K182G substitution in DevR or C 8 G mutation in the Dev box impairs protein–DNA interaction and abrogates DevR-mediated gene induction in Mycobacterium tuberculosis Rajesh Kumar Gupta, Santosh Chauhan* and Jaya Sivaswami Tyagi Department of Biotechnology, All India Institute of Medical Sciences, New Delhi, India Introduction Tuberculosis is the single most prevalent infectious dis- ease among humans and accounts for one-seventh of all deaths worldwide. The success of Mycobacte- rium tuberculosis as a pathogen is closely associated with its ability to persist in humans for extended peri- ods without causing disease. It is estimated that one- third of the global population harbours latent M. tuberculosis infection which can last for years and even decades without causing active disease [1,2]. This enormous reservoir of latent disease greatly compli- cates efforts aimed at tuberculosis control as it requires prolonged drug therapy presumably due to persistence Keywords DevR (or DosR); DNA–protein interaction; Mycobacterium tuberculosis Correspondence J. S. Tyagi, Department of Biotechnology, All India Institute of Medical Sciences, New Delhi-110029, India Fax: +91 11 2658 8663 Tel: +91 11 2658 8491 E-mail: jstyagi@aiims.ac.in *Present address Department of Cancer Biology, MD Anderson Cancer Center, Houston, Texas, USA (Received 16 November 2010, revised 15 April 2011, accepted 19 April 2011) doi:10.1111/j.1742-4658.2011.08130.x The DevR response regulator mediates adaptation of Mycobacterium tuber- culosis to various signals that are likely to be encountered within the host such as hypoxia, nitric oxide, carbon monoxide and ascorbic acid. DevR is proposed as a promising target for developing drugs against dormant bac- teria. It induces the expression of target genes by interacting with DNA motifs located in their promoter regions. An understanding of DNA–pro- tein interactions is expected to facilitate the development of inhibitors tar- geting DevR. Only three amino acids in DevR, namely Lys179, Lys182 and Asn183, directly contact nucleotide bases in the DNA motif. The present study was designed to decipher the contribution of Lys182 in DevR func- tion. M. tuberculosis fdxA (Rv2007c), a member of the DevR regulon, was selected for this analysis. Its transcriptional start point was mapped at )1 or )2 with respect to the putative translational start site suggesting that fdxA is expressed as a leaderless mRNA. DNase I footprinting led to the discovery of a secondary binding site and induction of the fdxA promoter is explained by the cooperative binding of DevR to two binding sites. Mutation of Lys182 lowers the DNA binding affinity of DevR and abro- gates induction of fdxA and other regulon genes. Mutational analyses also highlight the singular importance of Lys182–G 13 nucleotide interaction for DevR binding and regulon induction. Our findings demonstrate that impairment of Lys182-mediated interactions alone abolishes DevR function and provide valuable insights for designing molecules that interfere with DevR-mediated dormancy adaptation. Abbreviations EMSA, electromobility shift assay; GFP, green fluorescent protein; qRT-PCR, quantitative real time RT-PCR; TSP, transcription start point; WT, wild type. FEBS Journal 278 (2011) 2131–2139 ª 2011 The Authors Journal compilation ª 2011 FEBS 2131 of the dormant tubercle bacilli that are refractory to current treatment regimens [2,3]. Dormancy adaptation is characterized by the cessa- tion of active bacterial growth and the transition into a non-replicative persistent state. An understanding of the molecular basis of dormancy is a prerequisite for the identification of novel molecules in dormant organ- isms that can be targeted by new drugs. In vitro mod- els have provided valuable insights into the genetic programmes utilized by M. tuberculosis during dor- mancy adaptation [4]. Transcription represents the first and the most crucial step in gene regulation in prok- aryotes and in vitro exposure of M. tuberculosis to physiologically relevant stimuli such as hypoxia, NO, CO and ascorbic acid triggers a dormancy adaptive response that is initiated by the DevR transcriptional regulator [5–10]. DevR mediates the rapid upregulation of  48 M. tuberculosis genes that comprise the DevR regulon [5,11–13]. This regulator has been proposed as a key participant in the dormancy programme of M. tuberculosis and consequently it is potentially important as a target for novel drug development [14,15]. This hypothesis is supported by the demonstra- tion of blocking of the DevR pathway by a small inhibitor molecule that also prevented hypoxia-induced bacterial dormancy in vitro [16]. Therefore a fine