GSK3b and Akt phosphorylations using immunoblotting with specific phospho-S9-GSK3b and phospho-S473-Akt antibodies Akt-dependent phosphorylation of FOXO1 on Thr24 was also studied in parallel Total levels of GSK3b, Akt and FOXO1 were used to normalize for changes in expression and b-actin was used as loading control A representative experiment is shown and the fold changes obtained after lithium treatment from four independent experiments are reported in the graphs CREB-S133 phosphorylation in BAEC and found that treatment with lithium, or valproate, for h significantly induced activating CREB-S133 phosphorylation by  2- and 1.5-fold, respectively, compared with NaCl-treated cells (Fig 8B) These results suggest that lithium increases PGC-1a expression via at least two mechanisms: activation of FOXO1 and CREB Discussion Lithium is commonly used to treat bipolar disorder [1] and recent evidence suggests that it might also be beneficial in the treatment of neurodegenerative diseases [6] However, the mechanisms involved in both the beneficial effects and side effects of lithium are not fully identified We report a novel effect of lithium at doses commonly used to inhibit GSK3b activity and mimic Wnt signaling [33] In primary endothelial cells, lithium treatment triggered an increase in mitochondrial mass and ATP production without changing mitochondrial efficiency This increase in mitochondrial biogenesis correlated with the upregulation of key master controllers of mitochondrial biogenesis: transcription factors NRF1 and NRF2b and coactivator PGC-1a [25,26] In addition, we showed that two different signaling cascades known to regulate PGC-1a expression, inactivation of Akt [46] and activation of CREB [26], were triggered by lithium treatment An increase in mitochondrial biogenesis has been described in numerous physiological conditions as an adaptive mechanism during muscle exercise, calorie restriction, hormone treatment and cell differenti- FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS 2757 Lithium increases mitochondrial biogenesis Fold increase of target mRNA levels In treated vs control NaCl-treated BAEC A Na 4.5 Li VPA I T Struewing et al Ind * 3.5 * 2.5 1.5 0.5 PRC PGC-1α 8h B Treatments Na Li VPA Ind phosphoS133-CREB phosphoS133-ATF1 CREB β-actin Fold changes versus NaCl PhosphoS133-CREB/CREB 2.5 Li VPA 1.5 0.5 8h Fig Lithium increases the expression of the coactivator PGC-1a (A) Lithium increases the levels of PGC-1a mRNA BAEC were treated for 36 h with 10 mM NaCl, 10 mM LiCl, mM VPA or lM indirubin prior to RNA extraction and the levels of PGC-1a and PRC mRNAs were quantified using real-time RT-PCR The graph represents mean ± SEM results obtained from five independent experiments (B) Lithium increases the levels of phospho-S133-CREB BAEC were treated for h with 10 mM NaCl, 10 mM LiCl, mM VPA or lM indirubin prior to cell lysis and the levels of phosphoS133-CREB and total CREB were analyzed using immunoblotting with b-actin as the loading control A representative experiment is shown the fold changes obtained after lithium treatment in three independent experiments are reported ation, as well as in various pathological situations to compensate for mitochondrial dysfunction or damage [24,25] It is possible that lithium as a potential competitive inhibitor of some Mg2+-dependent mitochondrial enzymes and transporters, might induce mitochondrial biogenesis in response to mitochondrial dysfunction However, the kinetics of the increase in mitochondrial mass and ATP production observed 2758 between 18 and 36 h of treatment are incompatible with initial mitochondrial dysfunction (Fig 1) Similarly, the kinetics are incompatible with a compensatory mechanism following mitochondrial oxidative damage because, in this case, an initial decrease in both mitochondrial mass and ATP production would be expected prior to the recovery phase Moreover, treatment of BAEC with lithium did not increase intracellular levels of hydrogen peroxide (Fig 4B), which would be indicative of oxidative stress Also consistent with the absence of lithium-induced oxidative stress in BAEC, the distribution of mitochondria within cells was not altered compared with sodium-treated cells, apart from an increase in cell and mitochondrion size (Fig 2) The distribution of mitochondria within cells is mainly dependent on movement along microtubules and changes in the cell cycle [49] Lithium treatment increases microtubule