Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference Supattra Treerattrakool 1 , Sakol Panyim 1,2 , Siu-Ming Chan 3 , Boonsirm Withyachumnarnkul 4,5 and Apinunt Udomkit 1 1 Institute of Molecular Biology and Genetics, Mahidol University, Nakhon Pathom, Thailand 2 Department of Biochemistry, Mahidol University, Bangkok, Thailand 3 School of Biological Sciences, The University of Hong Kong, China 4 Department of Anatomy, Mahidol University, Bangkok, Thailand 5 Centex Shrimp, Mahidol University, Bangkok, Thailand Female reproduction in crustaceans is controlled by an elaborate endocrine system. The prominent cellular activity that occurs during ovarian development is known as vitellogenesis, which is the process whereby vitellogenin (Vg), a yolk protein precursor, is accumu- lated in the developing oocyte [1]. Vitellogenesis is an essential step in ovarian maturation. Vg can be synthe- sized in the ovary and ⁄ or other nonovarian sites such as the hepatopancreas [2–5]. Vg synthesis and ovarian maturation are regulated by an eyestalk endocrine factor referred to as vitellogenesis-inhibiting hormone (VIH) or gonad-inhibiting hormone (GIH) [6,7]. Gonad-inhibiting hormone is a member of the neu- ropeptide family that is synthesized in neuroendocrine cells located in the eyestalk medulla terminalis gangli- onic X-organ. Once produced, these neuropeptides are transported to the axon terminals that form a neuro- haemal organ called the sinus gland, from where they are secreted [8]. This hormone family is known as the CHH family. Mature peptides of CHH family Keywords black tiger shrimp; ovarian maturation; reproduction; RNA interference; vitellogenesis Correspondence A. Udomkit, Institute of Molecular Biology and Genetics, Mahidol University, Salaya Campus, Nakhon Pathom 73170, Thailand Fax: +66 2 441 9906 Tel: +66 2 800 3624, ext. 1236 E-mail: staud@mahidol.ac.th (Received 16 November 2007, revised 18 December 2007, accepted 25 December 2007) doi:10.1111/j.1742-4658.2008.06266.x One of the important peptide hormones that control reproduction in crus- taceans is gonad-inhibiting hormone (GIH). GIH is known to modulate gonad maturation by inhibiting synthesis of vitellogenin (Vg), the precursor of yolk proteins. In this study, a cDNA encoding a GIH (Pem-GIH) from the eyestalk of Penaeus monodon was cloned using RT-PCR and RACE techniques. Pem-GIH cDNA is 861 bp in size with a single ORF of 288 bp. The deduced Pem-GIH consists of a 17-residue signal peptide and a mature peptide region of 79 amino acids with features typical of type II peptide hormones from the CHH family. Pem-GIH transcript was detected in eye- stalk, brain, thoracic and abdominal nerve cords of adult P. monodon. The gonad-inhibiting activity of Pem-GIH was investigated using the RNA interference technique. Double-stranded RNA, corresponding to the mature Pem-GIH sequence, can trigger a decrease in Pem-GIH transcript levels both in eyestalk ganglia and abdominal nerve cord explant culture and in female P. monodon broodstock. The conspicuous increase in Vg transcript level in the ovary of GIH-knockdown shrimp suggests a negative influence for Pem-GIH on Vg gene expression, and thus implies its role as a gonad-inhibiting hormone. This is the first report to demonstrate the use of double-stranded RNA to elucidate the function of GIH in P. monodon. Abbreviations CHH, crustacean hyperglycemic hormone; GIH, gonad-inhibiting hormone; MIH, molt-inhibiting hormone; RT, reverse transcription; Vg, vitellogenin; VIH, vitellogenesis-inhibiting hormone. 970 FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS members generally have 78–83 amino acid residues with a molecular mass of  8–9 kDa. These hormones contain six cysteine residues that are aligned in con- served positions [9,10]. The CHH family can be divided into two types, type I and type II, as reflected by their primary structure [11–13]. The most abundant hormone in this family, crustacean hyperglycemic hor- mone (CHH), belongs to type I, whereas the other two hormones, molt-inhibiting hormone (MIH) and GIH, are categorized in type II. CHH or type I contains in its precursor sequence a short peptide called CHH-pre- cursor-related peptide followed by a dibasic residue- processing site. By contrast, type II hormones are preceded directly by the signal peptides. In addition, alignment of the amino acid sequence reveals deletion of the amino acid glycine at the fifth position after the first cysteine residue in type I peptides. Compared with CHH and MIH, only a limited number of GIH have been characterized to date. The first peptide with in vivo GIH activity was isolated from the American lobster Homarus americanus [14]. Another peptide that has been shown to depress Vg mRNA expression in the ovary fragment is the Pej- SGP-III of Marsupenaeus japonicus [15]. Likewise, a similar approach was used to assay VIH activity in the crayfish Procambarus bouvieri [16]. MIH-B from the shrimp Metapenaeus ensis, although capable of extend- ing the molting cycle, may be considered as another candidate for GIH because the mRNA levels of this peptide decrease sharply during the early phase of gonad maturation and increase continuously as the vitellogenic stages proceed [17]. The cDNA encoding GIH-like peptide is also found in a few other species such as the Norway lobster Nephrops norvegicus [18] and the prawn Macrobrachium rosenbergii [19]. How- ever, whether the peptides encoded by these cDNAs function as GIH needs further verification. In this study, a cDNA encoding GIH from Penaeus monodon and its potential role in vitellogenesis were studied. Functional knockdown of Pem-GIH by double-stranded (ds)RNA was applied to demonstrate the negative effect on Vg expression in the ovary of previtellogenic adult female and thus provides