understanding of the properties of DevR will undoubt- edly be invaluable for designing potent inhibitor molecules. The analysis of the crystal structure of the DevR C - terminal domain complex with a 20-bp oligonucleotide representing the consensus binding motif revealed that a DevR dimer interacts with each DNA motif. A con- served sequence, G 4 G 5 G 6 A 7 C 8 T 9 , present in each half palindrome is recognized by a subunit of the DevR dimeric protein. Only three amino acids per subunit, namely Lys179, Lys182 and Asn183, contact nucleo- tide bases in the binding motif [17]. To elucidate the functionality of DNA–DevR protein interactions, the present study was designed to decipher the contribu- tion of Lys182 (K182) to the DNA binding property of DevR. Lys182 is thought to participate in exclusive H-bonding interactions with the O 6 and N 7 atoms of G 13 (complementary to the conserved C 8 base on the sense strand) and the N 7 atom of A 12 (complementary to the conserved T 9 base on the sense strand [17]). The M. tuberculosis fdxA (Rv2007c) promoter was selected for this analysis as it is a member of the DevR regulon and harbours a solitary upstream DevR binding motif [5] containing the consensus C 8 and T 9 nucleotides that were predicted to interact specifically with Lys182 resi- due in DevR. fdxA encodes a putative ferredoxin pro- tein. Ferredoxins are small, acidic proteins containing iron–sulphur clusters which act as multifunctional elec- tron carriers in diverse redox systems. It has been sug- gested that M. tuberculosis FdxA protein may serve the tubercle bacteria as an electron carrier under hypoxia [18] or that it may play a role in maintaining DevS in its reduced functional state [19]. During the present study, we discovered the presence of a low- scoring DevR binding site in the fdxA promoter in addition to the previously predicted site. DevR binds cooperatively to the second site to induce fdxA pro- moter transcription. Through mutational analysis of protein and DNA (in a half-site of the primary binding motif), we highlight the singular importance of G 13 – Lys182 and partial importance of A 12 –Lys182 inter- action for DevR binding and function. Our results establish that abrogation of interactions mediated by a single amino acid, namely Lys182, with the primary binding site is alone sufficient to abolish specific DNA–protein interactions and downstream gene induction. Results Transcription start point mapping of fdxA In order to understand the relevance of DevR interac- tion to transcription, the transcription start point (TSP) was mapped by primer extension analysis using RNA isolated from aerobic and hypoxia-induced M. tuberculosis cultures. fdxA TSP was mapped at )1 or )2 with respect to the putative translational start site of FdxA under hypoxic conditions (Fig. 1). Based on previously described consensus sequences [20,21], SigA- and SigC-like promoter elements were mapped upstream of the TSP. fdxA promoter has a conserved architecture of two DevR binding sites located upstream of its TSP The fdxA gene is a member of the DevR regulon. The members of this regulon often have two or more DevR binding sites in their upstream regions [5,11–13,22]. In this context, the fdxA promoter is noteworthy because only a single upstream DevR binding site was pre- dicted for this gene [5]. However, DNase I footprinting analysis of the wild-type (WT) fdxA promoter region revealed the presence of two binding sites (Fig. 2A), the previously predicted site P [5] and a newly identi- fied adjacent site S that was proximal to the TSP and was not identified previously by in silico analysis. While both the binding sites were occupied at ‡ 0.5 lm concentration, binding to a single site was not Role of Lys182 in DevR function in M. tuberculosis R. K. Gupta et al. 2132 FEBS Journal 278 (2011) 2131–2139 ª 2011 The Authors Journal compilation ª 2011 FEBS observed at lower protein concentration (not shown). Four enhanced DNase I cleavage sites were detected within the DevR-bound region at an apparently periodic interval (indicated by arrowheads in Fig. 2A). The results of DNase I footprinting and TSP mapping indicate that DevR interacts cooperatively with the P and S sites and that the )35 promoter element partially overlaps with the secondary DevR binding site, S. DevR K182G mutant protein is defective for interaction with DNA The phosphorylation and DNA binding properties of purified WT and K182G mutant DevR proteins were compared. Both the proteins were phosphorylated with equivalent efficiency in vitro and therefore a phosphor- ylation defect in the mutant protein was ruled out (Fig. 3A). Electromobility shift assay (EMSA) analysis was performed with phosphorylated WT or K182G mutant DevR proteins and fdxA promoter DNA. WT DevR protein bound to fdxA promoter DNA over a narrow range (< 10-fold) of protein concentration; at 500 nm concentration > 90% saturation of DNA was observed with WT DevR protein while no binding was observed with mutant protein up to 1.0 lm concentra- tion (Fig. 3B, lanes 5 and 12, respectively). Partial binding of the mutant protein with fdxA promoter DNA was noted at higher protein concentration (up to 6.0 lm) suggesting that the overall conformation of the DNA binding domain was preserved relative to the WT protein. However, the mutant protein failed to Fig. 1. TSP mapping. The fdxA TSP (shown by arrow) was mapped using RNA isolated from aerobic (A) and hypoxic (H) cultures and fdxA tsp primer. DNA sequence of the fdxA promoter region (anti sense strand). The bent arrow (at T, T) indicates the fdxA TSP mapped in the present study. The primary, P, and secondary, S, DevR binding sites that were identified by DNase I footprinting (Fig. 2) are boxed. Putative )35 and )10 SigC and SigA promoter consensus elements are indicated below the relevant sequences. The first boxed GTG codon represents the translational initiation site annotated in TubercuList (http://tuberculist.epfl.ch). Additional putative translational initiation codons are boxed. AB Fig. 2. DNase I footprinting. (A) DNase I footprint of WT DevR protein (0.5 lM and 1.0 lM concentration) and fdxA promoter DNA containing WT ⁄ C 8 G ⁄ T 9 A mutant P box. DNA sequencing ladder of the same sequence is shown alongside the footprint. The footprints were analysed by the lane detection tool and lane profile graphs (red, no protein added; green, with 0.5 l M DevR; orange, with 1.0 lM DevR) were gener- ated using QUANTITYONE software (Bio-Rad). Arrowheads correspond to enhanced DNase I cleavage sites in the DevR binding region. The sequences of the WT and C 8 GorT 9 A mutant P boxes are shown above the corresponding footprints. (B) DNase I footprint of K182G DevR mutant protein and WT fdxA promoter DNA. R. K. Gupta et al. Role of Lys182 in DevR function in M. tuberculosis FEBS Journal 278 (2011) 2131–2139 ª 2011 The Authors Journal compilation ª 2011 FEBS 2133 bind to the P and S sites in the fdxA promoter (up to 6.0 lm protein concentration) in a DNase I footprint- ing assay. This property established that the K182G mutant protein was defective in sequence-specifc inter- action (Fig. 2B). M. tuberculosis expressing either K182G or K182A mutant DevR protein is defective in DevR regulon response The effect of K182 mutation on gene activation was assessed by quantitative real time RT-PCR (qRT- PCR) analysis of selected DevR regulon genes in iso- genic M. tuberculosis strains expressing WT or DevR K182G mutant protein. An induction defect was noted in the expression of Rv3134c, devR, fdxA and tgs1 genes in the mutant strain under hypoxia (Fig. 3C). A very feeble ( twofold) induction of hspX was observed in the mutant strain in contrast to > 80-fold induction in WT bacteria. However, hypoxic expres- sion of HspX protein was observed only in M. tubercu- losis cultures expressing WT DevR protein and not in those expressing mutant protein (not shown). The induction defect in DevR K182G-expressing M. tuber- culosis cultures is attributed to the decreased binding of mutant protein at target promoters. Moreover, because DevR expression is under positive autoregula- tion [11], inducing levels of the regulator are probably not attained in the mutant strain to overcome the binding defect of K182G DevR. The functional impor- tance of K182 residue in gene activation was confirmed in a second isogenic mutant strain that expresses DevR K182A version of mutant protein (Fig. 3C). Although not tested experimentally, a similar mechanism is a likely explanation for the expression defect in this mutant strain as well. C 8 base in the P box is crucial for DevR interaction and essential for fdxA promoter activation The experiments described above establish the impor- tance of K182 residue in the functionality of DevR. Because K182 residue in DevR was reported to contact G 13 and A 12 bases in the DNA motif (complementary to C 8 and T 9 bases, respectively, in the P box [17]), the relevance of this interaction was confirmed by analy- sing the binding of WT DevR protein with mutant fdxA promoter fragments harbouring these mutations in the P binding site. Comparative EMSA analysis of the interaction of DevR protein with the fdxA pro- moter containing either WT or mutated P box sequences revealed that the C 8 G mutant DNA was defective in binding. At 0.4 lm DevR concentration, binding to the C 8 G