stabilization in a GSK3b-dependent manner [50,51] Lithium also affects the cell cycle, although in a different manner depending on the cell type In particular, lithium induces G2 ⁄ M cell-cycle arrest in several cell types, including BAEC [13,18] The microtubule polymerizing agent, taxol, has been shown to induce both an increase in mitochondrial biogenesis and G2 ⁄ M cell-cycle arrest in the human 143B osteosarcoma cell line, but unlike lithium, these changes were associated with an abnormal distribution of mitochondria around the nucleus [52] By contrast, mitochondrial DNA replication starts at the G1 ⁄ S phase transition, whereas mitochondrial biogenesis peaks in the G2 ⁄ M phase, allowing equal distribution of mitochondria between the two daughter cells during cytokinesis [49,53] Thus, the lithiuminduced cell-cycle arrest in G2 ⁄ M might be sufficient to explain lithium-induced mitochondrial biogenesis Our results also showed that this lithium-dependent increase in mitochondrial biogenesis in BAEC was associated with an increase in mRNA levels for coactivator PGC-1a but not coactivator PRC (Fig 8A) This is consistent with the cell-cycle arrest induced by lithium Indeed, regulation of PRC expression is mainly dependent on cell-proliferation status, i.e increased in the presence of growth factors and decreased in contact-inhibited cells [26] However, regulation of PGC-1a expression during cell differentiation is well documented, as are the effects of lithium on cell differentiation PGC-1a expression increases during regenerative skeletal myogenesis as the cells grow, fuse and acquire contractile functions [54], and both lithium and Wnt signaling activate myogenic differentiation in cell-culture systems and the muscle regeneration model [55,56] By contrast, activation of the canonical Wnt ⁄ b-catenin signaling pathway in highly differentiated FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS I T Struewing et al brown adipocytes represses the expression of PGC-1a and the PGC-1a target gene UCP1, leading to their dedifferentiation to white adipocytes [57] Lithium treatment as well as overexpression of Wnt10b in Rb– ⁄ – MEF resulted in the blockade of both adipocytic differentiation and PGC-1a expression [57] Although lithium and Wnt signals have opposite effects on skeletal myogenesis and adipocyte differentiation, in both cases PGC-1a levels were associated with the differentiated states of the cells However, BAEC are already differentiated and lithium triggers a senescent-like phenotype detectable after days of treatment [13] Although a compensatory increase in mitochondrial biogenesis is also observed in senescent fibroblasts to maintain constant ATP production, the efficiency of mitochondrial OXPHOS is reduced because of increased proton leakage [58] In lithium-treated cells, there was an increase in ATP production in parallel with the increase in mitochondrial mass, indicating constant production of ATP per mitochondria and hence no change in mitochondrial efficiency (Fig 1) Therefore, the lithium-induced increase in mitochondrial biogenesis is not secondary to the establishment of cell senescence However, regulation of PGC-1a is also triggered by metabolic and environmental stresses [25,26] Our results showed that lithium induced a decrease in Akt phosphorylation on Ser473 and Akt activity, because phosphorylation of FOXO1 on Thr24, an Akt substrate site, also decreased (Fig 7) Although lithium has been shown to increase Akt phosphorylation in various cell lines, it is important to note that, in all these studies, cells were serum-starved prior to the addition of lithium, which was not the case in this study The observed decrease in Akt and FOXO1 phosphorylation was consistent with changes in the pattern of gene expression observed after lithium treatment (unpublished), which includes the increase in PGC-1a expression (Fig 8) Indeed, levels of PGC-1a expression have been shown to depend on the Akt ⁄ FOXO1 cascade in skeletal muscle [46] Both the decrease in activating Akt phosphorylation and increase in PGC1a expression are reminiscent of the induction of a stress pathway, which remains to be identified as lithium does not induce oxidative stress in BAEC (Fig 4) Interestingly, mild stresses triggered, for example, by physical exercise or preconditioning agents such as the K-ATP-dependent channel opener diazoxide, increase mitochondrial biogenesis allowing the preservation of mitochondrial functions