evidence for its role as a GIH. Results Cloning and characterization of Pem-GIH cDNA A partial 3¢ cDNA sequence encoding GIH from P. monodon (Pem-GIH) was amplified by several sets of degenerate primers (Fig. 1) designed from the con- served amino acid sequences of type II hormones in the CHH family. Nucleotide sequence analysis revealed that 7 of 213 recombinant clones harbored GIH-like nucleotide sequences, as judged by a unique feature of the amino acid sequences at the C-terminus, which are longer than and different from that of MIHs. To obtain the 5¢ region of this cDNA, a set of specific primers was designed from the 3¢ sequence of the cDNA as described in the Experimental procedures. In addition, full-length cDNA was amplified with specific primers, as shown in Fig. 1. The nucleotide sequences of the full-length Pem-GIH cDNA of eight individual recombinant clones were sequenced, and confirmed as representing identical clones. Fig. 2 shows the nucleo- tide sequence of Pem-GIH cDNA (GenBank accession no. DQ643389) and its deduced amino acid sequence. 10 0 b p PR T PM 1 PM1 IH 3 5′RACE-GIH1.1 ma tGIH F/ T7-mat GI HF GI HR ma tG IH R/ T7 -m at GI HR 10 0 b p 5′ 3′ PR T PM 1 3′RACE-GIH1A 3 ′RACE-GIH1 B PRT PM1 5 ′RACE-GIH1 5 ′RACE-GIH2 5 ′RACE-GIH 3 GIHF ma tGIH F/ T7-mat GI HF GI HR ma tG IH R/ T7 -m at GI HR Fig. 1. Schematic diagram showing the structure of Pem-GIH cDNA and locations of the primers used in this study. The 5¢- and 3¢-UTRs are shown as a thin line. The ORF is depicted by boxes: the unfilled box represents the signal peptide and the filled box represents the mature peptide. S. Treerattrakool et al. P. monodon GIH cDNA and its role in Vg expression FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS 971 The full-length cDNA encoding the putative GIH of P. monodon was composed of 861 nucleotides containing a 5¢-UTR (93 bp), an ORF (288 bp), a stop codon (TGA) and a 3¢-UTR (477 bp) with a potential polyadenylation signal AATAAA located 7 bp upstream of the poly(A) tail. The ORF of Pem-GIH codes for a protein of 96 amino acid residues. The sig- nal peptide, predicted using the signalp 3.0 server (http://www.cbs.dtu.dk/services/SignalP), consisted of 17 amino acids, whereas the remaining 79 amino acids comprised the mature Pem-GIH peptide. The deduced amino acid sequence of putative Pem-GIH showed the conservation of six cysteine residues in the mature pep- tide with a glycine residue at the fifth position after the first cysteine. Mature Pem-GIH showed 68% amino acid identity with the GIH of M. ensis, but 45 and 48% amino acid identity with that of H. americ- anus (Hoa-GIH) and N. norvegicus (Nen-GIH), respec- tively (Fig. 3). Tissue-specific expression of Pem-GIH Pem-GIH expression in several P. monodon tissues was examined by RT-PCR using a pair of primers specific for Pem-GIH cDNA. GIH transcripts at the expected size of 385 bp were detected in the eyestalk ganglia, brain, thoracic nerve cord and abdominal nerve cord of individual shrimp. No GIH transcript was found in other tissues examined. This expression profile is simi- lar to that of Mee-GIH expression in mature female M. ensis [17]. Interestingly, expression of Pem-GIH in these tissues was found in both male and female of adult and adolescent P. monodon (Fig. 4). dsRNA-induced Pem-GIH knockdown in shrimp explant culture The role of Pem-GIH was investigated by dsRNA- mediated gene silencing via RNAi, using dsRNA spe- cific to the Pem-GIH . The coding sequence for mature Pem-GIH was used as template in the synthesis of GIH-specific dsRNA. The efficacy of this GIH- dsRNA to knockdown GIH expression was first deter- mined in GIH-expressing tissues. Briefly, eyestalk XOSG neurons and abdominal nerve cord explant were cultured in a medium that contained GIH- dsRNA. RT-PCR results showed barely detectable levels of GIH transcript in the GIH-dsRNA-treated eyestalk XOSG culture from adult female shrimp after 3 h (Fig. 5A) indicating that GIH expression could be efficiently inhibited by GIH-dsRNA. Similar results were also seen when abdominal nerve cord from either adult or adolescent female shrimp was incubated with GIH-dsRNA for 3 and 6 h (Fig. 5B,C). By contrast, the irrelevant dsRNA, GFP-dsRNA, failed to knock- down Pem-GIH mRNA expression as the abdominal nerve cord incubated with GFP-dsRNA expressed similar levels of Pem-GIH transcript to that of the control sample into which no dsRNA was added. These results indicated that GIH-dsRNA was capable of triggering sequence-specific knockdown of Pem- GIH expression in shrimp explant culture, and thus Fig. 2. Nucleotide and deduced amino acid sequences of Pem-GIH. The amino acids are presented as one-letter symbols and shown below their codons in each line. The highlighted amino acid sequence represents the putative mature peptide region. An asterisk marks the stop codon. The putative polyadenylation site is underlined. The num- bers on the left and right of the sequences show the coordinate of nucleotides and amino acids in corresponding lines. P. monodon GIH cDNA and its role in Vg expression S. Treerattrakool et al. 972 FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS was a potent tool for functional study of Pem-GIH in the shrimp. Biological assay for vitellogenesis-inhibiting activity of Pem-GIH by dsRNA-mediated functional knockdown To test whether the knockdown of Pem-GIH expres- sion by dsRNA would interfere with Vg gene expres- sion, previtellogenic adult female P. monodon were injected with GIH-dsRNA and the level of Pem-GIH expression as well as the expression of Vg transcript in the shrimp was determined by RT-PCR. In order to determine the silencing effect of GIH- dsRNA in the shrimp, eyestalk ganglia were collected from previtellogenic adult P. monodon on day 3, 5 and 7 subsequent to