Hansenula polymorpha pex11 cells are affected in peroxisome retention Arjen M. Krikken 1 , Marten Veenhuis 1,2 and Ida J. van der Klei 1,2 1 Molecular Cell Biology, Groningen Biomolecular Sciences and Biotechnology Institute (GBB), University of Groningen, Haren, The Netherlands 2 Kluyver Centre for Genomics of Industrial Fermentation, Delft, The Netherlands Peroxisomes are single-membrane-bound, highly dynamic organelles that have crucial functions in eukaryotic cells [1]. Peroxisome loss or malfunction in human leads to severe diseases that may lead to an early death (e.g. Zellweger syndrome) [2]. For almost 20 years it was assumed that peroxi- somes exclusively multiply by growth and division [3]. However, several groups unequivocally demonstrated that peroxisomes may also arise from the endoplasmic reticulum under specific conditions [4–7]. Subsequent independent studies showed that peroxisomes in wild- type Saccharomyces cerevisiae and Hansenula polymor- pha cells multiply mainly by division [8,9]. Pex11p is the first peroxin to be implicated in per- oxisome proliferation. Cells deleted for PEX11 have reduced numbers of peroxisomes that are increased in size relative to wild-type organelles [10], and this is associated with a growth defect under conditions that require peroxisome functions (e.g. oleate or methanol) [10,11]. Overexpression of PEX11 resulted in prolifera- tion and elongation of peroxisomes [11–14]. The molecular mechanisms of Pex11p function in peroxisome proliferation are still largely unknown. Goodman et al. [15] proposed that the oligomerization state of the protein was discriminative in Pex11p func- tion: Pex11p monomers promoted peroxisome prolifer- ation, whereas the dimeric form resulted in termination of organelle proliferation. A primary role in medium-chain fatty acid oxidation has been described for Pex11p in S. cerevisiae, suggesting a sec- ondary role in peroxisome fission [16]. However, the observation that Pex11p acts directly in peroxisome division independently of peroxisome metabolism sug- gests a distinct role in the peroxisome fission process [9,17]. In this study, we characterized H. polymorpha PEX11 and analyzed its role in peroxisome biology. Consistent with other studies, in H. polymorpha peroxisome abundance could be manipulated by vary- ing Pex11p levels. However, we also found a novel unexpected role for Pex11p in regulating peroxisome retention ⁄ inheritance during vegetative reproduction Keywords inheritance; Inp1p; peroxisome; Pex11p; yeast Correspondence I. J. van der Klei, P.O. Box 14, 9750AA Haren, The Netherlands Fax: +31 50 363 8280 Tel: +31 50 363 2179 E-mail: i.j.van.der.klei@rug.nl (Received 7 November 2008, revised 22 December 2008, accepted 30 December 2008) doi:10.1111/j.1742-4658.2009.06883.x We have cloned and characterized the Hansenula polymorpha PEX11 gene. Our morphological data are consistent with previous observations that peroxisome proliferation can be regulated by modulating Pex11p levels. Surprisingly, pex11 cells also showed a defect in peroxisome retention in mother cells during vegetative cell reproduction. Until now, Saccharo- myces cerevisiae Inp1p has been the only peroxisomal protein that has been shown to play a role in the organelle retention process. H. polymorpha inp1 cells are also affected in peroxisome retention, like pex11 cells. We show by time-lapse imaging that Inp1–green fluorescent protein localization varies during the cell cycle and that the protein is normally recruited to peroxi- somes in pex11 cells. Taken together, our data show that H. polymorpha Pex11p is not only important for peroxisome proliferation but is also required for proper peroxisome segregation during cell division. Abbreviation GFP, green fluorescent protein. FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS 1429 of cells. Until now, only the peripheral membrane protein Inp1 of S. cerevisiae has been implicated as playing a direct role in peroxisome