mutant box was observed to be substantially reduced and to the T 9 A mutant box reduced to a lesser extent (Fig. 4A). The double mutant (C 8 G+T 9 A) was also defective in binding as expected (not shown). The results of EMSA analysis were supported by DNase I footprinting analysis and the C 8 G mutation was observed to be more deleterious than the T 9 A mutation indicating that the C 8 nucleo- tide is important for interaction with Lys182 of DevR (Fig. 2A). A comparison of the footprints and their profiles shows that the C 8 mutation in the P box abol- ished the binding of DevR to both the P and S boxes at 0.5 lm protein concentration. From DNase I foot- printing and EMSA results, we infer that DevR binds cooperatively to two sites at the fdxA promoter and that C 8 base in the P box is crucial for interaction. The functional relevance of the mutations resulting in a binding defect was assessed by green fluorescent protein (GFP) reporter assay using M. tuberculosis Fig. 3. (A) Phosphorylation of WT and K182G mutant DevR pro- teins with DevS 201 P (phosphorylated cytoplasmic domain of DevS). Lane 1, DevSP; lane 2, DevSP and DevR K182G mutant protein; and lane 3, DevSP and WT DevR protein. The top panel represents the phosphorimage and the bottom panel the Coomas- sie stained gel. (B) EMSA with phosphorylated DevR (WT or K182G mutant) and fdxA WT promoter DNA. Left, lanes 1 to 9 contain 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 l M of WT DevR protein; lane 10 represents free DNA; lanes 11 and 12 contain 0.5 and 1.0 l M of K182G mutant DevR protein. (C) qRT-PCR analysis of DevR regulon gene expression. RNA was isolated from M. tuberculosis cultures expressing either WT DevR protein or DevR K182G or DevR K182A mutant protein and subjected to gene expression analysis. Mean ± SD fold induction under hypoxia from two to four indepen- dent cultures is shown. Role of Lys182 in DevR function in M. tuberculosis R. K. Gupta et al. 2134 FEBS Journal 278 (2011) 2131–2139 ª 2011 The Authors Journal compilation ª 2011 FEBS strains harbouring the WT and mutant fdxA promot- ers (C 8 G, T 9 A and C 8 G+T 9 A in the P box). Although both mutant promoter DNAs were partially defective in binding to DevR in vitro (Fig. 4A), the fdxA promoter carrying the C 8 G mutation was com- pletely defective in the hypoxic induction of promoter activity while the T 9 A mutation was partially defective ( 50%, Fig. 4B). As expected the doubly mutated promoter DNA was also completely defective in pro- moter activation. These results establish that a single mutation (C 8 G) in one-half of the P box results in a defect in DevR binding to DNA and abolishes DevR- regulated gene induction. Discussion Only three amino acid residues, namely Lys179, Lys182 and Asn183, that are located in the a9 helix of each DevR subunit, directly contact G 4 G 5 G 6 A 7 C 8 T 9 bases in each half-binding site of a DevR C –DNA com- plex [17]. We recently showed that natural substitution at position G 4 is tolerated while G 5 ,G 6 and C 8 nucleo- tides are well conserved in the interacting boxes of DevR-dependent promoters [12,13]. The conserved C 8 base does not interact directly with DevR; however, G 13 in the complementary DNA strand at this position hydrogen bonds with Lys182. Lys182 also hydrogen bonds with the A 12 base in the complementary strand. The precise contribution of individual amino acids in DevR to its function can be assessed by mutational studies. It is expected that this type of analysis will reveal the interaction(s) that are crucial for DevR function and thereby guide the rational development of inhibitors to DevR, a target that is believed to play a key role in the hypoxia-induced bacterial dormancy programme. In the present study, the role of Lys182 was analysed because it exclusively interacts with only two bases in each half-site of DNA, namely G 13 and A 12 , the former being complementary to the highly conserved C 8 nucleotide. Furthermore, in silico analysis shows that the binding pocket in the crystal structure that interacts with a DevR inhibitor contains Lys182 [16]. The importance of Lys182 residue in DevR func- tion was assessed in vitro and in vivo using DevR K182G or K182A mutant protein and fdxA promoter harbouring mutations in C 8 or ⁄ and T 9 base in the pri- mary DevR binding site, P. The expression of the DevR regulon genes was severely compromised by mutation of this amino acid in DevR. The partial binding defect with the fdxA promoter carrying a C 8 mutant P box was associated with a complete loss in promoter activity and further established the essential role of K182 in DevR function. In contrast, a partial binding defect with