GIH-dsRNA injection. The results (Fig. 6A) show that 3 days after dsRNA injection, Actin Pem-GIH bp 500 400 A Adult B Adolescent Male D Actin Pem-GIH 500 400 M E S B T G N c H Hp M - v e M E S B T G N c H Hp M - v e M E S B T G N c H Hp M - v e M E S B T G N c H Hp M - v e F e m a l e C Fig. 4. Expression of Pem-GIH in different tissues of P. monodon. RT-PCR products were amplified from the total RNA of eyestalk (ES), brain (B), thoracic nerve (TG), abdominal nerve cord (Nc), heart (H), hepatopancreas (Hp) and muscle (M) using the specific primers for the 5¢-region of Pem-GIH. The negative PCR is indicated by ) ve. The actin transcript of P. monodon was used as an internal control of the amount of RNA template. Each panel shows tissue distribution of Pem-GIH in adult female (A), adult male (B), adolescent female (C) and adolescent male (D). The identity of RT-PCR products was confirmed by DNA sequencing. Fig. 3. Alignment of Pem-GIH with GIH and MIH from other species of crustacean. The deduced amino acid sequence of GIH from P. monodon (Pem-GIH; this study) is aligned with GIHs of M. ensis (Mee-GIH; AF294648), H. americanus (Hoa-GIH; X87192), N. norvegicus (Nen-GIH; AF163771) and MIHs of P. monodon (Pem-MIH1; AAR89516 and Pem-MIH2; AAR89517), M. japonicus (Pej-sgp-IV; BAA20432), M. ensis (Mee-MIH; AAC27452), L. vannamei (Liv-MIH1; AAR04348) and F. chinensis (Fec-MIH; AAL55258). Sequence identities are high- lighted in black color, and light gray depicts the conservative changes. The percent identity of the pro- and mature sequences between Pem-GIH and other hormones was shown on the right to the C-terminus of the sequences. S. Treerattrakool et al. P. monodon GIH cDNA and its role in Vg expression FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS 973 shrimp administered with GIH-dsRNA showed drasti- cally reduced Pem-GIH transcript levels in the eyestalk ganglia when compared with control shrimp injected with Tris ⁄ NaCl only. This comprehensive silencing lasted until day 5 before the expression of Pem-GIH began to recover to some extent on day 7. Moreover, expression of two other related genes, Pem-CHH1 and Pem-MIH1 of P. monodon, did not change in GIH- knockdown shrimp when compared with control shrimp (Fig. 6B), suggesting the specificity of Pem- GIH silencing by GIH-dsRNA. Subsequently, the consequence of the depletion in GIH transcript on Vg synthesis was investigated on day 5 after GIH-dsRNA injection. Fig. 7 shows that the Vg transcription level was increased more than ninefold in the ovary of GIH-knockdown previtellogenic adult shrimp when 3 h dsGIH –ve Pem-GIH Actin A – + Pem-GIH Actin C 0 h dsGIH 3 h – + + Shrim p #2 dsGFP dsGIH 6 h – + + dsGFP dsGIH 3 h – + + dsGFP dsGIH 6 h – + + dsGFP –ve Shrim p #1 0 h –ve Pem-GIH Actin B 3 h dsGIH dsGFP 3 h dsGIH dsGFP – + + – + + Fig. 5. Expression of Pem-GIH in shrimp explant culture after incubating with GIH-dsRNA. The eyestalk ganglia and abdominal nerve cord were dissected from live shrimp and incubated in modified M199 culture medium with or without the specified dsRNA. The Pem-GIH and actin transcripts were detected by RT-PCR at the indicated time points. (A) Expression of Pem-GIH in the eyestalk ganglia of adult female shrimp at 3 h after incubating without ()) or with (+) GIH-dsRNA. (B) Expression of Pem-GIH in the abdominal nerve cord of adult female shrimp at 3 and 6 h after incubating without ()) or with (+) GIH-dsRNA or GFP-dsRNA as indicated. (C) Expression of Pem-GIH in the abdom- inal nerve cord of two adolescent female shrimp at 3 and 6 h after incubating without ()) or with (+) GIH-dsRNA or GFP-dsRNA as indicated. )ve in (A–C) depicts the negative PCR. B dsGIH M Pem-GIH Actin 700 500 bp B M dsGIH Pem-CHH1 Actin 500 bp B M dsGIH Pem-MIH1 Actin 800 500 bp Pem-GIH Actin 800 bp 500 bp 1 2 3 4 5 1 2 3 4 5 6 M Buffer GIH-dsRNA Day 3 Pem-GIH Actin 800 bp 500 bp 1 2 3 4 5 1 2 3 4 5 6 Day 5 800 bp 500 bp Day 7 Pem-GIH Actin 1 2 3 4 5 1 2 3 A B Fig. 6. Time-course and specificity of Pem-GIH silencing by dsRNA in shrimp. (A) Previtellogenic adult female P. monodon were injected with Tris ⁄ NaCl or 3 lg GIH-dsRNA ⁄ g body weight of shrimp. Eyestalk ganglia were collected from both groups of shrimp at day 3, 5 and 7, and Pem-GIH transcripts were detected by RT-PCR. Numbers represent individual shrimp in each group. (B) Representative of agarose gel showing levels of Pem-GIH, Pem-CHH1 and Pem-MIH1 transcript in previtellogenic adult female shrimp detected by RT-PCR. The expression of Pem-GIH, Pem-CHH1 and Pem-MIH1 was examined in shrimp injected with Tris ⁄ NaCl (B) and GIH-dsRNA (dsGIH) on day 5 following GIH-dsRNA injection. For (A) and (B), actin transcript was amplified as internal control and M represent 100 bp ladder DNA marker. P. monodon GIH cDNA and its role in Vg expression S. Treerattrakool et al. 974 FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS compared with that in control shrimp. The increase in the ratio of Vg to actin transcripts in the GIH-depleted background suggested that functional knockdown of Pem-GIH led to the induced expression of Vg in the ovary. Discussion Because of the lack of information on the GIH in pen- aeid shrimp, the attempt to clone GIH cDNA from P. monodon in this study was carried out using a RACE approach with degenerate primers designed from the conserved amino acid sequences among MIH ⁄ GIH from other species of crustaceans. To increase the possibility of obtaining the GIH cDNA of P. monodon, codons preferably used for CHH (GenBank accession nos AF233295, AY346379 and AY346380) and MIH (GenBank accession nos AY496454 and AY496455) genes of this species were also taken into consideration for primer design. In addition, mRNA from eyestalk neurons of adult female P. monodon at different vitellogenic stages as deter- mined