during stronger stress [59,60] The preconditioning effects of lithium have been described both in brain and heart ischemia–reperfusion models and this protective effect was associated with Lithium increases mitochondrial biogenesis activation of the Akt survival pathway and inhibition of GSK3b [6,8,9] Our results showed that the effects of lithium on mitochondrial biogenesis were independent of the inhibition of GSK3b because expression of an inactive or constitutive form of GSK3b had no effect on expression of the mitochondrial biogenesis markers (Fig 6) However, we have shown also that lithium increased the activating CREB-S133 phosphorylation, which is another mechanism controlling the expression of PGC-1a [26] A protective CREBdependent pathway has been described during preconditioning in both brain and heart ischemia–reperfusion models [61,62] In particular, resveratrol, is a wellknown activator of PGC-1a, has been used as preconditioning agent [26] Therefore, it is conceivable that some of the protective effects of lithium during preconditioning might involve a CREB ⁄ PGC-1a cascade Although caution should be taken in extrapolating our results in primary BAEC to other cell types, including neuronal cells, it is noteworthy that lithium also induces CREB phosphorylation on Ser133 and activation in neuronal cells [48], and lithium treatment was shown to reverse the decreased expression of several OXPHOS genes in brain tissues from bipolar disorder subjects [29] Also, recent studies have established a crucial role of PGC-1a in protection against neurodegenerative diseases [30,63] Therefore, our study reveals a novel lithium-dependent mechanism leading to an increase of PGC-1a expression and mitochondrial biogenesis that appears highly relevant for the beneficial effects of lithium treatment in bipolar disorder and neurodegenerative diseases Experimental procedures Materials The chemicals lithium chloride, sodium valproate, dmyo-inositol, DETA-NO (2,2¢-(hydroxynitrosohydrazono) bis-ethanimine), indirubin-3¢-monoxime and the mouse anti-(tubulin-a) mAb were from Sigma-Aldrich (St Louis, MO) Mitochondria probes, Mitotracker-CMXRos and Mitotracker-633-Deep Red, and the intracellular H2O2 probe, 5- (and 6)-chloromethyl-2¢-7¢-dichlorodihydrofluorescein diacetate (CM-H2DCFDA) and the rabbit polyclonal ATP synthase-b were from Molecular Probes (Eugene, OR) Mouse anti-GSK3b mAb were from Transduction Laboratories (Lexington, KY) and the rabbit polyclonal anti-(b-actin), anti-(phospho-S9-GSK3b), anti-(phosphoS473-Akt), anti-(Akt), anti-(phosphoT24 ⁄ T32-FOXO1 ⁄ 3a), anti-(FOXO1, antiphosphoS133-CREB) and anti-CREB sera, and secondary horseradish-peroxidase-conjugated antibodies were from Cell Signaling (Beverly, MA) FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS 2759 Lithium increases mitochondrial biogenesis I T Struewing et al Cell culture and transfection Primary BAEC were purchased from Cambrex (Walkersville, MD) and maintained in culture in Dulbecco’s modified Eagles’ medium containing gỈL)1 d-glucose and supplemented with 10% fetal bovine serum, 100 mL)1 penicillin and 100 lgỈmL)1 streptomycin (Gibco-Invitrogen, Carlsbad, CA) All BAEC treatments were carried out in the same medium Transient transfections of BAEC with the various GSK3b constructs were performed using Exgen500 reagent (Fermentas, Hanover, MD) as recommended by the manufacturer GSK3b constructs Wild-type Xenopus GSK3b and inactive K85R-GSK3b cDNA were kindly provided by I Dominguez (Boston University Medical Center, Boston, MA) [64] The constitutive mutant S9A-GSK3b was also generated by PCR using the mutated forward primer 5¢-GCCACCATGTCGGGAAG GCCGAGAACCACTGCCTTTG-3¢ and the His6-tag was added in frame at the C-terminus of all the constructs by PCR using the reverse primer 5¢-TCAATGGTGATG GTGATGGTGTCCGGAGGAGTTGGAGGCAG-3¢ Phase contrast and immunofluorescence confocal imaging BAEC were plated on glass chamber slides 18 h prior to being treated with the various inhibitors for 24 h Phasecontrast images were taken with an inverted microscope (Nikon, TE2000) For the immunofluorescence staining, BAEC were treated with either 10 mm NaCl or 10 mm LiCl for 48 h, whereas treatment with 50 lm DETA-NO was performed for days with repeated treatments every 24 h as described previously [36], prior to being stained with 200 nm Mitotracker-Deep Red for 45 accordingly to the manufacturer’s recommendation (Molecular Probes) Slides were then