the T 9 mutant P box was associ- ated with  50% promoter activity. The functional importance of C 8 nucleotide for DevR interaction is reflected in the positional conservation of C 8 but not the T 9 nucleotide in binding motifs [5,12,13]. The mutant proteins analysed in the present study contain glycine or alanine in place of K182 in the WT protein wherein the side chain amino group of K182 residue in each subunit is involved in H-bonding with O 6 and N 7 atoms of G 13 and with the N 7 atom of A 12 in the DNA strand. In silico analysis of WT versus K182 mutant DevR protein reveals the loss of three K182- mediated H bonds in the mutant protein which is apparently sufficient to destabilize the remaining inter- actions and results in the reduced affinity of mutant DevR protein for specific DNA sequences that was observed in the present study. DNase I footprinting analysis of the fdxA promoter reveals some important binding properties of DevR. A Bound Free 1 2 3 4 5 1 2 3 4 51 2 3 4 5 0 0.2 0.4 0.8 1.0 0 0.2 0.4 0.8 1.0 0 0.2 0.4 0.8 1.0 WT P Box C 8 G P Box T 9 A P Box DevR~P (µ M ) A B Fig. 4. (A) EMSA analysis using WT DevR protein and fdxA WT ⁄ C 8 G ⁄ T 9 A promoter DNA. A representative result from three experiments is shown. (B) GFP fluorescence of M. tuberculosis cul- tures expressing WT DevR protein and harbouring either WT or mutant fdxA promoter in GFP reporter vector. GFP fluorescence was assessed in standing cultures in 96-well format and expressed as relative fluorescence units divided by A (mean ± SD of two inde- pendent experiments, each in triplicate wells). R. K. Gupta et al. Role of Lys182 in DevR function in M. tuberculosis FEBS Journal 278 (2011) 2131–2139 ª 2011 The Authors Journal compilation ª 2011 FEBS 2135 new DevR binding site (designated as S) was identified downstream and adjacent to the previously assigned P site. Mutational analysis established that protein bind- ing to the S site is dependent on its binding to the P site. In this regard the fdxA promoter displays an architectural similarity to tgs1 and some other DevR regulon promoters [12,13]. The presence of prominent DNase I cleavage sites in the protected region suggests that bound DevR may induce localized DNA bend- ing ⁄ distortion and thereby facilitate cooperative pro- tein–protein interaction at the fdxA promoter. Our observations are consistent with the bending of DNA observed in DevR C –DNA crystals [17]. Note that we have analysed DevR binding to a natural target pro- moter containing a strong and a weak binding site each while the crystal structure was elucidated using consensus DNA oligonucleotides. Many DevR regulon promoters contain a combination of strong and weak binding sites [12,13]. Taking into consideration the results of DNase I footprinting analysis and in vivo assays, it appears that DNA bending ⁄ distortion is cru- cial for recruiting DevR cooperatively to weak binding sites and for target promoter induction. Keeping in mind the overlap of a DevR binding site with the )35 promoter element at target promoters, it is possible that DevR-induced changes in DNA conformation may also facilitate interactions between bound DevR molecules and RNA polymerase. TSP mapping reveals the presence of a hypoxia- inducible transcriptional start site at )1or)2 position with respect to the putative translational start site of fdxA (as annotated in TubercuList, http://tubercu- list.epfl.ch) which suggests that the fdxA transcript is a leaderless mRNA. There are numerous examples of leaderless mRNA in eubacteria and archaea [23]. A leaderless fdx mRNA encoding ferredoxin was reported in Halobacterium salinarium where the TSP mapped at )1 position in relation to the translational start site [24]. It has been suggested that leaderless mRNAs may be preferentially translated under adverse conditions like carbon source downshift, stationary phase etc. [25]. It is not known whether translational control of leaderless mRNAs in M. tuber- culosis is similar to that in Escherichia coli; however, based on the assumption that similar mechanism(s) are employed, it is possible that the leaderless fdxA mRNA is efficiently translated in M. tuberculosis under conditions of hypoxic stress. Additional in-frame GTG codons were detected downstream of the +1 GTG initiation codon and, although no SD- like sequences were detectable, we cannot exclude the possibility that any one of them is utilized in the initi- ation of translation of FdxA. In conclusion, the results of mutational analysis of protein and DNA establish the singular importance of G 13 –Lys182 H-bonding in DevR–DNA interaction and for downstream gene induction events. It is hoped that these insights