S -Decyl-glutathione nonspecifically stimulates the ATPase activity of the nucleotide-binding domains of the human multidrug resistance-associated protein, MRP1 (ABCC1) Robbert H. Cool 1 , Marloes K. Veenstra 1 , Wim van Klompenburg 1 , Rene ´ I. R. Heyne 1 , Michael Mu¨ ller 2, *, Elisabeth G. E. de Vries 3 , Hendrik W. van Veen 1,† , and Wil N. Konings 1 1 Department of Microbiology, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Haren, the Netherlands; 2 Department of Gasteroenterology and Hepatology, University Hospital Groningen, the Netherlands; 3 Department of Medical Oncology, University Hospital Groningen, the Netherlands The human multidrug resistance-associated protein (MRP1) is an ATP-dependent efflux pump that transports anionic conjugates, and hydrophobic compounds in a glutathione dependent manner. Similar to the other, well-character- ized multidrug transporter P-gp, MRP1 comprises two nucleotide-binding domains (NBDs) in addition to transmembrane domains. However, whereas the NBDs of P-gp have been shown to be functionally equivalent, those of MRP1 differ significantly. The isolated NBDs of MRP1 have been characterized in Escherichia coli as fusions with either the glutathione-S-transferase (GST) or the maltose-binding domain (MBP). The nonfused NBD1 was obtained by cleavage of the fusion protein with thrombin. The GST-fused forms of NBD1 and NBD2 hydrolyzed ATP with an apparent K m of 340 l M and a V max of 6.0 nmol P I Æmg )1 Æmin )1 ,andaK m of 910 l M ATP and a V max of 7.5 nmol P I Æmg )1 Æmin )1 , respectively. Remarkably, S-decyl-glutathione, a conjugate specifically transported by MRP1 and MRP2, was able to stimulate the ATPase activities of the isolated NBDs more than 2-fold in a concentration-dependent manner. However, the stimulation of the ATPase activity was found to coincide with the formation of micelles by S-decyl-glutathione. Equivalent stimulation of ATPase activity could be obtained by surfactants with similar critical micelle con- centrations. Keywords: ABC; MRP; multidrug resistance; ATPase; nucleotide-binding domain. Multidrug resistance of human tumour cells is an impedi- ment to successful cancer treatment and is frequently associated with the overexpression of certain members of the ATP-binding cassette (ABC) transporter superfamily such as the MDR1 P-glycoprotein (P-gp; ABCB1) and the human multidrug resistance-associated protein (MRP1; ABCC1) [1–3]. As other ABC transporters, MRP1 is a membrane-bound transport protein that mediates the extrusion of its substrates at the expense of ATP. Studies on MRP1-expressing cells and membrane vesicles derived thereof have demonstrated that MRP1 has a broad specificity for glutathione S-conjugates, most notably cysteinyl leukotrienes, and for anionic conjugates of bile salts and steroid hormones [2,4]. In addition, MRP1 is able to extrude natural product drugs that are used in chemo- therapeutic strategies, such as daunorubicin and vincristine, in cotransport with reduced glutathione [5–7]. MRP and P-gp proteins may share a mechanism by which ATP hydrolysis is coupled to drug transport [8,9]. Indeed, the basal ATPase activity of P-gp and MRP proteins can be stimulated by some of their transported substrates or allocrites [10–18]. However, two aspects blur a clear view on the coupling mechanism. Firstly, whereas some allocrites do not stimulate, and other allocrites show only a weak stimulation of the ATPase activity, modu- lators of transport activity that are not transported can also affect ATPase activity. Secondly, the concentration- dependency of the allocrite-stimulated ATPase activity often is represented by a bell-shaped curve, and most allocrites even inhibit the ATPase activity at high concentrations [12,13,19,20]. This can be explained by assuming the presence of one high-affinity stimulatory binding site, and one low-affinity inhibitory binding site. These sites may be identical to the on and off sites, which are distinct allocrite-binding sites involved in transmem- brane transport [11]. A typical, but complicating, characteristic of multidrug transporters is their capability to efficiently expel struc- turally unrelated compounds from the cell. It was shown Correspondence to R. H. Cool, Pharmaceutical Biology, Groningen University, A. Deusinglaan 1, 9713 AV Groningen, the Netherlands, Fax: + 31 50 3633000, Tel.: + 31 50 3638154 E-mail: r.h.cool@farm.rug.nl Abbreviations: ABC, ATP-binding cassette; GST, glutathione- S-transferase; MBP, maltose-binding protein; MRP, multidrug resistance-associated protein; NBD, nucleotide-binding domain. Note: We prefer to use the term allocrite to describe transported compounds as proposed previously [8] in order to distinguish these compounds from the substrate, which by definition is ATP, and nontransported modulators. *Present address: Division of Nutrition, Metabolism and Genomics, University Wageningen, the Netherlands. Present address: Department of Pharmacology, University of Cambridge, UK. (Received 14 January 2002, revised 8 May 2002, accepted 30 May 2002) Eur. J. Biochem. 269, 3470–3478 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03028.x that different allocrites bind to different regions of the transporter, as revealed by kinetic measurements and mutational studies [21]. Although these drug-binding sites are still ill defined, there is ample evidence that most, if not all, of the residues involved in allocrite binding and transport are located within the transmembrane domains in P-gp and MRP [22–30]. Interestingly, however, two studies point to the binding of an allocrite by the ATP- binding domain of an ABC transporter. The oleando- mycin transporter OleB from Streptomyces antibioticus was suggested to have an allocrite-binding site located on the ATP-binding domain [31], and KpsT, the ATP- binding component of the Escherichia coli ABC trans- porter KspTM involved in the transport of polysialic acid, was shown to co-immunoprecipitate with polysialic acid [32]. In order to reveal the characteristics of the individual nucleotide-binding domains (NBDs) of MRP1, and in search of a putative interaction of these NBDs with allocrites, we have overproduced these domains as gluta- thione-S-transferase or maltose binding domain fusion proteins in E. coli. Both