mounted in presence of the antifading agent vectashield containing the nuclear stain DAPI (Vector Laboratories, Burlingame, CA) Serial images were taken using Leica immunofluorescence confocal microscope Whole-cell extracts and western blot analysis After washing with cold NaCl ⁄ Pi, cells were lysed in 50 mm Hepes pH 7.4, 0.1% Chaps, mm dithiothreitol and mm EDTA supplemented with protease and phosphatase cocktail inhibitors (Sigma-Aldrich) Equal amounts of the proteins were denaturated by boiling in Laemmli buffer, fractionated on SDS–PAGE and transferred onto Immobilon P membrane (Millipore, Billerica, MA) After blocking, membranes were incubated with the various pri- 2760 mary antibodies as indicated and subsequently with the appropriate secondary antibodies conjugated to horseradish peroxidase (Cell Signaling) Immunoreactive proteins were detected using SuperSignalÒ chemiluminescence (Pierce Chemical Co, Rockford, IL) and the intensity of the resulting bands was determined by densitometry using scion software To control for variations in loadings, the same membrane was stripped, washed and blocked prior to being incubated with either anti-(a-tubulin) or anti(b-actin) sera RNA extraction, reverse transcription and real-time PCR RNA extractions were performed using Trizol reagent (Invitrogen) Total RNA (1 lg) was subjected to DNAse I treatment for 15 (Invitrogen) prior to being reverse transcribed at 42 °C in presence of 0.5 lg oligo(dT) and 200 U reverse transcriptase for 50 (Invitrogen) Quantitative real-time PCR was performed in duplicate, with an equivalent of 16 ng total RNA per reaction and 10 pmole of each specific primer for the target genes (Table 1), using the SyBr Green PCR core reagent and the ABI7000 apparatus (Applied Biosystems, Foster City, CA) For each target gene, the threshold cycle number (Ct) was calculated using sds v 1.7 software (Applied Biosystems) and the duplicates averaged The Ct differences (DCt) of the target gene and the internal control rpL30 gene for each cell treatments were determined and the relative levels of target mRNA were calculated following the equation 2DCt treated ) DCt control, where control represents NaCl-treated cells At least five independent experimental treatments were performed DNA extraction and quantification of mitochondrial DNA by real-time PCR After washes in cold NaCl ⁄ Pi, the cells were scraped off the plate in NaCl ⁄ Pi and centrifuged at 500 g for The cell pellet was then resuspended in 200 lL of NaCl ⁄ Pi with lgỈmL)1 RNAse A prior to being subjected to DNA extraction using the DNeasy kit (Qiagen, Valencia, CA) The amounts of mitochondrial and nuclear DNA were determined by real-time PCR using the SyBr green Core reagent kit (Applied Biosystems) Two different genes for each genome were studied in parallel to minimize variation in primer pair efficiency We used specific primer pairs for cytochrome b, mitochondria control region and 12S ribosomal RNA as markers of the mitochondrial genome and ATP synthase subunit-b, ribosome biogenesis regulator-1 and mitochondrial transcription factor A as markers of the nuclear genome The sequences of the various primers are provided in Table For each primer set, quantification was performed in duplicate with FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS I T Struewing et al Lithium increases mitochondrial biogenesis Table Sequences of primers used for real-time PCR Bovine genes Genome Primer sequences (5¢– to 3¢) 12S rRNA Mitochondria COX II Mitochondria Cytochrome b Mitochondria ATP synthase subunit-6 Mitochondria Control region Mitochondria MitRNA polymerase Nuclear MitDNA polymerase Nuclear Cytochrome c1 Nuclear COX VIa Nuclear COX VIc Nuclear ATP synthase subunit b Nuclear Uncoupling protein-2 Nuclear Mit-transcription factor A (TFAM) Mit-transcription factor B2 (TFB2) NRF1 Nuclear NRF2b ⁄ GABP-b Nuclear c-myc Nuclear PGC1-a Nuclear PRC Nuclear rpL30 Nuclear RRS1 Nuclear Interleukin-8 Nuclear Fwd: CCTACAATAGCCGACGCACT Rev: GGTGAGGTTTATCGGGGTTT Fwd: GCCAGGGGAGCTACGACTAT Rev: CGCAAATTTCTGAGCATTGA Fwd: AATGCATTCATCGACCTTCC Rev: CCGTTTGCGTGTATGTATCG Fwd: TCGCTTTGTAACCCTCCAAC Rev: GGGATGGCTATGCCTAGGTT Fwd: CAACCCCAAAGCTGAAGTTCT Rev: CCTTGCGTAGGTAATTCATTC Fwd: GGACTCCACACACATGATGC Rev: GAACCTGGACAGGTCATGGAG Fwd: GGACTCCACACACATGATGC Rev: AACCTGGACAGGTCATGGAG Fwd: CCAGGTAGCCAAGGATGTGT Rev: GACCCTGAAGCTCAGGACAG Fwd: GGAAGGCCCTCACCTACTTC Rev: CGGGTTCACATGAGGGTTAT Fwd: GCTTTGGCAAAACCTCAGAT Rev: ACCAGCCTTCCTCATCTCCT Fwd: ACAGGACCCTATGTGCTTGG Rev: ATCAGCAAATTCCCCAACAG Fwd: ATGACAGACGACCTCCCTTG Rev: GGCATGAACCCTTTGTAGAAG Fwd: GGGAGGAACAAATGATGGAA Rev: CCATGGGCTACAGAAAAGGA Fwd: GTACAAGTCCCGTTCCGAGAC Rev: CACTCTGGCACCACTTTCAAG Fwd: ACCGCCGAATAATTCACTTG Rev: CACAAACACAGGCCACAACC Fwd: CATTGTGACCATGCCAGATG Rev: GTAGGCCTCTGCTTCCTGTTC Fwd: CTCCTCACAGCCCGTTAGTC Rev: CGCCTCTTGTCATTCTCCTC Fwd: CCGAGAATTCATGGAGCAAT Rev: GATTGTGTGTGGGCCTTCTT Fwd: GCTGAGAATGTGGCTGTTGA Rev: TCACTGATGAAAGCCTGCAC Fwd: CTCAACGAGAACAAGCTATC Rev: CCAATCTGCCGACTTAGCG Fwd: GCGAGTGATGAACAGCAAAA Rev: CTTTCCTCTTCCCTCCTTGG Fwd: CGATGCCAATGCATAAAAAC Rev: CTTTTCCTTGGGGTTTAGGC Nuclear Nuclear 10 ng total DNA per reaction The differences in the MitDNA-Ct versus the NuDNA-Ct (DMit–NuDNA-Ct) were calculated for each condition and for each MitDNA– NuDNA pair: 12S ⁄ TFAM, cytochrome b ⁄ ATP-synthase-b and CR ⁄ RRS1 The fold variations of the MitDNA levels versus NuDNA levels following treatments were determined using the equation 2DMit–NuDNA-Ct treated ) DMit–NuDNA-Ct control, where control cells represent NaCl-treated cells Three to four independent experiments were performed ATP quantification BAEC were plated in 12-well plates for 12 h prior to being subjected to the various treatments for an additional 36 h After washing with sterile NaCl ⁄ Pi, the cells were lysed in 125 lL sterile NaCl ⁄ Pi buffer containing 1% Triton X-100, mm EDTA and mm dithiotreitol Levels of ATP were determined using the ATP-dependent enzyme luciferase and its luminescent luciferin substrate (ATP determination kit, Molecular Probes) Reactions were performed accordingly FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS 2761 Lithium increases mitochondrial biogenesis I T Struewing et al to the recommendations of the manufacturer in duplicate for both cell extracts (10 lL) and ATP standards Luminescence intensity was recorded using a LMAX-II luminometer (Molecular Devices, Sunnyvale, CA, USA) The amounts of protein in the cell extracts were measured in duplicate by spectrometry using the BCA reagents (BioRad, Hercules, CA) Levels of ATP in luminescent intensity per lg of proteins were calculated for each treatment and the data obtained in 6–8 independent experiments are expressed in fold increase of ATP levels with the control NaCl-treated cells equal to Student’s t-test and one-way anova were performed using graphpad prism v 4.0 (GraphPad Software, San Diego, CA) Results were considered significant at P < 0.05 Acknowledgements We thank I Dominguez for the kind gift of wt- and K85R-GSK3b constructs This work was supported by NIH grant HL68698 to CDM References Determination of the mitochondrial transmembrane potential BAEC were plated in 24-well plates for 12 h prior to being subjected to the various treatments for 36 h After washing with NaCl ⁄ Pi containing mm Ca2+ ⁄ Mg2+, the cells were incubated for 45 with 500 nm of Mitotracker CMXRos in NaCl ⁄ Pi with Ca2+ ⁄ Mg2+ After three washes in NaCl ⁄ Pi with Ca2+ ⁄ Mg2+, the fluorescence intensities associated with active mitochondria were measured at kexc550 ⁄ kem590 using a FusionTM plate reader (Perkin–Elmer, Waltham, MA) Cell number was determined using CyQuant staining accordingly to the manufacturer’s instructions (Molecular Probe) and measurement of the fluorescence intensity at kexc485 ⁄ kem535 The mitochondria membrane potential per cell was calculated as the ratio of the CMXRos fluorescent intensity versus the CyQuant fluorescent intensity and the results obtained in eight independent experiments performed in triplicate are presented as the relative MTP levels with the control NaCltreated cells being equal to Determination of intracellular hydrogen peroxide production BAEC were plated in 24-well plates for 12 h prior to being treated with 10 mm NaCl as control, 10 mm LiCl or mm VPA for 36 h After washing with NaCl ⁄ Pi containing mm Ca2+ ⁄ Mg2+, cells were incubated for 30 with 2.5 lm CM-H2DCFDA (Molecular Probes) in the dark After three washes in NaCl ⁄ Pi with Ca2+ ⁄ Mg2+, the fluorescence intensities were measured at kexc485 ⁄ kem535 as described above, the results were normalized for variation in cell numbers using CyQuant staining and quantification, thought in this case separate wells were used The results obtained from five independent experiments performed in triplicate are presented as the relative levels of hydrogen peroxide production with the control NaCl-treated cells being equal to Statistical