by gonadal somatic index were used as the tem- plate for cDNA cloning in this study. This is based on a previous study which showed high levels of GIH mRNA in the sinus gland during previtellogenesis and vitellogenesis [20]. A putative GIH cDNA of P. monodon (Pem-GIH) was successfully cloned using the aforementioned strategy. The deduced amino acid sequence of putative GIH from P. monodon possesses all the characteristics in agreement with a type II hormone from the CHH family [11–13]. Moreover, the C-terminus of Pem-GIH had an extension of two amino acid residues when compared with that of MIH. This is consistent with previously identified GIHs from other crustacean species (Fig. 3). Pem-GIH cDNA was thus subsequently examined for its gonad- inhibiting function by using a RNA interference (RNAi) technique. RNAi, a post-transcription gene-silencing process in which dsRNA triggers sequence-specific suppression of its cognate mRNA [21], is a powerful tool for studying gene function [22–24]. In P. monodon, a dsRNA- induced gene-silencing phenomenon has been recently demonstrated [25], therefore it was selected as a tool for studying the functional knockdown of Pem-GIH cDNA in this study. GIH-specific dsRNA was synthesized from a 240 bp coding region of the mature Pem-GIH. The use of long dsRNA provides the possibility of generating more varieties of effective siRNA (21–23 nucleotides) molecules. Nevertheless, the nonspecific silencing, known as off-target phenomenon, may also occur from these diverse siRNA products of the long dsRNA [26,27]. To minimize this off-target silencing, the GIH-dsRNA sequence was used to search for a pos- sible region of 21–23 consecutively identical nucleotides in the sequences of all P. monodon CHH and MIH.A nucleotide sequence comparison revealed no such region (data not shown) in either CHHsorMIHs, suggesting that the GIH-dsRNA should direct sequence-specific silencing of Pem-GIH with a minimal off-target effect on other related genes. Indeed, this was clearly showed by the result in Fig. 6B in which the shrimp adminis- tered with GIH-dsRNA still expressed CHH and MIH at the level comparable with that of the control shrimp. The efficacy of GIH-dsRNA to silence Pem-GIH expression was manifested by the dramatic depletion in Pem-GIH mRNA level in shrimp eyestalk ganglia and abdominal nerve cords as early as 3 h after incubating with GIH-dsRNA. This silencing was not affected by irrelevant dsRNA, thus indicating that Pem-GIH knockdown occurred in a sequence-specific fashion. Similar specific silencing of Pem-GIH by GIH-dsRNA was also demonstrated in adolescent female P. monodon (Fig. S1). Accordingly, any biological changes observed following GIH-dsRNA injection may be considered the consequence of Pem-GIH knockdown. To date, no conclusive evidence about the mode of action of GIH on vitellogenesis has been established. Recently, the recombinant vitellogeneis-inhibiting hormone (VIH or GIH) of H. americanus has been GIH/acti n Buffer GIH dsRNA GIH/actin 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 Vg/actin levelnoisserpxeevitaleR Vg/actin Fig. 7. Influence of GIH-dsRNA on Pem-GIH and Vg expression in previtellogenic adult female shrimp. Shrimp were injected with Tris ⁄ NaCl or GIH-dsRNA. Eyestalk ganglia and ovaries were col- lected at 5 days after injection to examine for Pem-GIH and Vg mRNA levels, respectively, by RT-PCR. The graph represents rela- tive expression levels of Pem-GIH compared with actin levels that were quantified using the SCION IMAGE program. Values are shown as mean ± SEM (n = 5). Relative amounts of Pem-GIH ⁄ actin tran- script in both the control (Tris ⁄ NaCl-injected) and GIH-dsRNA- injected shrimp are represented by gray bars (P < 0.01), whereas those of Vg ⁄ actin transcript in both groups of shrimp are shown by white bars (P < 0.05). S. Treerattrakool et al. P. monodon GIH cDNA and its role in Vg expression FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS 975 reported for its biological activity to inhibit Vg mRNA synthesis in the ovary of heterologous species, M. japo- nicus [28]. In addition to the ovary, hepatopancreas has been revealed as another site for Vg synthesis in shrimp [29,30]. Although the function of Vg originating from the hepatopancreas has not been clearly evidenced, it has been shown that Vg expression in the hepatopan- creas is correlated with ovarian maturation [31]. After synthesis in the hepatopancreas, Vg undergoes post- translational processing into smaller subunits by a sub- tilisin-like endoprotease, these subunits are then released into the hemolymph. These hemolymph Vg subunits are further processed by an unidentified enzyme before being sequestered by the ovary, and form yolk protein (vitellin) subunits [32]. The induced ovarian Vg expression of GIH-knockdown previtello- genic adult P. monodon evidently indicates the inhibi- tory function of Pem-GIH on Vg gene expression in the ovary. Our results are in concurrence with an increase in Vg expression after eyestalk ablation in M. japonicus [33,34] and L. vannamei [35]. In addition, the level of Vg expression in hepatopancreas was not appreciably affected following dsRNA-mediated knockdown of Pem-GIH (data not shown). This is not unanticipated because Vg synthesis was not induced in hepatopan- creas of eyestalk-ablated shrimp either, especially within the first 7 days following eyestalk ablation [33]. In addition, Okumura et al. showed that the Vg mRNA level increased slowly in hepatopancreas at the start of vitellogenesis in naturally mature female of M. japoni- cus, compared with that in the ovary [36]. Empirically, our results support the postulation that ovarian Vg is required for early maturation of the ovary in crusta- ceans [5] and conform well to the precocious ovarian