NBDs were found to be able to hydrolyse ATP with comparable activity. Remarkably, the MRP1- and MRP2-specific allocrite S-decyl-glutathione significantly stimulates the ATPase activity of these do- mains, quite similar to its effect on the ATPase activity of reconstituted MRP2. However, this stimulation was found to relate to micelle formation by this compound. MATERIALS AND METHODS Cloning of the nucleotide-binding domains of MRP DNA coding for the first nucleotide-binding domain (NBD1) of human MRP1 (residues Lys614–Lys959) was amplified by PCR from plasmid pJ3W (kindly donated by P. Borst, Netherlands Cancer Institute, Amsterdam) using the forward primer 5¢-GGCG GGATCCGATATCA AACGCCTGAGGATCTTTC-3¢ and the reverse primer 5¢-TACTAGCGGCGCCGTTA GAATTCCTTGACCTG CCCTGTCTGCGC-3¢ (the introduced BamHI and EcoRI sites, respectively, are underlined). To obtain a translational fusion between glutathione S-transferase (GST) of Schisto- soma japonicum and NBD1, the PCR product was cloned as a BamHI–EcoRI fragment into pGEX4T-1 (Pharma- cia), giving pGST-NBD1. The fusion of the NBD1 with the maltose-binding domain (MBP) was accomplished through subcloning of the BamHI–SalI fragment from pGST-NBD1 into the pMalc2 expression vector (New England Biolabs). DNA coding for NBD2 of MRP1 (residues Glu1294– Val1531) was directly cloned as an EcoRI–NotIfragmentin pGEX4T-1 to create pGST-NBD2. A slightly larger fragment of NBD2 (residues Gly1291–Val1531) was pro- duced by PCR (forward primer 5¢-CCC GGATCCGGC CGAGTGGAGTTCCGGAAC-3¢ and reverse primer 5¢-GCCAG GTCGACTTATCACACCAAGCCGGCGT CTTTGG-3¢) and subcloned into the expression vector pMBPT [33]. This vector, kindly provided by G. Altenberg (University of Texas Medical Branch, Galveston, USA), comprises a factor Xa and a thrombin cleavage site between the MBP and the fusion partner, so that the nonfused protein can be obtained by incubation with either protease. Protein overproduction and purification Overproduction of the fusion proteins was performed principally according to standard procedures, even though several deviations were tested. A low incubation tempera- ture after induction of gene expression was essential to increase solubility of NBD2-fusion proteins. Escherichia coli strains DH5a and the protease-poor AD 202 were both used for expression and did not result in large differences. In short, an overnight preculture in Luria–Bertani medium containing 50–100 lgÆmL )1 ampicillin and 0.2– 0.5% glucose was used to inoculate a larger volume of the same medium. After incubation at 37 °CuptoD 660  0.6, 0.05–0.1 m M of isopropyl thio-b- D -galactoside (Boehringer Mannheim, Germany) was added. NBD1 fusion protein- producing cultures were further incubated at 30 °Cfor5h, whereas NBD2-fusion protein producing cultures were cooled to 25 or 18 °C and incubated for an additional 5 or 16 h, respectively. Cells were harvested by centrifugation and resuspended in buffer A (20–50 m M Tris/HCl, pH 7.5, 50–100 m M NaCl, 5–10 m M dithiothreithol, 10% glycerol) in the ratio of 3 mL of buffer per g of wet cells. The resuspended cells were lyzed by ultra-sonication or by passage through a French pressure cell at 16 000 p.s.i., and centrifuged for 30–45 min at 40 000 g and 4 °Ctoremove cell debris. The supernatant was used for purification according to the protocols of the supplier of the column material: glutathione–Sepharose 4B (Pharmacia Biotech) for the purification of GST-fusion proteins, or amylose resin (New England Biolabs) for the purification of MBP-fusion proteins. Column material with bound proteins was washed extensively with buffer A, after which fusion proteins were eluted with buffer A plus 10 m M glutathione or maltose. Protein containing fractions were determined by SDS/ PAGE and pooled fractions were concentrated using Vivaspin TM centrifugation vials (Vivascience Inc.). To purify NBD1 as a separate domain in the absence of GST, the specific thrombin cleavage site located between GST and NBD1 was employed. A 20-mL column contain- ing glutathione–Sepharose 4B with GST–NBD1 was pre- pared as described above, after which 20 units of thrombin (Sigma) were added to the column. After an incubation of 16 h at 4 °C, the nonfused NBD1 was eluted from the column with buffer A and concentrated using Vivaspin centrifugation vials (Vivascience Inc.). Purified protein was rapidly frozen in liquid nitrogen and stored at )80 °C. Protein concentrations were determined by the Bradford assay using BSA as the standard. The following purified proteins were kindly provided by colleagues: the MBP fusion protein of the NBD of the lactococcal half-transporter LmrA (residues Glu328- Lys590) by M. Pasmooij (Groningen University, the Netherlands); E. coli MalK by H. Landmesser (Humboldt University, Berlin, Germany); and GlcV, the ATP-binding subunit of a glucose uptake system from the thermoacido- philic Sulfolobus solfataricus, by S. Albers (Groningen University, the Netherlands). ATPase activity The ATPase activity of NBDs was measured by a colori- metric assay [34]. Protein was incubated in buffer, supple- mented with ATP (from a 100-m M stock of Na-ATP, Ó FEBS 2002 Nucleotide-binding domains of MRP1 (Eur. J. Biochem. 269) 3471 brought to pH 7.5 with NaOH; Sigma), and allocrites or inhibitors, as described in the legends. Substrates and inhibitors were added to the reaction mixtures or inorganic phosphate standards prior to the addition of ATP. The transfer of the mixture from ice to a water bath of 30 °C started the reaction. At this temperature, the reaction was linear over the 30 min-incubation interval. Samples of 30 lL were added to wells of a 24-well plate precooled on ice, where after 150 lL of colour reagent [0.034% (w/v) malachite green base (Sigma), 1.05% (w/v) ammonium molybdate and 0.1% (v/v) Triton X-100] was added. After 5 min on ice, 75 lL of 34% (w/v) citric acid was added, and the plate was incubated for 30 min at room temperature. Subsequently, the D 650 wasmeasuredinanELISAplate reader. As a control, samples were incubated for 30 min on ice and treated in the same way. A calibration was performed using 0–160 l M of inorganic phosphate. For clarity, in Table 1 ATPase activities are presented relative to the activity measured at 2 m M Mg 2+ ,andin Figs 2,3,4 and 6 relative to the activity measured in absence of surfactant. The absolute ATPase activities of the proteins in these experiments were, depending on protein prepar- ation, in the range of 0.3–0.5 (pmol P i )Æ(pmol pro- tein) )1 Æmin )1 for the GST- and MBP-fused versions of NBD, NBD2, and LmrA-NBD, and approximately 0.02 (pmol P i )Æ(pmol protein) )1 Æmin )1 for the nonfused version of NBD1. Micelle formation Micelle formation was followed by measurement of the fluorescence of 1,6-diphenyl-1,2,3-hexatriene (Fluka), using excitation wavelength 355 and emission wavelength 428 nm. 1,6-diphenyl-1,2,3-hexatriene was dissolved to 2.5 m M in dimethylsulfoxide, and used at a final concen- tration of 5 l M . 