retention ⁄ inheri- tance [18]. Results Identification and characterization of H. polymorpha PEX11 A tblastn search using the primary sequence of S. cerevisiae Pex11p as a query identified a single H. polymorpha PEX11 candidate in the H. polymorpha genome [19]. The H. polymorpha PEX11 gene product consists of 259 amino acids with a calculated mass of approximately 29 kDa that was similar to S. cerevisiae Pex11p (32% identity). The nucleotide sequence of the gene has been deposited in GenBank (accession num- ber DQ645582). Cells of a constructed PEX11 deletion strain (pex11) grew like the wild-type on glucose (not shown), but displayed a minor but significant growth defect when grown in the presence of methanol as sole carbon and energy source (Fig. 1A). Electron micros- copy revealed that methanol-grown pex11 cells gener- ally contained a single enlarged peroxisome (Fig. 1C). Transformation of pex11 cells with a plasmid contain- ing PEX11 restored a normal wild-type phenotype, confirming that authentic PEX11 was deleted in pex11 10 1 0.1 A 660 WT 0 10 20 Time (h) 30 40 pe×11 A B C D Fig. 1. PEX11 controls peroxisome number in H. polymorpha. Growth experiments with H. polymorpha pex11 cells revealed that the dou- bling time of cells under peroxisome-inducing condition are retarded relative to the wild-type (WT) (A). The graphs represent the average of three independent experiments. The bars represent standard error. Ultrathin sections through methanol-grown, KMnO 4 -fixed wild-type control cell (B) and a pex11 (C) cell demonstrating the presence of an enlarged peroxisome in pex11 cells relative to the normal multiple organelles in wild-type controls. Overexpression of PEX11 results in massive peroxisome proliferation (D). The bars represent 0.5 lm. P, peroxisome; M, mitochondrion; N, nucleus; V, vacuole. A role of Pex11 in peroxisome retention in yeast A. M. Krikken et al. 1430 FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS cells (not shown). As observed for other organisms, overexpression of PEX11 in wild-type cells resulted in massive peroxisome proliferation (Fig. 1D). Deletion of PEX11 affects normal peroxisome partitioning in budding cells H. polymorpha cells, grown to the mid-exponential growth phase on glucose, characteristically contain a single peroxisome per cell [20]. During vegetative cell reproduction, these organelles are typically positioned in the neck region between mother cell and bud prior to fission; one of the resulting organelles then migrates into the developing daughter cell (bud) (Fig. 2A). However, in pex11 cells, organelle positioning and fission was not observed. Instead, the single organelle present in the mother cells migrated into the buds, leaving the mother cells devoid of peroxisomes at the late stages of the budding process (Fig. 2B). In the few exceptional cases of cells that contained two peroxi- somes, these two organelles migrated to the bud (Fig. 2B, inset). To substantiate the above observa- tions, quantitative analyses were performed. To this end, Z-stacks were acquired from randomly selected cells using confocal microscopy, and peroxisome loca- tion was determined. The data presented in Fig. 2C show that in wild-type cells, essentially all mother and daughter cells contain a peroxisome (Fig. 2C). How- ever, in pex11 cells, a significant percentage of the bud- ding cells lacked peroxisomes in the mother cells. Electron microscopy confirmed that in budding pex11 cells, peroxisomal structures are not detectable in the mother cell after migration of the organelles to the buds (Fig. 2D). 