development after the main source of GIH synthesis was removed by eyestalk extirpation [37]. Although a similar strategy was used to analyze the function of CHH cDNA from L. schmitti [38], the effect of CHH silencing on glucose level was deter- mined at 24 h after dsRNA injection. Our study clearly demonstrates that the effect of dsRNA silencing is effective for at least 5 days in shrimp, which pro- vides further benefit to the use of dsRNA for analysis of genes whose function has long-term physiological influence. Although the function of GIH has been studied mainly in female crustaceans, expression of Pem-GIH in male P. monodon, which is similar to previous reports [17,39], implies that GIH may play a more ver- satile role in the male as well. Eyestalk ablation in the crayfish Cherax quadricarinatus resulted in an overex- pression of androgenic gland polypeptides, which had a direct effect on male reproductive system [40]. Whether Pem-GIH is involved in reproduction in male P. monodon needs further investigation. In summary, this study identified and characterized Pem-GIH cDNA of P. monodon in both molecular and biological aspects. The system of a functional–knock- down study was exploited using GIH-specific dsRNA, and revealed, for the first time, the influence of Pem- GIH on vitellogenin transcript levels in the ovary, which directly linked GIH to expression of Vg mRNA. Finally, our results demonstrated that dsRNA-medi- ated gene silencing has a potential as a powerful tool for functional study of other genes in crustaceans. Experimental procedures Animals Wild adult female P. monodon, at different vitellogenic stages, were caught from the Gulf of Thailand, Chonburi Province, Thailand. They were used in cDNA cloning experiments. Previtellogenic adult female P. monodon used for the GIH functional assay were domesticated shrimp provided by Bangkok Aquaculture Farm Company (BAFCO, Huasai, Nakhon Si Thammarat Province, Thailand). Experiments involving animals were carried out in accor- dance with animal care and use protocol of the Mahidol University Animal Care and Use Committee (MUACUC). Total RNA preparation and first-strand cDNA synthesis Eyestalk neurons were dissected from individual eyestalks of adult female shrimp at various stages of reproductive cycle and homogenized in TRI-REAGENT Ò (Molecular Research Center, Cincinnati, OH, USA). Total RNA of eyestalks was extracted by using TRI-REAGENT Ò accord- ing to instructions of the manufacturer’s protocol. The reverse transcription (RT) step was performed with ImProm-IIÔ reverse transcriptase (Promega, Madison, WI, USA) according to the manufacturer’s protocol using 500 nm of oligo(dT)16 or PRT primer (5¢-CCGGAATTC AAGCTTCTAGAGGATCCTTTTTTTTTTTTTTTT-3¢)to prime cDNA synthesis at 42 °C for 60 min. RACE The degenerate primers used in 3¢-RACE of Pem-GIH cDNA were designed from the conserved amino acid sequences of MIH ⁄ GIH from several species of crustacean. In the first round of PCR, a 1 lL aliquot of cDNA was amplified with 3¢-RACE-GIH1A [5¢-TG(TC)(AC)CIGGIG TIATGGG(TC)AAC(AC)GIGA-3¢] and PM1 (5¢-CCGG AATTCAAGCTTCTAGAGGATCC-3¢) primers in 25 lL P. monodon GIH cDNA and its role in Vg expression S. Treerattrakool et al. 976 FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS of a reaction mixture containing 10 mm Tris ⁄ HCl pH 9.0, 50 mm KCl, 0.1% Triton X-100, 1.5 mm MgCl 2 , 200 nm of each primer, 200 lm each of dATP, dCTP, dGTP, dTTP and 1.25 units of Taq DNA Polymerase in storage buffer B (Promega). Amplification was performed in a DNA thermal cycler (GeneAmp System 2400; PE Applied Biosystems, Foster City, CA, USA) with 35 cycles of 94 °C for 30 s, 50 °C for 30 s and 74 °C for 1 min followed by 7 min incu- bation at 74 °C as a final extension. Subsequently, nested amplification was performed with 200 nm of 3¢-RACE- GIH1B [5¢-ATGGG(TC)AAC(AC)GIGA(TC)(ATC)TITA (TC)(GA)AIAA(AG)GT-3¢] and PM1 primers to obtain the specific product. For 5¢-RACE, first-strand cDNA synthesis was per- formed in a reaction as described above, except that 1 lm of 5¢-RACE-GIH1 primer (5¢-CCACGGCCGGCCGGC ATTGAG-3¢) was substituted for PRT primer. The reaction was carried out using two-step RT. The first RT step was incubated at 50 °C for 60 min. The RNA template was denatured again at 83 °C for 3 min and then immediately on ice for 5 min. For the second RT step, 1 lL of ImProm- IIÔ reverse transcriptase was added to the reaction. The reaction was incubated at 50 °C for 60 min and then termi- nated at 70 °C for 15 min. The RNA template was degraded with RNaseH before proceeding with cDNA purification by QIAquick PCR Purification Kit (Qiagen, Hilden, Germany). A 20 lL aliquot of purified cDNA was tailed with dATP in 30 lL of 100 mm cacodylate buffer (pH 6.8), 1 mm CoCl 2 , 0.1 mm dithiothreitol, 200 lm dATP and 20 units of terminal deoxynucleotidyl transferase (TdT) (Promega). The reaction was incubated at 37 °C for 20 min and TdT was heat-inactivated at 65 °C for 10 min. The first round PCR with 3 lL of the dA-tailed cDNA template was carried out as described for 3¢-RACE using 200 nm of 5¢-RACE-GIH2 (5¢-GGCCTCGCGCTTGGCCGAGTG-3¢) and PRT primers, except that annealing was performed at 55 °C for 30 s. Second-round PCR was performed with 200 nm of 5¢-RACE-GIH3 (5¢-TCGATTTCTGCACAAGC CATCCAGCTG-3¢) and PM1 primers to obtain specific amplified product. Amplification of full-length Pem-GIH cDNA Total RNA extracted from one pair of eyestalks from an adult female shrimp in stage IV of vitellogenesis, as described above, was used to synthesize a cDNA template for the cloning of full-length cDNA of Pem-GIH.A1lL aliquot of cDNA was amplified with GIHF (5¢-GAACGTC TCGTATAAAAGGTCTGCG-3¢) and GIHR (5¢-GGTCG ACTTTATTTTAACGGAAAATTAAT-3¢) primers in a 25 lL reaction containing 1· Phusion HF buffer including 1.5 mm