1,6-Diphenyl-1,2,3-hexatriene was incu- bated with surfactants for at least 1 h at room temperature, as time-dependent measurements demonstra- ted that an equilibrium was reached after 30 min. Although micelle formation is usually determined with 1,6-dihydro-1,2,3-hexatriene using fluorescence anisotropy [35], standard fluorescence measurements give a reason- ably good indication of the critical micelle formation value of a surfactant. This was checked by determining the critical micelle formation value of dodecylmaltoside, which corresponded to the critical micelle formation value given by the manufacturer. RESULTS Production and purification of the NBDs of MRP1 The amplified PCR products for the first and second NBD of MRP1 were cloned into the pGEX-2T expression vector in frame with GST domain. The overexpression at 30 °Cof the gene encoding the GST–NBD1 fusion protein under control of the isopropyl thio-b- D -galactoside-inducible tac promoter was evident as shown in Fig. 1. For the overpro- duction of GST–NBD2 at 30 °C, most fusion protein was found in inclusion bodies. However, when the protein overproduction was performed at lower temperature, most GST–NBD2 was present in the soluble fraction. A yield of approximately 15 mg GST–NBD1 and 3 mg GST–NBD2 per litre of culture was achieved. The resultant proteins appear more than 95% pure as judged by SDS/PAGE analysis. Comparable results were obtained with the MBP-fused versions of NBD1 and NBD2. However, thrombin cleavage appeared less efficient for the MBP-fusion proteins as compared to the GST-fusion proteins. Basal ATPase activity In order to study the role of NBD1 and NBD2 in MRP1- mediated drug transport, the ATPase activity of the fusion proteins was determined. Kinetic analysis revealed for GST-NBD1 an apparent K m of 340 l M ATP and a V max of 6.0 nmol P i Æmg )1 min )1 , and for GST-NBD2 an Table 1. Dependence of the ATPase activity of GST–NBD1 and GST– NBD2 on divalent cations. ATPase activity was measured as described in Materials and methods in the presence of 2 m M ATP and 2 m M divalent cations or EDTA. For comparison, the ATPase activity of each NBD are presented as percentages of its activity in the presence of magnesium. Addition GST–NBD1 (%) GST–NBD2 (%) Mg 2+ 100 ± 9 100 ± 5 Ca 2+ 86 ± 12 22 ± 3 Mn 2+ 37 ± 4 38 ± 2 Co 2+ 39 ± 4 30 ± 6 EDTA 0 0 Fig. 1. Overproduction and purification of MRP1 NBDs in Escherichia coli. Fractions obtained for overproduction and purification of NBDs were analyzed by 10% SDS/polyacrylamide gel electrophoresis and stained by colloidal Coomassie staining. Lane 1–3, total bacterial proteins of cell cultures producing GST–NBD1: lane 1, overnight without IPTG; lane 2, before addition of isopropyl thio-b- D -galacto- side (t ¼ 0); lane 3, harvested cells after induction. The arrow indicates the position of GST–NBD1. Lane 4–6, overloaded samples of (semi)- purified fractions: lane 4, GST–NBD1 purified by glutathione-Seph- arose 4B affinity chromatography; lane 5, MBP–NBD2 purified by amylose/agarose; lane 6, NBD1 purified by glutathione-Sepharose 4B affinity chromatography followed by thrombin cleavage. The positions of molecular mass markers (in kDa) are indicated. 3472 R. H. Cool et al.(Eur. J. Biochem. 269) Ó FEBS 2002 apparent K m of 910 l M ATP and a V max of 7.5 nmol P i Æmg )1 Æmin )1 (data not shown). Similar V max values (5– 10 nmol P i Æmg )1 Æmin )1 ), but higher K m values (1.5–1.8 m M ) were obtained recently with His-tagged NBDs of MRP1 [36]. When compared to the full length MRP1, the obtained K m values are somewhat higher than the apparent K m of 100 l M ATP for MRP1-mediated leukotriene C 4 transport [37], and than the apparent K m of 104 l M found for purified MRP1 after reconstitution in proteoliposomes [38]. Signi- ficantly different values were obtained with the purified MRP1 in presence of phospholipids: K m ¼ 3m M and V max ¼ 460 nmol P i Æmg )1 Æmin )1 [14]. The MBP-fused versions of NBD1 and NBD2 have similar ATPase activities as the GST-fused proteins. In contrast, the ATPase activity of the nonfused NBD1 (without GST- or MBP-moiety) was one order of magni- tude lower than that of the fused protein. As yet, we have no evident explanation for this. The nonfused version of NBD2 could not be isolated by thrombin cleavage of the GST– NBD2 protein due to proteolytic degradation. GTP was hydrolyzed by both GST–NBDs (data not shown), in agreement with the finding that reconstituted MRP1 does not show nucleotide specificity [38]. The ATPase activity of GST–NBD1 and -NBD2 was dependent on the presence of divalent cations. The highest ATPase activity was obtained with magnesium ions but the hydro- lysis of ATP was also observed in the presence of manganese, cobalt and calcium ions (Table 1). To further characterize the ATPase activity of both GST-NBDs, the effect of ATPase inhibitors was tested. The cysteinyl-reactive N-ethylmaleimide did not signifi- cantly inhibit the ATPase activities at concentrations of up to 2 m M . However, the ATPase activity of GST–NBD1 and GST–NBD2 was inhibited more than 70% by 2m M sodium azide and approximately 40% by 2 m M ortho-vanadate. In comparison, the ATPase activity of reconstituted MRP1 was efficiently inhibited by ortho- vanadate (IC 50 ¼ 10 l M ), less efficiently by N-ethylmalei- mide (IC 50 ¼ 0.5 m M ), and hardly by sodium azide (IC 50 >6m M ) [38]. Surprisingly, the ATPase activities of the His-tagged NBDs were inhibited by N-ethylmaleimide [36]. In an attempt to obtain information about interdomain interactions, the basal ATPase activities were