analysis After verification of the normal distribution of the values obtained in at least three independent experiments, 2762 Pilcher HR (2003) The ups and downs of lithium Nature 425, 118–120 Hedgepeth C, Conrad LJ, Zhang J, Huang HC, Lee VM & Klein PS (1997) Activation of the Wnt signaling pathway: a molecular mechanism for lithium action Dev Biol 185, 82–91 Klein PS & Melton DA (1996) A molecular mechanism for the effect of lithium on development Proc Natl Acad Sci USA 93, 8455–8459 Belmaker RH, Livne A, Agam G, Moscovich DG, Grisaru N, Schreiber G, Avissar S, Danon A & Kofman O (1990) Role of inositol-1-phosphatase inhibition in the mechanism of action of lithium Pharmacol Toxicol 66, 76–83 Harwood AJ (2005) Lithium and bipolar mood disorder: the inositol-depletion hypothesis revisited Mol Psychiat 10, 117–126 Wada A, Yokoo H, Yanagita T & Kobayashi H (2005) Lithium: potential therapeutics against acute brain injuries and chronic neurodegenerative diseases J Pharmacol Sci 99, 307–321 Sarkar S, Floto RA, Berger Z, Imarisio S, Cordenier A, Pasco M, Cook LJ & Rubinsztein DC (2005) Lithium induces autophagy by inhibiting inositol monophosphatase J Cell Biol 170, 1101–1111 Kaga S, Zhan L, Altaf E & Maulik N (2006) Glycogen synthase kinase-3beta ⁄ beta-catenin promotes angiogenic and anti-apoptotic signaling through the induction of VEGF, Bcl-2 and survivin expression in rat ischemic preconditioned myocardium J Mol Cell Cardiol 40, 138–147 Tong H, Imahashi K, Steenbergen C & Murphy E (2002) Phosphorylation of glycogen synthase kinase-3beta during preconditioning through a phosphatidylinositol-3-kinase – dependent pathway is cardioprotective Circ Res 90, 377–379 10 Masuda CA, Xavier MA, Mattos KA, Galina A & Montero-Lomeli M (2001) Phosphoglucomutase is an in vivo lithium target in yeast J Biol Chem 276, 37794–37801 11 Schambony A, Kunz M & Gradl D (2004) Cross-regulation of Wnt signaling and cell adhesion Differentiation 72, 307–318 FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS I T Struewing et al 12 Williams RS & Harwood AJ (2000) Lithium therapy and signal transduction Trends Pharmacol Sci 21, 61–64 13 Mao CD, Hoang P & DiCorleto PE (2001) Lithium inhibits cell cycle progression and induces stabilization of p53 in bovine aortic endothelial cells J Biol Chem 276, 26180–26188 14 Rossig L, Badorff C, Holzmann Y, Zeiher AM & Dimmeler S (2002) Glycogen synthase kinase-3 couples AKT-dependent signaling to the regulation of p21Cip1 degradation J Biol Chem 277, 9684–9689 15 Cheng CW, Smith SK & Charnock-Jones DS (2003) Wnt-1 signaling inhibits human umbilical vein endothelial cell proliferation and alters cell morphology Exp Cell Res 291, 415–425 16 Stump RJ, Lovicu FJ, Ang SL, Pandey SK & McAvoy JW (2006) Lithium stabilizes the polarized lens epithelial phenotype and inhibits proliferation, migration, and epithelial mesenchymal transition J Pathol 210, 249– 257 17 Penso J & Beitner R (2003) Lithium detaches hexokinase from mitochondria and inhibits proliferation of B16 melanoma Mol Genet Met 78, 74–78 18 Smits VA, Essers MA, Loomans DS, Klompmaker R, Rijksen G & Medema RH (1999) Inhibition of cell proliferation by lithium is associated with interference in cdc2 activation FEBS Lett 457, 23–27 19 Hoshi M, Sato M, Kondo S, Takashima A, Noguchi K, Takahashi M, Ishiguro K & Imahori K (1995) Different localization of tau protein kinase I ⁄ glycogen synthase kinase-3 beta from glycogen synthase kinase-3 alpha in cerebellum mitochondria J Biochem (Tokyo) 118, 683–685 20 Bijur GN & Jope RS (2003) Glycogen synthase kinase-3 beta is highly activated in nuclei and mitochondria Neuroreport 14, 2415–2419 21 Watcharasit P, Bijur GN, Song L, Zhu J, Chen X & Jope RS (2003) Glycogen synthase kinase-3b (GSK3b) binds to and promotes the actions of p53 J Biol Chem 278, 48872–48879 22 Pastorino JG, Hoek JB & Shulga N (2005) Activation of glycogen synthase kinase 3beta disrupts the binding of hexokinase II to mitochondria by phosphorylating voltage-dependent anion channel and potentiates chemotherapy-induced cytotoxicity Cancer Res 65, 10545–10554 23 Matoba S, Kang J-G, Patino WD, Wragg A, Boehm M, Gavrilova O, Hurley PJ, Bunz F & Hwang PM (2006) p53 regulates mitochondrial respiration Science 312, 1650–1653 24 Garesse R & Vallejo CG (2001) Animal mitochondrial biogenesis and function: a regulatory cross-talk between two genomes Gene 263, 1–16 25 Kelly DP & Scarpulla RC (2004) Transcriptional regulatory circuits