will advance the rational development of specific inhibitors of DevR. Materials and methods Bacterial strains and growth conditions All M. tuberculosis strains were revived from )80 °C bacte- rial stocks and grown in Dubos medium containing 0.1% Tween-80 and 10% (v ⁄ v) albumin dextrose complex (DTA medium). All cultures were grown at 37 °C in a shaker incubator (190–220 r.p.m. using an Innova Shaker 4230) unless mentioned otherwise. Plasmids used in this study are shown in Table 1. Overexpression and purification of recombinant DevR K182G mutant protein Lysine to glycine or alanine mutation at position 182 of DevR was introduced by site-directed mutagenesis in plas- mid pSC1 which expresses WT DevR protein in pGEX4T1 vector using mutagenic primers (Table 2) and Pfu Turbo DNA polymerase (Stratagene, La Jolla, CA, USA). The amplified product was digested with DpnI enzyme and then transformed into E. coli XL-1 Blue. The generation of the site-specific mutation was confirmed by DNA sequencing. WT and K182G mutant DevR proteins were purified from E. coli as described previously [11]. Generation of G 13 ,A 12 and double (G 13 +A 12 ) mutant DNA boxes in fdxA promoter Mutant M. tuberculosis fdxA promoter GFP reporter con- structs bearing G 13 or A 12 or G 13 +A 12 mutations in the P box were generated by site-directed mutagenesis in plas- mid pSG1 (Table 2). All mutations were confirmed by DNA sequencing. EMSA EMSAs were performed as described previously [11]. Briefly, 32 P-labelled fdxA promoter DNA (WT and mutant) fragments were generated by PCR from M. tuberculosis H37Rv DNA using oligonucleotide primers fdxA f and fdxA r (Table 2). DevR protein (WT or K182G mutant) was purified as described previously [11] and phosphory- lated DevR was prepared using acetyl phosphate as described previously [11]. Varying concentrations of phos- phorylated WT or K182G mutant DevR protein were incu- bated with 2 ng of the labelled fdxA promoter DNA (WT Role of Lys182 in DevR function in M. tuberculosis R. K. Gupta et al. 2136 FEBS Journal 278 (2011) 2131–2139 ª 2011 The Authors Journal compilation ª 2011 FEBS or mutant) on ice for 30 min. DNA–protein complexes were separated by non-denaturing PAGE and the DNA– protein complexes were visualized by phosphorimaging. The fraction of bound DNA was estimated using quantity one software (Bio-Rad, Hercules, CA, USA). DNase I footprinting of fdxA promoter DNase I footprinting assays were performed with phos- phorylated WT DevR protein and fdxA promoter DNA variants (WT and mutant) or K182G mutant DevR protein and WT fdxA promoter DNA as described earlier [11]. TSP mapping RNA was isolated from M. tuberculosis H37Rv cultures grown in DTA medium under aerobic shaking and standing Table 2. Primers used in the study. Underlined bases indicate the introduced mutations. Primer name Sequence 5¢fi3¢ fdxA tsp CCAGTAGATCGCCT fdxA f TGACGGGCTATCGTAAGTTTATG fdxA r CACGCACTCACTACCGATCACA K182G f GAAAAGACGGTG GGGAACTACGTGTCG K182G r CGACACGTAGTT CCCCACCGTCTTTTC K182A f GAAAAGACGGTG GCGAACTACGTGTCG K182A r CGACACGTAGTT CGCCACCGTCTTTTC fdxA-C8G f TGACGAATAAGGC GTTTGGTCCTTTCC fdxA-C8G r GGAAAGGACCAAA CGCCTTATTCGTCA fdxA-A9T f TGACGAATAAGGCC ATTGGTCCTTTCC fdxA-A9T r GGAAAGGACCAA TGGCCTTATTCGTCA fdxA-C8G-A9T f TGACGAATAAGGC GATTGGTCCTTTCC fdxA-C8G-A9T r GGAAAGGACCAA TCGCCTTATTCGTCA Table 1. Plasmids used in the study. Plasmid Feature(s) Reference ⁄ source pSC-DevR pGEX4T1 overexpressing WT DevR with a glutathione S-transferase N-terminal tag [11] pRG-K182G DevR pSC-DevR encoding DevR containing lysine to glycine mutation at amino acid residue182 This study pSM P Operon devR pJFR19 integrative vector containing WT devR sequences expressed from its native operon promoter S. D. Majumdar, PhD thesis submitted to AIIMS, 2010 pRG P Operon K182G devR pSM P operon devR encoding DevR containing lysine to glycine mutation at amino acid residue182 This study pRG P Operon K182A devR pSM P operon devR encoding DevR containing lysine to alanine mutation at amino acid residue182 This study pFPV27 E. coli Mycobacterial shuttle plasmid with promoterless gfp;Km r [27] pSG1 pFPV27 containing WT fdxA promoter ()191 to +30) cloned upstream of gfp S. Ghosh, M Biotech dissertation, AIIMS, 2008 pRG1 pSG1 containing C 8 G mutation in P box of fdxA promoter This study pRG2 pSG1 containing T 9 A mutation in P box of fdxA promoter This study pRG3 pSG1 containing C 8 G+T 9 A mutation in P box of fdxA promoter This study Table 3. Strains used in the study. Strain Feature(s) Reference ⁄ source M. tuberculosis Mut2 M. tuberculosis H37Rv strain with a 447-bp BalI deletion in devR coding region [28] M. tuberculosis Comp13 Plasmid pSM P Operon devR