measured at different NBD concentrations. No significant deviations from a linear concentration-dependence were observed in the tested concentration range up to 4 l M for the separate domains and up to 1 l M for the mixture of the MBP-NBDs. Allocrite-mediated effects on the ATPase activity The capability was tested of a number of allocrites to stimulate the ATPase activity of the NBDs of MRP1. The following compounds (tested at the indicated concentra- tions) had no significant effect on the basal ATPase activity: vincristine (46 l M ); vincristine (46 l M ) plus reduced gluta- thione (500 l M ); reduced glutathione (500 l M ); oxidized glutathione (500 l M ); probenecid (1 m M ); sulfinpyranoside (1 m M ); N-ethyl-maleimide-glutathione (0.1–4 m M ;pre- pared as described previously; [18]); LTC4 (0.1–1.6 l M ); 17b-estradiol 17-(b- D -glucuronide) (10–75 l M ). Strikingly, the ATPase activity of GST- and MBP-NBD1 was stimulated by S-decyl glutathione: approximately twofold at 250 l M of S-decyl-glutathione (Fig. 2). Up to 250 l M of S-decyl-glutathione, the stimulatory action increased, whereas the stimulation decreased at higher concentrations. At 1 m M of S-decyl-glutathione, the meas- ured ATPase activity represented approximately the basal ATPase activity. This type of behaviour was also observed for the stimulatory effect of S-decyl-glutathione on the ATPase activity of reconstituted MRP2 [17]. The effect was Fig. 2. ATPase activity of GST–NBD1 and MBP–NBD1 is stimulated by S-decyl-glutathione. GST–NBD1 (upward diagonally hatched bars) orMBP–NBD1(blackbars)at2.5 l M was incubated with 7 m M ATP and different concentrations of S-decyl-glutathione (A), decyl-malto- side (B) or decanol (C) in 50 m M Tris/HCl, pH 7.5, 50 m M NaCl, and 50 m M MgCl 2 ,for30minat37°C.TheATPaseactivitywasdeter- mined as described in Materials and methods and calculated relative to the activity measured in absence of surfactant. Error bars indicate standard deviations. Each determination was performed at least twice. Ó FEBS 2002 Nucleotide-binding domains of MRP1 (Eur. J. Biochem. 269) 3473 specific for S-decyl-glutathione as alkyl-glutathione conju- gates of shorter chain length (ethyl-, propyl-, butyl-, hexyl-, and octyl-glutathione) did not show a significant effect on the ATPase activity at concentrations up to 1 m M .Asa control, the effects of two molecules with a similar alkyl chain were compared: decyl-maltoside and decanol (Fig. 2B,C). Decyl-maltoside did not stimulate the ATPase activity at lower concentrations, but induced a concentra- tion-dependent stimulation at concentrations above 500 l M ,atleastupto1m M (we did not measure at higher concentrations). In contrast, decanol did not show any stimulation, and caused a small, but significant and concentration-dependent inhibition of the ATPase activity. The ATPase activity of MBP–NBD2 was stimulated in the same manner as MBP–NBD1, indicating that in this respect there is no difference between the two NBDs. Surprisingly, the MBP-fusion protein of the isolated NBD of the bacterial multidrug transporter LmrA [39] also showed a similar stimulation pattern (Fig. 3). LmrA is the bacterial homologue of P-gp, and is not expected to bind or transport glutathione-conjugates. In comparison, we have measured the effect of S-decyl-glutathione on the ATPase activity of MalK [40] and of GlcV, the ATP-binding subunit of a glucose uptake system from the thermoacidophilic Sulfolobus solfataricus [41]. In both cases, the ATPase activity was slightly inhibited in a near-linear concentration- dependent manner over the concentration range 0–0.5 m M of S-decyl-glutathione (data not shown). Thus, the ATPase activity of these proteins is differently affected when compared to the NBDs of MRP and LmrA. In further analysis, the concentration of S-decyl-glutathi- one, which optimally stimulates the ATPase activity of MBP-NBD1 appeared to depend on the concentration of MBP–NBD1. The optimum increases with increasing MBP–NBD1 concentration: whereas at 1 l M of MBP– NBD1 optimal stimulation is observed at 0.2 m M S-decyl- glutathione, at 4 l M of MBP–NBD1, the optimal stimulation is achieved at 0.3–0.4 m M of S-decyl-glutathi- one (Fig. 4A). A similar concentration-dependence was found for MBP–NBD2 and NBD1 (Fig. 4), even though the optimal concentrations are shifted. These results clearly demonstrate that we are not dealing with a simple enzyme-substrate system. As the presence of two allocrite-binding sites (a stimulatory high-affinity, and an inhibitory low-affinity site) on a NBD is unlikely, we reasoned that it could be a nonspecific, detergent-related effect. As we were unable to find in the literature any indications at which concentration S-decyl-glutathione forms detergent micelles, this critical micelle concentration was determined by taking advantage of the fact that the fluorescence of 1,6-dihydro-1,2,3-hexatriene is greatly Fig. 3. ATPase activity of MBP-LmrA-NBD is stimulated by S-decyl- glutathione. MBP–LmrA–NBD at 2 l M was incubated with 5 m M ATP and different concentrations of S-decyl-glutathione in 50 m M Tris/HCl, pH 7.5, 50 m M NaCl, 10 m M MgCl 2 ,and10m M dithio- threitol, for 30 min at room temperature. The ATPase activity was determined as described in Materials and methods and calculated relative to the activity measured in absence of surfactant. Error bars indicate standard deviations. Each determination was performed at least twice. Fig. 4. Concentration profile of the S-decyl-glutathione-stimulated ATPase activity depends on the concentration of the nucleotide-binding domain. Four different concentrations of (A) MBP–NBD1 (1, 2, 3, 4 l M ), (B) MBP–NBD2 (1, 2, 3, 4 l M )or(C)NBD1(5,10,15,20l M ) in 50 m M Tris/HCl, pH 7.5, 50 m M NaCl, 10 m M MgCl 2 ,and10m M dithiothreitol, were incubated with 1 m M ATP for 30 min at room temperature. The ATPase activities were determined in presence of S-decyl-glutathione as described in Materials and methods and normalized to the activity found in absence of surfactant (100%). The relative ATPase activities at the indicated concentrations of surfactant are represented by columns with upward diagonally hatched, black, horizontally hatched or downward diagonally hatched surface for the activities at the lowest to highest concentration of the NBDs, respectively. Each activity was measured at least twice. The bar represents the standard deviation. 