MgCl 2 , 500 nm of each primer, 200 lm each of dATP, dCTP, dGTP, dTTP and 0.25 units of Phusion DNA Polymerase (Finnzymes, Espoo, Finland). Amplifica- tion was performed in a DNA thermal cycler (GeneAmp System 2400; PE Applied Biosystems) with 35 cycles of 98 °C for 10 s, 50 °C for 30 s and 72 °C for 1 min followed by 7 min incubation at 72 °C as a final extension. RT-PCR To detect tissue-specific expression of Pem-GIH, total RNA extracted from several P. monodon tissues, including eye- stalks, brain, thoracic nerve cord, abdominal nerve cord, heart, hepatopancreas, ovary and muscle, was used as a template for RT with PRT primer as described above. The specific transcript of Pem-GIH was amplified with GIHF and 5¢-RACE-GIH1 primers to detect Pem-GIH transcript level in all experiments. The reaction was amplified with 35 cycles of 94 °C for 30 s, 50 °C for 30 s and 74 °C for 1 min followed by 7 min incubation at 74 °C as a final extension. To detect Vg transcript in the ovary, Vg-F (5¢-CTAAGGCAATTATCACTGCTGCT-3¢) and Vg-R (5¢-AAGCTTGGCAATGTATTCCTTTT-3¢) primers desig- ned from the EST clone containing Vg sequence from P. monodon ovary (GenBank accession no. EE332453) were used in a reaction with 32 cycles of 94 °C for 30 s, 50 °C for 30 s and 74 °C for 1 min followed by 7 min incubation at 74°C. The actin transcript was amplified with PmActin-F (5¢-GACTCGTACGTCGGGCGACGAGG-3¢) and PmAc- tin-R (5¢-AGCAGCGGTGGTCATCACCTGCTC-3¢) primers in a reaction with 21 cycles of 94 °C for 30 s, 55 °C for 30 s and 74 °C for 1 min followed by further incubation at 74 °C for 7 min. The expected sizes of Pem-GIH, Vg and actin transcripts are 385, 354 and 539 bp, respectively. Preparation of GIH-dsRNA Production of GIH-dsRNA by in vitro transcription Two DNA templates for dsRNA of GIH that span the coding sequence of the mature Pem-GIH, each containing T7 promoter sequence at the 5¢-end on different strands were synthesized by PCR from full-length Pem-GIH cDNA. Two separate PCR reactions were set up, one with T7-containing forward primer (5¢-TAATACGACTCACTA TAGGGAGAAA CATC CTGG ACAGCA AATGC AGGG -3¢) and reverse primer (5¢-CCGGCATTGAGGATGCTGAT- 3¢) for the sense-strand template, the other with forward primer matGIHF (5¢-AACATCCTGGACAGCAAATGCA GGG-3¢) and T7-containing reverse primer (5¢-TAATACG ACTCACTATAGGGAGACCGGCA TTGAGGATG CTG AT-3¢) for the antisense-strand template. The reaction consisted of denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s and extension at 74 °C for 1 min for 9 cycles with a 1 ° C decrease in annealing temperature per cycle; the annealing temperature then remained at 48 °C for another 30 cycles and followed by a final extension at 74 °C for 7 min. The expected PCR product were excised and purified with a gel extraction kit S. Treerattrakool et al. P. monodon GIH cDNA and its role in Vg expression FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS 977 (Qiagen), as described in the manufacturer’s protocol. A mixture of 1 lg of each template was used in an in vitro transcription reaction with MEGAscriptÒRNAi Kit (Ambion, Austin, TX, USA) according to the manufac- turer’s protocol with some modifications. Briefly, sense- and antisense-strand templates were amplified in separate PCR as described above. The two templates were mixed in equal amounts and added to a single transcription reaction to syn- thesize dsRNA with T7 RNA polymerase at 37 °C for 6 h. To increase the duplex yield, the transcription reaction was incubated at 75 °C for 5 min, and allowed to cool to room temperature. The remaining DNA template and single- stranded RNA in solution were digested with DNaseI and RNaseA at 37 °C for 1 h. The proteins, free nucleotides and degraded nucleic acid residues were removed from double- stranded RNA by the filter cartridge as described in manu- facturer’s instructions. Finally, dsRNA was eluted with 100 lLof95°C pre-heated 10 mm Tris ⁄ HCl pH 7, and 1mm EDTA. Production of GIH-dsRNA by in vivo expression in Escherichia coli In order to obtain large quantity of dsRNA for the in vivo functional assay, GIH-dsRNA was produced as hairpin- RNA precursor in E. coli following a previously described method [25] with some modifications. A 340 bp DNA template for the sense strand of dsRNA connecting with a loop region was amplified with primers sense-GIHF1-XbaI (5¢-GCTCTAGAAACATCCTGGACAGCA-3¢) and sense- GIHR1-BamHI (5¢-CGGGATCCTAGCGCAGGGGGA GA-3¢). Another DNA template for the antisense strand of dsRNA, 240 bp, was amplified with primers as-GIHF-SalI (5¢-CGGTCGACAACATCCTGGACAGCA-3¢) and as- GIHR-BamHI (5¢-CGGGATCCTCACCACGGCCGG CCGGC-3¢). The antisense template was first cloned into pET17b vector at BamHI and XhoI sites, following by the sense template at XbaI and BamHI. The resulting recombi- nant plasmid was constructed and propagated in E. coli DH5a and its nucleotide sequence was verified by auto- mated DNA sequencing. The recombinant plasmid of hairpin-RNA of Pem-GIH was subsequently transformed into an RNaseIII-deficient E. coli HT115 strain. Expression of hairpin-RNA was induced with 0.4 mm isopropyl thio-b-d-galactoside for 2 h in 2· YT medium. Cells were harvested by centrifu- gation and resuspended in 500 lL NaCl ⁄ P i containing 0.1% SDS. The sample was boiled for 2 min and then snapped cool on ice. To eliminate endogenous RNA from bacterial cell and single-stranded RNA in the loop region of GIH hairpin-RNA, the cell lysate was treated with RNaseA at 37 °C for 30 min. dsRNA of Pem-GIH was extracted by using TRI-REAGENT Ò (Molecular Research Center) and resuspended in Tris ⁄ NaCl (10 mm Tris ⁄ HCl pH 7, 10 mm NaCl). The quantity of dsRNA was determined by the UV spec- trophotometry at an absorbancy of A 260 . dsRNA-mediated Pem-GIH knockdown in shrimp explant culture Eyestalk ganglia or abdominal nerve cords of