electroporated in M. tuberculosis Mut2 (expressing WT DevR) S. D. Majumdar, PhD thesis submitted to AIIMS, 2010 M. tuberculosis DevR Mut K182G pRG Operon K182G devR electroporated in M. tuberculosis Mut2 This study M. tuberculosis DevR Mut K182A pRG Operon K182A devR electroporated in M. tuberculosis Mut2 This study M. tuberculosis GFP empty vector Plasmid pFPV27 electroporated in M. tuberculosis H37Rv strain This study M. tuberculosis fdxA Plasmid pSG1 electroporated in M. tuberculosis H37Rv This study M. tuberculosis Mut fdxA G13 Plasmid pRG1 electroporated in M. tuberculosis H37Rv This study M. tuberculosis Mut fdxA A12 Plasmid pRG2 electroporated in M. tuberculosis H37Rv This study M. tuberculosis Mut fdxA G13 + A12 Plasmid pRG3 electroporated in M. tuberculosis H37Rv This study R. K. Gupta et al. Role of Lys182 in DevR function in M. tuberculosis FEBS Journal 278 (2011) 2131–2139 ª 2011 The Authors Journal compilation ª 2011 FEBS 2137 conditions (48 h) as described previously [11]. TSPs were mapped using 32 P-labelled fdxA tsp primer (Table 2) and 30 lg of RNA from aerobic and standing cultures (twice using two separate lots of RNA). The reactions were run alongside the sequence ladder generated using the same pri- mer and M. tuberculosis H37Rv DNA. The gel was dried and visualized by phosphorimager (Bio-Rad) as described previously [11]. GFP reporter assay M. tuberculosis H37Rv harbouring pSG1, pRG1, pRG2, pRG3 reporter plasmids carrying WT and mutant fdxA pro- moter sequences (Table 3) were grown in DTA medium to mid-logarithmic phase (D 595  0.4) under shaking condi- tions. The cultures were diluted to D 595  0.025 and dispensed in 200-lL aliquots per well in 96-well plates. The plates were incubated for up to 5 days and GFP fluorescence was measured as described previously [11]. GFP fluorescence due to promoter activity was calculated by subtracting back- ground fluorescence of the promoter-less vector and is expressed as relative fluorescence units divided by D. Construction of M. tuberculosis strains expressing DevR K182G or DevR K182A and their RNA analysis Plasmid pSM P Operon devR containing WT devR sequences (Table 1) was used as template to generate K182G or K182A mutation in DevR using K182G f and K182G r or K182A f and K182A r primers (Table 2). Plasmids expressing mutant DevR proteins were electroporated into a devR deletion mutant to generate mutant M. tuberculosis strains in H37Rv background (Table 3). M. tuberculosis strains were cultured in DTA medium under aerobic (0 day) and hypoxic (5 days standing) conditions as described earlier [26]. RNA was isolated (two separate lots) from the strains expressing WT or mutant DevR proteins and analysed by qRT-PCR for the expression of selected DevR regulon genes. Acknowledgements J. S. T. is grateful to the Department of Biotechnology (DBT), Government of India, for research funding and for a Tata Innovation Fellowship. R. K. G. is grateful to DBT for a PDF and IYBA fellowship and to DST for project funding under the Fast Track scheme. References 1 Corbett EL, Watt CJ, Walker N, Maher D, Williams BG, Raviglione MC & Dye C (2003) The growing burden of tuberculosis: global trends and interactions with the HIV epidemic. Arch Intern Med 163, 1009–1021. 2 Parrish NM, Dick JD & Bishai WR (1998) Mechanisms of latency in Mycobacterium tuberculosis. Trends Micro- biol 6, 107–112. 3 Sacchettini JC, Rubin EJ & Freundlich JS (2008) Drugs versus bugs: in pursuit of the persistent predator Myco- bacterium tuberculosis. Nat Rev Microbiol 6, 41–52. 4 Shiloh MU & DiGiuseppe Champion PA (2010) To catch a killer. What can mycobacterial models teach us about Mycobacterium tuberculosis pathogenesis? Curr Opin Microbiol 13, 86–92. 5 Park HD, Guinn KM, Harrell MI, Liao R, Voskuil MI, Tompa M, Schoolnik GK & Sherman DR (2003) Rv3133c ⁄ dosR is a transcription factor that mediates the hypoxic response of Mycobacterium tuberculosis. Mol Microbiol 48, 833–843. 6 Voskuil MI, Schnappinger D, Visconti KC, Harrell MI, Dolganov GM, Sherman DR & Schoolnik GK (2003) Inhibition of respiration by nitric oxide induces a Mycobacterium tuberculosis dormancy program. J Exp Med 198, 705–713. 7 Ohno H, Zhu G, Mohan VP, Chu D, Kohno S, Jacobs WR Jr & Chan J (2003) The effects of reactive nitrogen intermediates on gene expression in Mycobacterium tuberculosis. Cell Microbiol 5, 637–648. 8 Shiloh MU, Manzanillo P & Cox JS (2008) Mycobacte- rium tuberculosis senses host-derived carbon monoxide during macrophage infection. Cell Host Microbe 3, 323–330. 9 Kumar A, Deshane JS, Crossman DK, Bolisetty S, Yan BS, Kramnik I, Agarwal A & Steyn AJ (2008) Heme oxygenase-1-derived carbon monoxide induces the Mycobacterium tuberculosis dormancy regulon. J Biol Chem 283, 18032–18039. 