3474 R. H. Cool et al.(Eur. J. Biochem. 269) Ó FEBS 2002 enhanced in hydrophobic environment, e.g. upon formation of micelles. In Fig. 5, the fluorescence of 1,6-dihydro-1,2,3- hexatriene in presence of different concentrations of S-decyl-glutathione, decyl-maltoside and dodecyl-maltoside are depicted. The increase of fluorescence starting at approximately 0.15 m M of dodecyl-maltoside and the slight increase starting at 1 m M of decyl-maltoside corresponds with the critical micelle concentrations of these compounds, respectively, 0.17 m M and 1.8 m M (values manufacturer). The 1,6-dihydro-1,2,3-hexatriene-mediated fluorescence in the presence of S-decyl-glutathione suggests that this compound forms micelles already at low concentrations. At the moment we cannot explain why the S-decyl- glutathione-induced fluorescence shows a relative minimum at approximately 0.8 m M of S-decyl-glutathione (Fig. 5B). As micelle formation could affect the ATPase activity of the NBD, we tested the effects of surfactants with different critical micelle concentrations. The three surfactants un- decyl-, dodecyl- and tridecyl-maltoside could stimulate the ATPase activity of GST–NBD1 to a similar extent as S-decyl-glutathione, butwith different concentration optima: 0.1–0.5, 0.05–0.2 and 0–0.1 m M , respectively (Fig. 6). These values correspond reasonably well to the critical micelle con- centrations of these compounds: 0.6, 0.12 and 0.024 m M , respectively (values manufacturer). Similarly, Triton-X100 (critical micelle concentration value: 0.23 m M )stimulated the ATPase activity of MBP-NBD2 in a similar fashion as dodecyl-maltoside and S-decyl-glutathione (not shown). Thus, the stimulatory effect of S-decyl-glutathione or other surfactants on the ATPase activity of the MRP–NBDs seems to be related to micelle formation and not to be a specific, allocrite-mediated effect. DISCUSSION In this study, we show that the isolated nucleotide-binding domains of human MRP1 display comparable ATPase activities. The Michaelis–Menten constants K m and V max for the GST-fusion proteins of NBD1 and NBD2 are 340 l M and 6.0 nmol P i Æmg )1 Æmin )1 ,and910l M and 7.5 nmol P i Æmg )1 Æmin )1 , respectively. These kinetic param- eters are in the same range of those observed for the isolated NBDs of the human MDR1 P-glycoprotein [42], the cystic fibrosis transmembrane conductance regulator [43] and prokaryotic ABC transporters [44]. Furthermore, these results are in reasonable agreement with the results obtained with the isolated NBDs of MRP1 comprising an N-terminal His-tag [36], and to the values obtained with the reconsti- tuted MRP1, isolated from insect cells [37] or human tumour cells [38]. The similarity of the basal ATPase activities of the two isolated domains does not seem to correlate to the differences found in photo-affinity labelling experiments with MRP1 using 8-azido-adenosine nucleo- tides [45–47]. ATP labelling occurred preferentially at NBD1, while ortho-vanadate-induced trapping of ADP occurred predominantly at NBD2. However, such different Fig. 6. Stimulation of the ATPase activity of GST–NBD1 by undecyl-, dodecyl-, and tridecyl-maltoside. In a buffer of 50 m M Tris/HCl, pH 7.5, 50 m M NaCl, 10 m M MgCl 2 ,and10m M dithiothreitol, 1 l M of GST-NBD1 was incubated with 1 m M ATP in presence of different concentrations of n-undecyl-b- D -maltoside (A; upward diagonally hatched bars), n-dodecyl-b- D -maltoside (B; black bars) or n-tridecyl- b- D -maltoside (C; downward diagonally hatched bars) for 30 min at room temperature. ATPase activities were measured as described in Materials and methods and represented as activities relative to the activity measured in absence of the surfactants. Experiments were performed at least in duplicate. Error bars indicate the standard deviations. Fig. 5. Detection of micelle formation by dodecyl-maltoside (A), decyl- maltoside and S-decyl-glutathione (B). Different concentrations of dodecyl-maltoside (A, d), decyl-maltoside (B; r)andS-decyl-gluta- thione (B; j) were incubated with 5 l M 1,6-dihydro-1,2,3-hexatriene in 50 m M Tris/HCl,pH7.5,50m M NaCl, 10 m M MgCl 2 ,and10m M dithiothreitol, for 3 h at room temperature. Thereafter, the fluores- cence was determined using a 355-nm excitation wavelength and a 428-nm emission wavelength. For every measurement, the fluorescence was followed for at least 5 min in order to assure a stable value. Ó FEBS 2002 Nucleotide-binding domains of MRP1 (Eur. J. Biochem. 269) 3475 behaviour may result from different contacts within the full length MRP1 of the NBD(s) with other domains and/or the lipidic bilayer. The hydrolysis of ATP by both NBDs of MRP1 was dependent on divalent cations and was inhibited by ATPase inhibitors, such as ortho-vanadate and azide. Our data indicate that both NBDs of MRP1 are also able to hydrolyze GTP. This result is consistent with previous studies on full length MRP1 protein, which demonstrated the hydrolysis of ATP and GTP by purified MRP1 [15], and the dependence on these nucleotides of MRP1-mediated drug transport in plasma membrane vesicles [5]. Frequently MBP-fusion proteins are more stable than GST-fusion proteins, in line with the postulation that the MBP-moiety functions as an intramolecular chaperone [48]. We could observe a similar effect for the NBDs of MRP1, although the differences in solubility for the two types of fusion proteins were not very large. The MBP-fusion proteins however, appeared to be cleaved by thrombin less efficiently than the GST-fusion proteins, most likely due to a shielding effect of the MBP moiety. The nonfused NBD1 appeared to be stable, but to have an ATPase activity that is one order of magnitude lower than that of the fused forms of this domain. As yet, we have no satisfactory explanation for this. A similar effect was observed for the NBD of P-gp, which appeared to express a 100–1000-fold lower ATPase activity as compared to P-gp full length. It was suggested that NBDs may need to interact with the membrane-bound domains (i.e. intracellular loops) to fold properly [23]. In addition, differences in the N- and C-terminal boundaries of subcloned NBDs seem to affect