100 80 60 40 Cell frequency (%) 20 0 Peroxisome only in mother Peroxisome only in bud Peroxisome mother and bud no peroxisomes pe×11 WT A B C D Fig. 2. Budding of PEX11 deletion cells results in mother cells lacking peroxisomes. Analysis of Z-stacks of glucose-grown cells producing GFP–SKL recorded by confocal laser scanning microscopy revealed that in wild-type (WT) cells, peroxisomes are evenly distributed over the mother cell and developing bud (A). In pex11 cells, peroxisomes are predominantly present in the daughter cell (B).Quantification of peroxi- somes in pex11 and wild-type cells. For each sample, peroxisomes from 2 · 100 cells were counted from two independent experiments. The bar represents the standard error of the mean. (C). Electron microscopy of glucose-grown cells revealed the presence of peroxisomes in developing buds but not in the mother cell (D). The bar represents 2 lm in (A) and (B), and 0.5 lm in (D). P, peroxisome; M, mitochon- drion; N, nucleus; V, vacuole. A. M. Krikken et al. A role of Pex11 in peroxisome retention in yeast FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS 1431 The above observation, that the organelles are not positioned in the neck region between mother cell and bud prior to fission, lends support to the view that orga- nelle retention is disturbed in pex11 cells. To study the putative defect in peroxisome retention in more detail, video microscopy of wild-type and pex11 cells that produce green fluorescent protein containing the carboxyterminal tripeptide serine lysine leucine that functions as peroxisomal targeting signal (GFP-SKL) was performed. In wild-type control cells, peroxisomes are normally distributed over mother and daughter cells at an early stage of bud formation (Fig. 3A; Video S1). As shown in Video S2, the peroxisomes in pex11 cells migrate into the daughter cell at an early stage of bud formation, leaving the mother cell devoid of these struc- tures. Infrequently, a peroxisome moving from mother to daughter and vice versa was observed, akin to previ- ous observations in S. cerevisiae inp1 cells [18] (Fig. 3B). Inp1p is localized to peroxisomes in pex11 cells The observed peroxisome phenotype of H. polymorpha pex11 cells shows a strong resemblance to the per- oxisome inheritance phenotype of S. cerevisiae and Yarrowia lipolytica inp1 cells [18,21]. This led us to investigate the role of Inp1p in H. polymorpha. First, an INP1 deletion (inp1) strain was constructed. A tblastn search using the primary sequence of S. cerevisiae Inp1p as a query identified a single H. polymorpha INP1 candidate in the H. polymorpha genome [19]. The H. polymorpha INP1 gene product consists of 405 amino acids with a calculated mass of approximately 45 kDa that is similar to S. cerevisiae Inp1p (19% iden- tity). The nucleotide sequence of this gene has been deposited in GenBank (accession number FJ481644). Analysis of GFP–SKL-producing inp1 cells grown on glucose revealed that the organelles migrated into the buds, leaving the mother cells devoid of peroxisomes at late stages of the budding process, similarly to pex11 cells (Fig. 4A). Subsequently, peroxisome inheritance was quantified as detailed for pex11 cells. The data pre- sented in Fig. 4B show that in inp1 cells a significant percentage of the budding cells lacked peroxisomes in the mother cells under conditions in which wild-type cells displayed normal distribution patterns. The observed inheritance phenotype for pex11 and inp1 are strikingly similar (compare Figs 2C and 4B). To investigate whether the H. polymorpha pex11 phe- notype is related to improper association of Inp1p with peroxisomes, we constructed a pex11 strain producing Inp1–GFP from the homologous INP1 promoter in conjunction with DsRed–SKL to mark peroxisomes. Fluorescence microscopy revealed that Inp1–GFP colo- calizes with peroxisomes both in pex11 and in wild-type control cells (Fig. 4C) under conditions in which the protein is present at wild-type levels (Fig. 4D). This indicates that Pex11p is not essential to recruit Inp1p to the peroxisomal membrane. We also studied Inp1–GFP distribution in vivo in pex11 cells by time-lapse imaging, using wild-type cells as control. These studies indicated that in the wild-type control cells, Inp1–GFP fluorescence is often below the A B Fig. 3. Peroxisome retention is disturbed in pex11. Selected images