10 Taneja NK, Dhingra S, Mittal A, Naresh M & Tyagi JS (2010) Mycobacterium tuberculosis transcriptional adaptation, growth arrest and dormancy phenotype development is triggered by vitamin C. PLoS ONE 5, e10860. 11 Chauhan S & Tyagi JS (2008) Cooperative binding of phosphorylated DevR to upstream sites is necessary and sufficient for activation of the Rv3134c-devRS operon in Mycobacterium tuberculosis: implication in the induction of DevR target genes. J Bacteriol 190, 4301–4312. 12 Chauhan S & Tyagi JS (2008) Interaction of DevR with multiple binding sites synergistically activates divergent transcription of narK2-Rv1738 genes in Mycobacterium tuberculosis. J Bacteriol 190, 5394–5403. 13 Chauhan S & Tyagi JS (2009) Powerful induction of divergent tgs1-Rv3131 genes in Mycobacterium tuber- culosis is mediated by DevR interaction with a high- affinity site and an adjacent cryptic low-affinity site. J Bacteriol 191, 6075–6081. 14 Saini DK & Tyagi JS (2005) High-throughput microplate phosphorylation assays based on Role of Lys182 in DevR function in M. tuberculosis R. K. Gupta et al. 2138 FEBS Journal 278 (2011) 2131–2139 ª 2011 The Authors Journal compilation ª 2011 FEBS DevR-DevS ⁄ Rv2027c 2-component signal transduction pathway to screen for novel antitubercular compounds. J Biomol Screen 10, 215–224. 15 Murphy DJ & Brown JR (2007) Identification of gene targets against dormant phase Mycobacterium tuberculo- sis infections. BMC Infect Dis 7, 84. 16 Gupta RK, Thakur TS, Desiraju GR & Tyagi JS (2009) Structure-based design of DevR inhibitor active against nonreplicating Mycobacterium tuberculosis. J Med Chem 52, 6324–6334. 17 Wisedchaisri G, Wu M, Rice AE, Roberts DM, Sherman DR & Hol WG (2005) Structures of Mycobacterium tuberculosis DosR and DosR-DNA complex involved in gene activation during adaptation to hypoxic latency. J Mol Biol 354, 630–641. 18 Ricagno S, de Rosa M, Aliverti A, Zanetti G & Bolognesi M (2007) The crystal structure of FdxA, a 7Fe ferredoxin from Mycobacterium smegmatis. Biochem Biophysic Res Commun 360, 97–102. 19 Ioanoviciu A, Meharenna YT, Poulos TL & Ortiz de Montellano PR (2009) DevS oxy complex stability identifies this heme protein as a gas sensor in Myco- bacterium tuberculosis dormancy. Biochemistry 48, 5839–5848. 20 Agarwal N & Tyagi AK (2006) Mycobacterial tran- scriptional signals: requirements for recognition by RNA polymerase and optimal transcriptional activity. Nucl Acids Res 34, 4245–4257. 21 Sun R, Converse PJ, Ko C, Tyagi S, Morrison NE & Bishai WR (2004) Mycobacterium tuberculosis ECF sigma factor SigC is required for lethality in mice and for the conditional expression of a defined gene set. Mol Microbiol 52, 25–38. 22 Florczyk MA, McCue LA, Purkayastha A, Currenti E, Wolin MJ & McDonough KA (2003) A family of acr-coregulated Mycobacterium tuberculosis genes shares a common DNA motif and requires Rv3133c (dosR or devR) for expression. Infect Immun 71, 5332–5343. 23 Moll I, Grill S, Gualerzi CO & Blasi U (2002) Leaderless mRNAs in bacteria: surprises in ribosomal recruitment and translational control. Mol Microbiol 43, 239–246. 24 Pfeifer F, Griffig J & Oesterhelt D (1993) The fdx gene encoding the [2Fe–2S] ferredoxin of Halobacterium salinarium (H. halobium). Mol Gen Genet 239, 66–71. 25 Moll I, Hirokawa G, Kiel MC, Kaji A & Blasi U (2004) Translation initiation with 70S ribosomes: an alternative pathway for leaderless mRNAs. Nucleic Acids Res 32, 3354–3363. 26 Majumdar SD, Sharma D, Vashist A, Kaur K, Taneja NK, Chauhan S, Challu VK, Ramanathan VD, Bala- sangameshwara V, Kumar P et al. (2010) Co-expression of DevR and DevR(N)-Aph proteins is associated with hypoxic adaptation defect and virulence attenuation of Mycobacterium tuberculosis. PLoS ONE 5, e9448. 27 Valdivia RH, Hromockyj AE, Monack D, Ramakrish- nan L & Falkow S (1996) Applications for green fluo- rescent protein (GFP) in the study of host-pathogen interactions. Gene 173 , 47–52. 28 Parish T, Smith DA, Kendall S, Casali N, Bancroft GJ & Stoker NG (2003) Deletion of two-component regula- tory systems increases the virulence of Mycobacterium tuberculosis. Infect Immun 71, 1134–1140. R. K. Gupta et al. Role of Lys182 in DevR function in M. tuberculosis FEBS Journal 278 (2011) 2131–2139 ª 2011 The Authors Journal compilation ª 2011 FEBS 2139 . K182G substitution in DevR or C 8 G mutation in the Dev box impairs protein–DNA interaction and abrogates DevR- mediated gene induction in Mycobacterium. footprinting led to the discovery of a secondary binding site and induction of the fdxA promoter is explained by the cooperative binding of DevR to two binding