controlling mitochondrial biogenesis and function Genes Dev 18, 357–368 Lithium increases mitochondrial biogenesis 26 Puigserver P & Spiegelman BM (2003) Peroxisome proliferator-activated receptor-c coactivator 1a (PGC-1a) Trans Coactivator Metabolic Regul Endocrin Res 24, 78–90 27 Suliman HB, Carraway MS, Welty-Wolf KE, Whorton AR & Piantadosi CA (2003) Lipopolysaccharide stimulates mitochondrial biogenesis via activation of nuclear respiratory factor-1 J Biol Chem 278, 41510–41518 28 Kwong JQ, Beal MF & Manfredi G (2006) The role of mitochondria in inherited neurodegenerative diseases J Neurochem 97, 1659–1675 29 Sun X, Wang J-F, Tseng M & Young LT (2006) Downregulation in components of the mitochondrial electron transport chain in the post mortem frontal cortex of subjects with bipolar disorder J Psychiat Neurosci 31, 189–196 30 Cui L, Jeong H, Borovecki F, Parkhurst CN, Tanese N & Krainc D (2006) Transcriptional repression of PGC1alpha by mutant huntingtin leads to mitochondrial dysfunction and neurodegeneration Cell 127, 59–69 31 McLeod CJ, Jeyabalan AP, Minners JO, Clevenger R, Hoyt RFJ & Sack MN (2004) Delayed ischemic preconditioning activates nuclear-encoded electron-transferchain gene expression in parallel with enhanced postanoxic mitochondrial respiratory recovery Circulation 110, 534–539 32 Gidday JM (2006) Cerebral preconditioning and ischaemic tolerance Nat Rev Neurosci 7, 437–448 33 Williams RSB, Cheng L, Mudge AW & Harwood AJ (2002) A common mechanism of action for three moodstabilizing drugs Nature 417, 292–295 34 Fonseca CP, Jones JG, Carvalho RA, Jeffrey FM, Montezinho LP, Geraldes CF & Castro MM (2005) Tricarboxylic acid cycle inhibition by Li+ in the human neuroblastoma SH-SY5Y cell line: a 13C NMR isotopomer analysis Neurochem Int 47, 385–393 35 Poot M, Zhang YZ, Kramer JA, Wells KS, Jones LJ, Hanzel DK, Lugade AG, Singer VL & Haugland RP (1996) Analysis of mitochondrial morphology and function with novel fixable fluorescent stains J Histochem Cytochem 44, 1363–1372 36 Nisoli E, Falcone S, Tonello C, Cozzi V, Palomba L, Fiorani M, Pisconti A, Brunelli S, Cardile A, Francolini M et al (2004) Mitochondrial biogenesis by NO yields functionally active mitochondria in mammals Proc Natl Acad Sci USA 101, 16507–16512 37 He TC, Sparks AB, Rago C, Hermeking H, Zawel L, da Costa LT, Morin PJ, Vogelstein B & Kinzler KW (1998) Identification of c-MYC as a target of the APC pathway Science 281, 1509–1512 38 Li F, Wang Y, Zeller KI, Potter JJ, Wonsey DR, O’Donnell KA, Kim JW, Yustein JT, Lee LA & Dang CV (2005) Myc stimulates nuclearly encoded mitochondrial genes and mitochondrial biogenesis Mol Cell Biol 25, 6225–6234 FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS 2763 Lithium increases mitochondrial biogenesis I T Struewing et al 39 Chen G, Huang LD, Jiang YM & Manji HK (1999) The mood-stabilizing agent valproate inhibits the activity of glycogen synthase kinase-3 J Neurochem 72, 1327–1330 40 Phiel CJ, Zhang F, Huang EY, Guenther MG, Lazar MA & Klein PS (2001) Histone deacetylase is a direct target of valproic acid, a potent anticonvulsant, mood stabilizer, and teratogen J Biol Chem 276, 36734–36741 41 Nemeth ZH, Deitch EA, Fekete CSZ, Hauser CJ & Hasko G (2002) Lithium induces NF-jB activation and interleukin-8 production in human intestinal epithelial cells J Biol Chem 277, 7713–7719 42 Vyas DR, Spangenburg EE, Abraha TW, Childs TE & Booth FW (2002) GSK-3beta negatively regulates skeletal myotube hypertrophy Am J Physiol Cell Physiol 283, C545–C551 43 Haq S, Choukroun G, Kang ZB, Ranu H, Matsui T, Rosenzweig A, Molkentin JD, Alessandrini A, Woodgett J, Hajjar R et al (2000) Glycogen synthase kinase-3beta is a negative regulator of cardiomyocyte hypertrophy J Cell Biol 151, 117–130 44 Zhang F, Phiel CJ, Spece L, Gurvich N & Klein PS (2003) Inhibitory phosphorylation of glycogen synthase kinase-3 (GSK-3) in response to lithium Evidence for autoregulation of GSK-3 J Biol Chem 278, 33067–33077 45 Biggs WHR, Meisenhelder J, Hunter T, Cavenee WK & Arden KC (1999) Protein kinase B ⁄ Akt-mediated phosphorylation promotes nuclear exclusion of the winged helix transcription factor FKHR1 Proc Natl Acad Sci USA 96, 7421–7426 46 Southgate RJ, Bruce CR, Carey AL, Steinberg GR, Walder K, Monks R, Watt MJ, Hawley JA, Birnbaum MJ & Febbriao MA (2005) PGC-1a gene expression is down-regulated by Akt-mediated phosphorylation and nuclear exclusion of FoxO1 in insulin-stimulated skeletal muscle FASEB