were taken from time-lapse series of budding cells, using GFP–SKL to mark peroxisomes. In wild-type cells, the organelle divides prior to budding (20 min) and the newly formed smaller peroxisome migrates into the bud (22 min) (A) (Video S1). In pex11 cells, peroxisomes migrate into the daughter cell at an early stage of bud formation, leaving the mother cell devoid of these structures (B) (Video S2). The bar represents 2 lm. A role of Pex11 in peroxisome retention in yeast A. M. Krikken et al. 1432 FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS A C B D Fig. 4. The phenotype of H. polymorpha inp1 and the localization of Inp1–GFP in wild-type (WT) and pex11 cells. Cells producing GFP–SKL to mark peroxisomes were grown on glucose. Analysis of Z-stacks recorded by confocal laser scanning microscopy revealed that in inp1 cells, peroxisomes are predominantly present in the daughter cells (A). Quantification of Z-stacks for the presence or absence of peroxi- somes in the mother and daughter cell was carried out in budding cells. For each sample, peroxisomes were counted from 2 · 100 cells from two independent experiments. The bar represents the standard error of the mean (B). Fluorescence microscopy showed that in bud- ding wild-type cells, Inp1–GFP colocalized with DsRed–SKL peroxisomes (C, upper panel). In pex11 cells, Inp1–GFP is still present in peroxi- somes (C, lower panel). The bar in (A) represents 5 lm, and that in (C) 2 lm. (D) shows a western blot, prepared from crude extracts of glucose-grown pex11 and wild-type control cells, producing Inp1–GFP. The blots, decorated with antibodies against GFP, show that the Inp1–GFP levels in pex11 cells and wild-type cells are comparable. Equal amounts of protein are loaded per lane. A B Fig. 5. Inp1p localization changes during cell budding. Selected images were taken of time-lapse series of wild-type cells producing Inp1–GFP from the endogenous INP1 promoter. In wild-type cells (A), the levels of peroxisome-associated Inp1–GFP fluorescence intensity vary. At several stages, the levels of Inp1–GFP fluorescence are below the level of detection (0 and 60 min). At the initial stages of budding, fluorescence is markedly increased on the peroxisome to be retained in the mother cell (42 and 120 min). In early budding pex11 cells (B), Inp1–GFP is also localized to peroxisomes (105 min), but the Inp1–GFP-containing organelle is not retained in the mother cell but moves into the young bud (114 min). The bar represents 2 lm. A. M. Krikken et al. A role of Pex11 in peroxisome retention in yeast FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS 1433 limit of detection in nonbudding cells (Fig. 5A; Video S3). As the western blots revealed that the level of Inp–GFP in pex11 cells is somewhat reduced relative to wild-type levels (Fig. 4D), these data are consistent with the view that, as in baker’s yeast [18], increased amounts of Inp1p may be present at certain stages of the cell cycle. Upon initiation of bud forma- tion, Inp1–GFP fluorescence is evident on the peroxisomes that are retained in the mother cells. In pex11 cells, Inp1–GFP is localized to peroxisomes independently of whether they are transported into the bud. In wild-type cells, Inp1–GFP-containing peroxi- somes have never been observed to be transported into the bud; however, at later stages of bud development, Inp1–GFP is again recruited to the organelles (Fig. 5B; Video S4). Discussion Here we report the characterization of the H. polymor- pha PEX11 deletion strain. Pex11p has been identified before in various organ- isms, including yeast, humans, plants and trypano- somes. Pex11p is the first peroxin to be implicated in peroxisome proliferation. Our findings, that peroxi- some abundance in H. polymorpha can be regulated through manipulation of Pex11p levels, are consistent with findings in the other organisms [10–12]. Various functions have been suggested for Pex11p, including a role in deforming