the solubility of the isolated domains and may also influence the ATPase activity. Indeed, preliminary data show significant differences in basal ATPase activities of MBP-fused constructs of NBD1 of different length (not shown). An important aspect of the mechanism, by which ABC transporter proteins expel the allocrites from the cell, is how the ATP hydrolysis is coupled to transport. Stimulation of ATPase activity by allocrites has been used as an important assay for the elucidation of this coupling. However, even though the ATPase activity can be stimulated by some allocrites, this stimulation is modest and not observed for all allocrites. In addition, the many studies that have been performed to reveal the drug-binding sites of MDR transporters suggest that these binding sites are located in the transmembrane segments. Indeed, whereas modulators of transport activity, e.g. flavonoids, were shown to interact with the NBDs P-gp or MRP proteins [49,50], no interac- tions between allocrites and the NBDs of these transporters were reported. In contrast, the oleandomycin ABC trans- porter OleB from Streptomyces antibioticus was suggested to have an allocrite-binding site located on the ATP-binding domain [31]. Furthermore, the ATP-binding component of the Escherichia coli ABC transporter KspTM involved in the transport of polysialic acid, KpsT, was shown to co- immunoprecipitate with the allocrite polysialic acid [32]. The latter examples encouraged us to measure the effects of MRP-specific allocrites on the ATPase activity of the isolated NBDs. We have tested several MRP-specific allocrites in their ability to stimulate the ATPase activity of NBD1. Most of the tested compounds did not induce a significant stimula- tion of the basal activity. Remarkably, however, the high affinity-allocrite S-decyl-glutathione showed a stimulatory effect, which was concentration dependent. An optimal concentration was found around 100–300 l M , above which concentration the stimulatory effect decreased to zero (Fig. 2). This effect is very similar to that observed with reconstituted MRP2: a 2.5-fold stimulation of the ATPase activity was observed at 100 l M S-decyl-glutathione, whereasnostimulationcouldbemeasuredat1m M [17]. However, additional experiments cautioned us to interpret the observed effect as a demonstration of the presence of an allocrite-binding site on NBD1. First, we could obtain a similar stimulatory effect with NBD2, and with the NBD of the bacterial transporter LmrA (Fig. 3) that is not supposed to transport glutathione-conjugates. Secondly, we noticed that the optimal stimulatory concentration of allocrite was dependent on the concentration of NBD (Fig. 4). Taken together, these results pointed at a possibly nonspecific effect of S-decyl-glutathione. As S-decyl-glutathione comprises an alkyl chain, it may act as a surfactant. After having already determined that S-decyl-glutathione is capable of forming micelles at low concentrations (Fig. 5) we measured the effects of surfac- tants with different critical micelle concentration values on the ATPase activity of the NBDs (Fig. 6). It was found that the stimulation of these compounds, which are not known to be allocrites of MRP1, coincides with micelle formation. Thus, the observed effect appears to be more surfactant- related than allocrite-related. The shift in optimal stimulatory concentration of allocrite related to the NBD concentration can be rationalized by assuming a direct interaction between surfactant molecules and the protein, which would cause a decrease in free concentration of surfactant and thereby a shift to a higher critical micelle concentration value. Such an interaction was suggested between P-gp and detergents [20]. It is tempting to speculate that the surfactant-dependent stimulation may mimick the interaction between the NBD and lipid bilayer. Indeed, the phospholipidic content of biomembranes affects the basal and the drug-stimulated ATPase activity of MRP1 [51] and P-gp [52], similar to the effects on the ATPase activity of ABCR [53]. This is supported by the close proximity of the NBDs of P-gp to the membrane surface observed by spectroscopic measurements [54,55] and electron microscopy [56], and by the recently published crystal structure of the Escherichia coli ABC transporter MsbA [57]. At this point we cannot explain the decrease in stimulatory effect at higher concentrations of surfactant. Further work is required to elucidate these effects. In conclusion, the NBDs of MRP1 show comparable basal ATPase activities that can be stimulated by the allocrite S-decyl-glutathione. We could show, however, that this stimulation results not from an allocrite-specific effect, but from surfactant-mediated micelle formation. Our results strongly suggest that the stimulatory action of S-decyl- glutathione on the ATPase activity should not be used as a signal for specific interaction between MRP and allocrite. ACKNOWLEDGEMENTS This investigation was supported by grant RuG 96–1218 from the Dutch Cancer Society and part of a joint GUIDE-GBB research programme at the Groningen University. We would like to thank 3476 R. H. Cool et al.(Eur. J. Biochem. 269) Ó FEBS 2002 Sarina van der Zee, Patrycja Golon and Sylwia Chocholska for technical assistance. Furthermore we thank Piet Borst for the kind gift of plasmid pJ3W, and Marjon Pasmooij, Sonja Albers and Heidi Landmesser for purified LmrA-NBD, GlcV, and MalK, respectively. H. W. v. V was a fellow of the Netherlands Academy of Art and Sciences. REFERENCES 1. Borst, P., Evers, R., Kool, M. & Wijnholds, J. (2000) A family of drug transporters: the multidrug resistance-associated proteins. J. Natl Cancer Inst. 92, 1295–1302. 2. Cole, S.P. & Deeley, R.G. (1998) Multidrug resistance mediated by the ATP-binding cassette transporter protein MRP. Bioessays 20, 931–940. 3. Renes,J.,deVries,E.G.,Jansen,P.L.&Mu ¨ ller, M. (2000) The (patho) physiological functions of the MRP family. Drug Resist. Update 3, 289–302. 4. Keppler, D., Cui, Y., Ko ¨ nig,J.,Leier,I.&Nies,A.(1999)Export pumps for anionic conjugates encoded by MRP genes. Adv. Enzyme Regul. 39, 237–246. 5. Loe, D.W., Almquist, K.C., Deeley, R.G. & Cole, S.P. (1996) Multidrug resistance protein (MRP)-mediated transport of leuko- triene C4 and chemotherapeutic agents in membrane vesicles. Demonstration of glutathione-dependent vincristine transport. J. Biol. Chem. 271, 9675–9682. 