J 19, 2072–2074 47 Zhang P, Liu C, Zhang C, Zhang Y, Shen P, Zhang J & Zhang CY (2005) Free fatty acids increase PGC1alpha expression in isolated rat islets FEBS Lett 579, 1446–1452 48 Ozaki N & Chuang DM (1997) Lithium increases transcription factor binding to AP-1 and cyclic AMPresponsive element in cultured neurons and rat brain J Neurochem 69, 2336–2344 49 Karbowski M & Youle RJ (2003) Dynamics of mitochondrial morphology in healthy cells and during apoptosis Cell Death Differ 10, 870–880 50 Bhattacharyya B & Wolff J (1976) Stabilization of microtubules by lithium ion Biochem Biophys Res Commun 73, 383–390 51 Krylova O, Messenger MJ & Salinas PC (2000) Dishevelled-1 regulates microtubule stability: a new function 2764 52 53 54 55 56 57 58 59 60 61 62 mediated by glycogen synthase kinase-3beta J Cell Biol 151, 83–94 Karbowski M, Spodnik JH, Teranishi M, Wozniak M, Nishizawa Y, Usukura J & Wakabayashi T (2001) Opposite effects of microtubule-stabilizing and microtubule-destabilizing drugs on biogenesis of mitochondria in mammalian cells J Cell Sci 114, 281–291 Martinez-Diez M, Santamaria G, Ortega AD & Cuezva JM (2006) Biogenesis and dynamics of mitochondria during the cell cycle: significance of 3¢-UTRs Public Library of Science One 1, e107–118 Duguez S, Feasson L, Denis C & Freyssenet D (2002) Mitochondrial biogenesis during skeletal muscle regeneration Am J Physiol Endocrin Metab 282, E802–E809 van der Velden JL, Langen RC, Kelders MC, Wouters EF, Janssen-Heininger YM & Schols AM (2006) Inhibition of glycogen synthase kinase-3beta activity is sufficient to stimulate myogenic differentiation Am J Physiol Cell Physiol 290, C453–C462 Polesskaya A, Seale P & Rudnicki MA (2003) Wnt signaling induces the myogenic specification of resident CD45+ adult stem cells during muscle regeneration Cell 113, 841–852 Kang S, Bajnok L, Longo KA, Petersen RK, Hansen JB, Kristiansen K & MacDougald OA (2005) Effects of Wnt signaling on brown adipocyte differentiation and metabolism mediated by PGC-1alpha Mol Cell Biol 25, 1272–1282 Hutter E, Renner K, Pfister G, Stockl P, Jansen-Durr P & Gnaiger E (2004) Senescence-associated changes in respiration and oxidative phosphorylation in primary human fibroblasts Biochem J 380, 919–928 Kevelaitis E, Oubenaissa A, Peynet J, Mouas C & Menasche P (1999) Preconditioning by mitochondrial ATP-sensitive potassium channel openers: an effective approach for improving the preservation of heart transplants Circulation 100, 345–350 Wisloff U, Najjar SM, Ellingsen O, Haram PM, Swoap S, Al-Share Q, Fernstrom M, Rezaei K, Lee SJ, Koch LG et al (2005) Cardiovascular risk factors emerge after artificial selection for low aerobic capacity Science 307, 418–420 Das S, Cordis GA, Maulik N & Das DK (2005) Pharmacological preconditioning with resveratrol: role of CREB-dependent Bcl-2 signaling via adenosine A3 receptor activation Am J Physiol Heart Circ Physiol 288, H328–H335 Mabuchi T, Kitagawa K, Kuwabara K, Takasawa K, Ohtsuki T, Xia Z, Storm D, Yanagihara T, Hori M & Matsumoto M (2001) Phosphorylation of cAMP response element-binding protein in hippocampal neurons as a protective response after exposure to FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS I T Struewing et al glutamate in vitro and ischemia in vivo J Neurosci 21, 9204–9213 63 St-Pierre J, Drori S, Uldry M, Silvaggi JM, Rhee J, Jager S, Handschin C, Zheng K, Lin J, Yang W et al (2006) Suppression of reactive oxygen species and neurodegeneration by the PGC-1 transcriptional coactivators Cell 127, 397–408 Lithium increases mitochondrial biogenesis 64 Dominguez I, Itoh K & Sokol SY (1995) Role of glycogen synthase kinase beta as a negative regulator of dorsoventral axis formation in Xenopus embryos Proc Natl Acad Sci USA 92, 8498–8502 FEBS Journal 274 (2007) 2749–2765 ª 2007 The Authors Journal compilation ª 2007 FEBS 2765 ... conditions, changes in mitochondrial biogenesis and mass within cells and tissues reflect changes in energy demand and hormonal status, and depend mainly on changes in the activity and ⁄ or expression. .. signaling [33] In primary endothelial cells, lithium treatment triggered an increase in mitochondrial mass and ATP production without changing mitochondrial efficiency This increase in mitochondrial. .. GSK3b indicate that the lithium- induced increase of mitochondrial biogenesis is independent of GSK3b inhibition Lithium increases cell size in the absence of Akt activation Of the various inhibitors