membranes, recruiting Fis1p to the peroxisomal membrane, and regulating lipid composi- tion or transport of lipids ⁄ fatty acids [12,14–16,22]. In the current study, we found a novel, unexpected func- tion of Pex11p in organelle retention. This was evident from the finding that in pex11 cells the normal orga- nelle fission process was disturbed. This phenomenon was not observed in H. polymorpha dnm1 or mpp1 cells, which also typically contain single organelles [9,23]. A defect in retention is not unique for H. poly- morpha pex11. S. cerevisiae inp1 cells also have reduced peroxisome numbers and show the same inheritance defect as observed in H. polymorpha pex11 cells. An attractive hypothesis is that peroxisome anchoring is required for peroxisome fission and distri- bution [24]. The S. cerevisiae anchoring protein Inp1p shows interactions with Pex25p, Pex30p and Vps1p. All of these proteins have been shown to play a role in peroxisome fission. Also in H. polymorpha inp1 cells, peroxisome reten- tion is disturbed, which is similar to observations in S. cerevisiae and Y. lipolytica [18,21]. Interestingly, in budding H. polymorpha pex11 cells, Inp1–GFP is normally sorted to peroxisomes. Therefore, Inp1p targeting to H. polymorpha peroxisomes is not depen- dent on Pex11p. The failure in retention may be explained by the fact that the pulling force exerted by the molecular motor Myo2p is stronger than the reten- tion force in the absence of Pex11p. However, the principles of Inp1p dysfunction in the absence of Pex11p are still unknown and require further investiga- tion. Our data also showed that Inp1–GFP localization varied during the cell cycle. This modulation might be important in regulating peroxisome anchoring. Our data are consistent with the view that Inp1p function (but not location) might be dependent on Pex11p. The identification of the cortical anchor to which peroxisomes attach will provide further clues about the molecular mechanism of peroxisome inheritance and fission. Experimental procedures Organisms and growth The H. polymorpha strains used in this study are NCYC495 derivatives (Table 1). The cells were cultivated in batch cultures at 37 °C on YPD (1% yeast extract, 1% peptone and 1% glucose), selective minimal medium con- taining 0.67% Yeast Nitrogen Base without amino acids (DIFCO), or minimal medium [25] using 0.5% glucose or 0.5% methanol as respective carbon sources in the pres- ence of 0.25% ammonium sulfate or 0.25% methylamine as the nitrogen source. When required, amino acids or uracil were added to a final concentration of 30 lgÆmL )1 . For growth on agar plates, the media were supplemented with 2% agar. For selection of zeocin-resistant trans- formants, YPD plates containing 100 lgÆmL )1 zeocin (Invitrogen) were used. For cloning purposes, Escherichia coli DH5a was used. Cells were grown at 37 °C in LB supplemented with kana- mycin (100 lgÆmL )1 ) or ampicillin (100 lgÆmL )1 ). Molecular techniques The plasmids and oligonucleotide primers used in this study are listed in Tables 2 and 3, respectively. Standard recombi- nant techniques were carried out essentially according to Sambrook et al. [26]. Transformation of H. polymorpha cells and site-specific integration were performed as previ- ously described [27]. DNA-modifying enzymes were used as recommended by the suppliers (Roche, Almere, the Nether- lands; Fermentas, St Leon-Rot, Germany). Preparative PCR was performed using pwo polymerase according to the instructions of the supplier (Roche, Almere, the Nether- lands). Oligonucleotides were synthesized by Biolegio (Nijmegen, the Netherlands). DNA sequencing reactions A role of Pex11 in peroxisome retention in yeast A. M. Krikken et al. 1434 FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS were performed at ServiceXS (Leiden, the Netherlands). For DNA sequence analysis, the clone manager 5 pro- gram (Scientific and Educational Software, Durham, USA) was used. blast algorithms [28] were used to