P. monodon were dissected from individual shrimp. The eyestalk from a single shrimp was used in each experiment. The XOSG neuron from the left eyestalk was used as a negative control whereas that from the right eyestalk was treated with dsRNA as described below. Nerve cord from the same shrimp was cut into  0.8–1 cm pieces and used in one set of the experiment. The explant samples were incubated in a well of 24-well plate filled with 1.5 mL of modified M199 culture medium consisting of M199 powder in crab saline (440 mm NaCl, 11 mm KCl, 13.3 mm CaCl 2 ,26mm MgCl 2 ,26mm Na 2 SO 4 and 10 mm Hepes pH 7.2) supple- mented with 100 lgÆmL )1 penicillin–streptomycin anti- fungus and 40 lgÆmL )1 gentamicin sulfate. The samples were added to 3 lg of GIH-dsRNA and cultured with shaking at 20–24 °C for the appropriate length of time. Samples were then washed with modified M199 medium plus antibiotic before collected for RNA extraction. The level of Pem-GIH transcript was detected by RT-PCR with GIHF and 5¢-RACE-GIH1 primers as described earlier. Functional knockdown assay for Pem-GIH activity Previtellogenic adult female P. monodon at the intermolt and early premolt stages (C–D2) ( 85–120 g each) were cultured in tanks filled with artificial seawater ( 30 p.p.t. salinity). Shrimp were divided into two groups, each con- taining five shrimp. The control group was injected through the arthrodial membrane of the second walking leg with Tris ⁄ NaCl ( 3 lLÆg )1 body weight) and the experimental group was injected with GIH-dsRNA ( 3 lgÆlL )1 )at 3 lgÆg )1 body weight. The level of GIH and Vg transcripts in eyestalk ganglia and ovary, respectively were detected by RT-PCR 5 days after being administered with dsRNA. Statistical analysis Results are presented as mean ± SEM. Statistical signifi- cance between values was determined by Levene’s test of independent sample t-test from spss for Windows 11.5. Acknowledgements We acknowledge Hiu Kwan Tiu (School of Biological Sciences, The University of Hong Kong) for her kind advice on the shrimp explant culture technique. We thank Ms Junpim Wannarungsi at Bangkok Aquacul- ture Farm Company (BAFCO) for supplying adult P. monodon GIH cDNA and its role in Vg expression S. Treerattrakool et al. 978 FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS female P. monodon. This study was supported by The Royal Golden Jubilee PhD program to ST, the RD&E Funding from BIOTEC, Thailand and Mahidol Uni- versity research grant. SMC was supported by a grant (HKU#7482 ⁄ 05M) from the Research Grant Council of the Hong Kong SAR Government. References 1 Tsukimura B (2001) Crustacean vitellogenesis: its role in oocyte development. Am Zool 41, 465–476. 2 Tsutsui N, Kawazoe I, Ohira T, Jasmani S, Yang W-J, Wilder MN & Aida K (2000) Molecular characteriza- tion of a cDNA encoding vitellogenin and its expression in the hepatopancreas and ovary during vitellogenesis in the Kuruma prawn, Penaeus japonicus. Zool Sci 17, 651–660. 3 Avarre J-C, Michelis R, Tietz A & Lubzens E (2003) Relationship between vitellogenin and vitellin in a mar- ine shrimp (Penaeus semisulcatus) and molecular charac- terization of vitellogenin complementary DNAs. Biol Reprod 69, 355–364. 4 Tsang W-S, Quackenbush LS, Chow BKC, Tiu SHK, He JG & Chan S-M (2003) Organization of the shrimp vitellogenin gene: evidence of multiple genes and tissue specific expression by the ovary and hepatopancreas. Gene 303, 99–109. 5 Yang F, Xu HT, Dai ZM & Yang WJ (2005) Molecular characterization and expression analysis of vitellogenin in the marine crab Portunus trituberculatus. Comp Biochem Physiol B 142, 456–464. 6 Charmantier G, Charmantier-Daures M & Van Herp F (1997) Hormonal regulation of growth and reproduc- tion in crustaceans. In Endocrinology and Reproduction, Recent Advances in Marine Biotechnology, Vol. 1 (Fingerman M, Nagabhushanam R & Thompson M-F, eds), pp. 109–161. Science Publishers, Enfield, NH. 7 Huberman A (2000) Shrimp endocrinology. A review. Aquaculture 191, 191–208. 8 Skinner DM (1985) Molting and regeneration. In The Biology of Crustacea, Integuments, Pigments and Hormonal Processes , Vol. 9 (Bliss DE & Mantel LH eds), pp. 43–146. Academic Press, Orlando, FL. 9 Keller R (1992) Crustacean neuropeptides: structures, functions and comparative aspects. Experientia 48, 439– 448. 10 Ohira T, Katayama H, Tominaga S, Takasuka T, Nakatsuji T, Sonobe T, Aida K & Nagasawa H (2005) Cloning and characterization of a molt-inhibiting hormone-like peptide from the prawn Marsupenaeus japonicus. Peptide 26, 259–268. 11 Lacombe C, Greve P & Martin G (1999) Overview on the sub-grouping of the crustacean hyperglycemic hormone family. Neuropeptides 33, 71–80. 12 Chen SH, Lin CY & Kuo CM (2005) In silico analysis of crustacean hyperglycemic hormone family. Mar Biotechnol 7, 193–206. 13 Chan SM, Gu PL, Chu KH & Tobe SS (2003) Crusta- cean neuropeptide genes of the CHH ⁄ MIH ⁄ GIH family: implications from molecular studies. Gen Comp Endocrinol 134, 214–219. 14 Soyez D, Van Deijnen JE & Martin M (1987) Isolation and characterization of a vitellogenesis-inhibiting factor from the sinus gland of the lobster, Homarus americ- anus. J Exp Zool 244, 479–484. 15 Tsutsui N, Katayama H, Ohira T, Nagasawa H, Wilder MN & Aida K (2005) The effects of crustacean hyper- glycemic hormone-family peptides on vitellogenin gene expression in the kuruma prawn, Marsupenaeus japonicus . Gen Comp Endocrinol 144, 232–239. 16 Aguilar MB, Quackenbush LS, Hunt DT, Shabanowitz J & Huberman A (2002) Identification, purification and initial characterization of the vitellogenesis-inhibiting hormone from the Mexican crayfish Procambarus bouvieri (Ortmann). Comp Biochem Physiol B 102, 491–498. 17 Gu P-L, Tobe SS, Chow BKC, Chu KH, He J-G & Chan S-M (2002) Characterization of an additional molt inhibiting hormone-like neuropeptide from the shrimp Metapenaeus ensis. Peptide 23, 1875–1883. 