6. Loe, D.W., Deeley, R.G. & Cole, S.P. (1998) Characterization of vincristine transport by the M(r) 190 000 multidrug resistance protein (MRP): evidence for cotransport with reduced gluta- thione. Cancer Res. 58, 5130–5136. 7. Renes, J., de Vries, E.G., Nienhuis, E.F., Jansen, P.L. & Mu ¨ ller, M. (1999) ATP- and glutathione-dependent transport of che- motherapeutic drugs by the multidrug resistance protein MRP1. Br. J. Pharmacol. 126, 681–688. 8.Holland,I.B.&Blight,M.A.(1999)ABC-ATPases,adaptable energy generators fuelling transmembrane movement of a variety of molecules in organisms from bacteria to humans. J. Mol. Biol. 293, 381–399. 9. Jones, P.M. & George, A.M. (1999) Subunit interactions in ABC transporters: towards a functional architecture. FEMS Microbiol. Lett. 179, 187–202. 10. Gottesman, M.M. & Pastan, I. (1993) Biochemistry of multidrug resistance mediated by the multidrug transporter. Annu. Rev. Biochem. 62, 385–427. 11. Ambudkar, S.V., Dey, S., Hrycyna, C.A., Ramachandra, M., Pastan, I. & Gottesman, M.M. (1999) Biochemical, cellular, and pharmacological aspects of the multidrug transporter. Annu. Rev. Pharmacol. Toxicol. 39, 361–398. 12. Urbatsch, I.L., al-Shawi, M.K. & Senior, A.E. (1994) Character- ization of the ATPase activity of purified Chinese hamster P-glycoprotein. Biochemistry 33, 7069–7076. 13. Litman, T., Zeuthen, T., Skovsgaard, T. & Stein, W.D. (1997) Competitive, non-competitive and cooperative interactions between substrates of P-glycoprotein as measured by its ATPase activity. Biochim. Biophys. Acta 1361, 169–176. 14. Chang, X.B., Hou, Y.X. & Riordan, J.R. (1997) ATPase activity of purified multidrug resistance-associated protein. J. Biol. Chem. 272, 30962–30968. 15. Chang, X.B., Hou, Y.X. & Riordan, J.R. (1998) Stimulation of ATPase activity of purified multidrug resistance-associated pro- tein by nucleoside diphosphates. J. Biol. Chem. 273, 23844–23848. 16.Pascaud,C.,Garrigos,M.&Orlowski,S.(1998)Multidrug resistance transporter P-glycoprotein has distinct but interacting binding sites for cytotoxic drugs and reversing agents. Biochem. J. 333, 351–358. 17. Hagmann,W.,Nies,A.T.,Konig,J.,Frey,M.,Zentgraf,H.& Keppler, D. (1999) Purification of the human apical conjugate export pump MRP2 reconstitution and functional characteriza- tion as substrate-stimulated ATPase. Eur. J. Biochem. 265, 281–289. 18. Bakos,E.,Evers,R.,Sinko,E.,Varadi,A.,Borst,P.&Sarkadi,B. (2000) Interactions of the human multidrug resistance proteins MRP1 and MRP2 with organic anions. Mol. Pharmacol. 57, 760–768. 19. Ambudkar, S.V., Lelong, I.H., Zhang, J., Cardarelli, C.O., Gottesman, M.M. & Pastan, I. (1992) Partial purification and reconstitution of the human multidrug-resistance pump: char- acterization of the drug-stimulatable ATP hydrolysis. Proc. Natl Acad.Sci.USA89, 8472–8476. 20. Orlowski, S., Mir, L.M., Belehradek, J. Jr & Garrigos, M. (1996) Effects of steroids and verapamil on P-glycoprotein ATPase activity: progesterone, deoxycorticosterone, corticosterone and verapamil are mutually non-exclusive modulators. Biochem. J. 317, 515–522. 21.Martin,C.,Berridge,G.,Mistry,P.,Higgins,C.,Charlton,P. & Callaghan, R. (2000) Drug binding sites on P-glycoprotein are altered by ATP binding prior to nucleotide hydrolysis. Biochemistry 39, 11901–11906. 22. Loo, T.W. & Clarke, D.M. (1999) Identification of residues in the drug-binding domain of human P-glycoprotein. Analysis of transmembrane segment 11 by cysteine-scanning mutagenesis and inhibition by dibromobimane. J. Biol. Chem. 274, 35388–35392. 23. Sharom, F.J., Yu, X., Lu, P., Liu, R., Chu, J.W., Szabo, K., Mu ¨ ller, M., Hose, C.D., Monks, A., Varadi, A., Seprodi, J. & Sarkadi, B. (1999) Interaction of the P-glycoprotein multidrug transporter (MDR1) with high affinity peptide chemosensitizers in isolated membranes, reconstituted systems, and intact cells. Biochem. Pharmacol. 58, 571–586. 24. Stride, B.D., Cole, S.P. & Deeley, R.G. (1999) Localization of a substrate specificity domain in the multidrug resistance protein. J. Biol. Chem. 274, 22877–22883. 25. Ryu, S., Kawabe, T., Nada, S. & Yamaguchi, A. (2000) Identifi- cation of basic residues involved in drug export function of human multidrug resistance-associated protein 2. J. Biol. Chem. 275, 39617–39624. 26. Zhang, D.W., Cole, S.P. & Deeley, R.G. (2001) Identification of a nonconserved amino acid residue in multidrug resistance protein 1 important for determining substrate specificity: evidence for functional interaction between transmembrane helices 14 and 17. J. Biol. Chem. 276, 34966–34974. 27. Zhang, D.W., Cole, S.P. & Deeley, R.G. (2001) Identification of an amino acid residue in multidrug resistance protein 1 critical for conferring resistance to anthracyclines. J. Biol. Chem. 276, 13231– 13239. 28. Loo, T.W. & Clarke, D.M. (2001) Defining the drug-binding site in the human multidrug resistance P-glycoprotein using a methane- thiosulfonate analog of verapamil, MTS-verapamil. J. Biol. Chem. 276, 14972–14979. 29. Ito, K., Suzuki, H. & Sugiyama, Y. (2001) Charged amino acids in the transmembrane domains are involved in the determination of the substrate specificity of rat Mrp2. Mol. Pharmacol. 59, 1077– 1085. 30. Ito, K., Olsen, S.L., Qiu, W., Deeley, R.G. & Cole, S.P. (2001) Mutation of a single conserved tryptophan in multidrug resistance protein 1 (MRP1/ABCC1) results in loss of drug resistance and selective loss of organic anion transport. J. Biol. Chem. 276, 15616–15624. 31. Buche, A., Mendez, C. & Salas, J.A. (1997) Interaction between ATP, oleandomycin and the OleB ATP-binding cassette trans- porter of Streptomyces antibioticus involved in oleandomycin secretion. Biochem. J. 321, 139–144. 32. Bliss, J.M. & Silver, R.P. (1997) Evidence that KpsT, the ATP- binding component of an ATP-binding cassette transporter, is exposed to the periplasm and associates with polymer during Ó FEBS 2002 Nucleotide-binding domains of MRP1 (Eur. J. Biochem. 269) 3477 translocation of the polysialic acid capsule of Escherichia coli K1. J. Bacteriol. 179, 1400–1403. 33. Wang, C., Castro, A.F., Wilkes, D.M. & Altenberg, G.A. (1999) Expression and purification of the first nucleotide-binding domain and linker region of human multidrug resistance gene product: comparison of fusions to glutathione S-transferase, thioredoxin and maltose-binding protein. Biochem. J. 338, 77–81. 34. Driessen, A.J., Brundage, L., Hendrick, J.P., Schiebel, E. & Wickner, W. (1991) Preprotein translocase of Escherichia coli: solubilization, purification, and reconstitution of the integral membrane subunits SecY/E. Methods Cell. Biol. 34, 147–165. 35. Zhang, X., Jackson, J.K. & Burt, H.M. (1996) Determination of surfactant critical micelle concentration by a novel fluorescence depolarization technique. J. Biochem. Biophys. Meth. 31, 145–150. 36. Kern, A., Felfoldi, F., Sarkadi, B. & Varadi, A. (2000) Expression and characterization of the N- and C-terminal ATP-binding domains of MRP1. Biochem. Biophys. Res. Commun. 273, 913–919. 37. Gao, M., Loe, D.W., Grant, C.E., Cole, S.P.C. & Deeley, R.G. (1996) Reconstitution of ATP-dependent leukotriene C4 transport by co-expression of both half-molecules of human multidrug resistance protein in insect cells. J. Biol. Chem. 271, 27782–27787. 38. Mao, Q., Leslie, E.M., Deeley, R.G. & Cole, S.P. (1999) ATPase activity of purified and reconstituted multidrug resistance protein MRP1 from drug-selected H69AR cells. Biochim. Biophys. Acta 1461, 69–82. 39. van Veen, H.W., Venema, K., Bolhuis, H., Oussenko, I., Kok, J., Poolman, B., Driessen, A.J. & Konings, W.N. (1996) Multidrug resistance mediated by a bacterial homolog of the human multi- drug transporter MDR1. Proc.NatlAcad.Sci.USA93, 10668– 10672. 40. Schmees, G., Stein, A., Hunke, S., Landmesser, H. & Schneider, E. (1999) Functional consequences of mutations in the conserved Ôsignature sequenceÕ of the ATP-binding-cassette protein MalK. Eur. J. Biochem. 266, 420–430. 41. Albers, S.V., Elferink, M.G., Charlebois, R.L., Sensen, C.W., Driessen, A.J. & Konings, W.N. (1999) Glucose transport in the extremely thermoacidophilic Sulfolobus solfataricus involves a high-affinity membrane-integrated binding protein. J. Bacteriol. 181, 4285–4291. 42. Baubichon-Cortay,H.,Baggetto,L.G.,Dayan,G.&DiPietro,A. (1994) Overexpression and purification of the carboxyl-terminal nucleotide-binding domain from mouse P-glycoprotein. Strategic location of a tryptophan residue. J. Biol. Chem. 269, 22983–22989. 43. Ko, Y.H., Thomas, P.J., Delannoy, M.R. & Pedersen, P.L. (1993) The cystic fibrosis transmembrane conductance regulator. Over- expression, purification, and characterization of wild type and delta F508 mutant forms of the first nucleotide binding fold in fusion with the maltose-binding protein. J. Biol. Chem. 268, 24330–24338. 44. Koronakis, V., Hughes, C. & Koronakis, E. (1993) ATPase ac- tivity and ATP/ADP-induced conformational change in the sol- uble domain of the bacterial protein translocator HlyB. Mol. Microbiol. 8, 1163–1175. 45. Gao,M.,Cui,H.R.,Loe,D.W.,Grant,C.E.,Almquist,K.C., Cole, S.P. & Deeley, R.G. (2000) Comparison of the functional characteristics of the nucleotide binding domains of multidrug resistance protein 1. J. Biol. Chem. 275, 13098–13108. 46. Hou, Y., Cui, L., Riordan, J.R. & Chang, X. (2000) Allosteric interactions between the two non-equivalent nucleotide binding domains of multidrug resistance protein MRP1. J. Biol. Chem. 275, 20280–20287. 47. Nagata, K., Nishitani, M., Matsuo, M., Kioka, N., Amachi, T. & Ueda, K. (2000) Nonequivalent nucleotide trapping in the two nucleotide binding folds of the human multidrug resistance pro- tein MRP1. J. Biol. Chem. 275, 17626–17630. 48. Kapust, R.B. & Waugh, D.S. (1999) Escherichia coli maltose- binding protein is uncommonly effective at promoting the solubility of polypeptides to which it is fused. Protein Sci. 8, 1668–1674. 49. Conseil, G., Baubichon-Cortay, H., Dayan, G., Jault, J.M., Barron, D. & Di Pietro, A. (1998) Flavonoids: a class of modulators with bifunctional interactions at vicinal ATP- and steroid-binding sites on mouse P-glycoprotein. Proc. Natl Acad. Sci. USA 95, 9831–9836. 50. Perez-Victoria, J.M., Chiquero, M.J., Conseil, G., Dayan, G., Di Pietro, A., Barron, D., Castanys, S. & Gamarro, F. (1999) Correlation between the affinity of flavonoids binding to the cytosolic site of Leishmania tropica multidrug transporter and their efficiency to revert parasite resistance to daunomycin. Biochemistry 38, 1736–1743. 51. Hooijberg, J.H., Pinedo, H.M., Vrasdonk, C., Priebe, W., Lankelma, J. & Broxterman, H.J. (2000) The effect of glutathione on the ATPase activity of MRP1 in its natural membranes. FEBS Lett. 469, 47–51. 52. Di Pietro, A., Dayan, G., Conseil, G., Steinfels, E., Krell, T., Trompier, D., Baubichon-Cortay, H. & Jault, J. (1999) P-glyco- protein-mediated resistance to chemotherapy in cancer cells: using recombinant cytosolic domains to establish structure-function relationships. Braz.J.Med.Biol.Res.32, 925–939. 53. Ahn, J., Wong, J.T. & Molday, R.S. (2000) The effect of lipid environment and retinoids on the ATPase activity of ABCR, the photoreceptor ABC transporter responsible for Stargardt macular dystrophy. J. Biol. Chem. 275, 20399–20405. 54. Liu, R. & Sharom, F.J. (1998) Proximity of the nucleotide bind- ing domains of the P-glycoprotein multidrug transporter to the membrane surface: a resonance energy transfer study. Biochemistry 37, 6503–6512. 55. Liu, R., Siemiarczuk, A. & Sharom, F.J. (2000) Intrinsic fluores- cence of the P-glycoprotein multidrug transporter: sensitivity of tryptophan residues to binding of drugs and nucleotides. Biochemistry 39, 14927–14938. 56. Rosenberg, M.F., Callaghan, R., Ford, R.C. & Higgins, C.F. (1997) Structure of the multidrug resistance P-glycoprotein to 2.5 nm resolution determined by electron microscopy and image analysis. J. Biol. Chem. 272, 10685–10694. 57. Chang, G. & Roth, C.B. (2001) Structure of MsbA from E. coli:a homolog of the multidrug resistance ATP binding cassette (ABC) transporters. Science 293, 1793–1800. 3478 R. H. Cool et al.(Eur. J. Biochem. 269) Ó FEBS 2002 . S -Decyl-glutathione nonspecifically stimulates the ATPase activity of the nucleotide-binding domains of the human multidrug resistance-associated protein, MRP1. effects on the ATPase activity The capability was tested of a number of allocrites to stimulate the ATPase activity of the NBDs of MRP1. The following compounds