18 Edomi P, Azzoni E, Mettulio R, Pandolfelli N, Ferrero EA & Giulianini PG (2002) Gonad-inhibiting hormone of the Norway lobster (Nephrops norvegicus): cDNA cloning, expression, recombinant protein production, and immunolocalization. Gene 284, 93–102. 19 Yang W-J & Rao KR (2001) Cloning of precursors for two MIH ⁄ VIH-related peptides in the prawn, Macrob- rachium rosenbergii. Biochem Biophys Res Commun 289, 407–413. 20 De Kleijn DPV, Janssen KPC, Waddy SL & Hegeman R (1998) Expression of the crustacean hyperglycemic hor- mones and the gonad-inhibiting hormone during the reproductive cycle of the female American lobster Homarus americanus. J Endrocrinol 156, 291–298. 21 Hannon GL (2002) RNA interference. Nature 418, 244–251. 22 Tsuzuki S, Sekiguchi S & Hayakawa Y (2005) Regula- tion of growth-blocking peptide expression during embryogenesis of the cabbage armyworm. Biochem Biophys Res Commun 335, 1078–1084. 23 Volz J, Osta MA, Kafatos FC & Muller HM (2005) The roles of two clip domain serine proteases in innate immune responses of the malaria vextor Anopheles gambiae. J Biol Chem 280, 40161–40168. 24 Martin D, Maestro O, Cruz J, Mane-Padros D & Belles X (2006) RNAi studies reveal a conserved role for RXR in molting in the cockroach Blattella germa- nica. J Insect Physiol 52, 410–416. S. Treerattrakool et al. P. monodon GIH cDNA and its role in Vg expression FEBS Journal 275 (2008) 970–980 ª 2008 The Authors Journal compilation ª 2008 FEBS 979 [...]... (2006) Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti: functional analysis by double-strnaded RNA interference technique FEBS J 273, 5669–5677 39 De Kleijn DPV, Coenen T, Laverdure AM, Tensen CP & Van Herp F (1992) Localization of messenger RNAs encoding crustacean hyperglycemic hormone and gonadinhibiting hormone in the X-organ sinus gland... & Kuo C-M (2001) Hepatopancreas is the extraovarian site of vitellogenin synthesis in black tiger shrimp, Penaeus monodon Comp Biochem Physiol A 129, 909–917 30 Phiriyangkul P & Utarabhand P (2006) Molecular characterization of a cDNA encoding vitellogenin in the banana shrimp, Penaeus (Litopenaeus) merguiensis and sites of vitellogenin mRNA expression Mol Reprod Dev 73, 410–423 31 Jayasankar V, Tsutsui...P monodon GIH cDNA and its role in Vg expression S Treerattrakool et al 25 Yodmuang S, Tirasophon W, Roshorm Y, Chinnirunvong W & Panyim S (2006) YHV-protease dsRNA inhibits YHV replication in Penaeus monodon and prevents mortality Biochem Biophys Res Commun 341, 351–356 26 Jackson AL & Linsley PS (2004) Noise amidst the silence: off-target effects of siRNAs? Trends Genet 20, 521–524 27 Quin S,... on vitellogenin synthesis in immature female kuruma prawn, Marsupenaeus japonicus Zoolog Sci 24, 233–240 35 Raviv S, Parnes S, Segall C, Davis C & Sagi A (2006) Complete sequence of Litopenaeus vannamei (Crustacea: Decapoda) vitellogenin cDNA and its expression in endocrinologically induced sub-adult females Gen Comp Endocrinol 145, 39–50 980 36 Okumura T, Yamano K & Sakiyama K (2007) Vitellogenin. .. Macrobrachium rosenbergii, and yolk processing during ovarian maturation J Exp Zool 292, 417–429 33 Okumura T, Kim YK, Kawazoe I, Yamano K, Tsutsui N & Aida K (2006) Expression of vitellogenin and cortical rod protein during induced ovarian development by eyestalk ablation in the kuruma prawn, Marsupenaeus japonicus Comp Biochem Physiol A 143, 246–253 34 Okumura T (2007) Effects of bilateral and unilateral eyestalk... 36 Okumura T, Yamano K & Sakiyama K (2007) Vitellogenin gene expression and hemolymph vitellogenin during vitellogenesis, final maturation, and oviposition in female kuruma prawn, Marsupenaeus japonicus Comp Biochem Physiol A 147, 1028–1037 37 Browdy CL & Samocha TM (1985) The effect of eyestalk ablation on spawning, molting and mating of Penaeus semisulcatus de Haan Aquaculture 49, 19–29 38 Lugo JM,... MN (2002) Dynamics of vitellogenin mRNA expression and changes in hemolymp vitellogenin levels during ovarian maturation in the giant freshwater prawn Macrobrachium rosenbergii J Exp Zool 293, 675–682 32 Okuno A, Yang WJ, Jayasankar V, Saido-Sakanaka H, Huong do TT, Jasmani S, Atmomarsono M, Subramoniam T, Tsutsui N, Ohira T et al (2002) Deduced primary structure of vitellogenin in the giant fresh... divided into three groups Control shrimp (buffer) were injected with Tris ⁄ NaCl, whereas shrimp in the experimental group (dsGIH) were injected with GIH-dsRNA at a concentration of 2 lg ⁄ 10 g shrimp The third group (dsGFP) was injected with GFP-dsRNA at the same concentration as GIH-dsRNA Eyestalk ganglia were collected from individual shrimp in each group at 72 h after injection for RNA extraction and. .. gland complex of the lobster Homarus americanus Neuroscience 51, 121–128 40 Khalaila I, Manor R, Weil S, Granot Y, Keller R & Sagi A (2002) The eyestalk–androgenic gland–testis endocrine axis in the crayfish Cherax quadricarinatus Gen Comp Endocrinol 127, 147–156 Supplementary material The following supplementary material is available online: Fig S1 Silencing of Pem-GIH in adolescent female P monodon Adolescent... siRNAs? Trends Genet 20, 521–524 27 Quin S, Ademal M & Lane T (2005) A computational study of off-target effects of RNA interference Nucleic Acids Res 33, 1834–1847 28 Ohira T, Okumura T, Suzuki M, Yajima Y, Tsutsui N, Wilder MN & Nagasawa H (2006) Production and characterization of recombinant vitellogenesis-inhibiting hormone from the American lobster, Homarus americanus Peptides 27, 1251–1258 29 Tseng . Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference Supattra. eye- stalk, brain, thoracic and abdominal nerve cords of adult P. monodon. The gonad-inhibiting activity of Pem-GIH was investigated using the RNA interference