screen data- bases at the National Center for Biotechnology Information (Bethesda, MD, USA). The clustal_x program was used to align protein sequences [29]. Construction of an H. polymorpha PEX11 null mutant A PEX11 deletion strain was constructed by replacing the region of PEX11 comprising nucleotides +375 to +749 with an auxotrophic marker. To this end, a deletion con- struct was made using Gateway Technology (Invitrogen, Breda, the Netherlands). Two DNA fragments comprising the regions )13 to +374 and +750 to +1480 of the PEX11 genomic region were obtained by PCR with the primers PEX11-attB4-fw + PEX11-attB1-rev and PEX11- attB2-fw + PEX11-attB3-rev, respectively, using genomic H. polymorpha DNA as a template. The PCR fragments were cloned in the vectors pDONR P4-1R and pDONR P2-P3, respectively. Subsequently, BP recombina- tion resulted in entry vectors pKVK106 and pKVK107. Additionally, a DNA fragment comprising the region )512 to +1042 of the H. polymorpha URA3 gene was obtained Table 2. Plasmids used in this study. GFP, green fluorescent protein; Sc, Saccharomyces cerevisiae. Plasmid Description Reference pDONR P4-1R Gateway vector Invitrogen pDONR P2-P3 Gateway vector Invitrogen pKVK106 pDONR4 P4-1R containing 5¢-region of PEX11 This study pKVK107 pDONR P2-P3 containing 3¢-region of PEX11 This study pBSK URA3 pBluescript II containing H. polymorpha URA3, amp R [23] pDONR221 Gateway vector Invitrogen pENTR221 ⁄ URA3 Gateway vector containing URA3 This study pDEST R4-R1 Gateway destination vector Invitrogen pKVK108 pDEST R4-R3 containing PEX11 deletion cassette This study pFEM35 pHIPX7 containing GFP–SKL; kan R , Sc-Leu2 This study pANL29 pHIPZ4 containing P AOX GFP–SKL; amp R , zeo R [23] pHIPZ4 DsRed–SKL Plasmid containing P AOX DsRed–SKL; amp R , zeo R [34] pHIPZ4 PEX11 Plasmid containing P AOX PEX11; amp R , zeo R This study pHS6A E. coli. ⁄ H. polymorpha shuttle vector; amp R , Sc-Leu2, HARS1 [23] pHS6A PEX11 Plasmid containing PEX11 complementing fragment This study pANL31 Plasmid containing GFP without start codon; zeo R , amp R [23] pAMK6 pANL31 containing the 3¢-end of the INP1 gene fused in-frame to GFP; zeo R , amp R This study pAMK15 pHIPX7 containing DsRed–SKL; kan R , Sc-Leu2 This study pHIPX7 Plasmid containing H. polymorpha TEF1 promoter [31] pHIPX7 PEX3 Plasmid containing PEX3 gene; kan R , Sc-Leu2 [31] pBSK URA3 pBluescript SK + containing H. polymorpha URA3 fragment; Amp R [23] pAMK18 pBluescript containing the cassette for the deletion of the INP1 gene This study Table 1. H. polymorpha strains used in this study. GFP, green fluorescent protein. Strain Description Reference WT leu1.1 ura3 NCYC495, leu1.1 ura3 [33] WT leu1.1 NCYC495, leu1.1 [33] WT::P TEF1 GFP–SKL Wild type with integration of plasmid pHIPX7 GFP–SKL This study WT::P AOX PEX11 Wild type with one copy integration of plasmid pSUS0048 This study WT::P INP1 INP1–GFP Wild type with integration of plasmid pAMK6 This study WT::P INP1 INP1–GFP::P TEF1 DsRed–SKL Wild type with integration of plasmids pAMK6 and pHIPX7 DsRed–SKL This study pex11::URA3 PEX11 deletion strain, leu1.1 This study pex11::P TEF1 GFP–SKL pex11 with integration of plasmid pHIPX7 GFP–SKL This study pex11:: P INP1 INP1–GFP pex11 with integration of plasmid pAMK6 This study pex11:: P INP1 INP1–GFP::P TEF1 DsRed–SKL pex11 with integration of plasmids pAMK6 and pHIPX7 DsRed–SKL This study pex11:: pHS6A–PEX11 pHS6A with the entire H. polymorpha PEX11 gene This study inp1::URA3 INP1 deletion strain, leu1.1 This study inp1::P TEF1 GFP–SKL inp1 with integration of plasmid pHIPX7 GFP–SKL This study A. M. Krikken et al. A role of Pex11 in peroxisome retention in yeast FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS 1435 by PCR with the primers Entr221_URA_F and Entr221_URA_R, using plasmid pBSKURA3 [23] as template, and recombined into vector pDONR221, resulting in entry vector pENTR221 ⁄ URA3. Subsequently, LR recombination of plasmids pKVK106, pENTR221 ⁄ URA3 and pKVK107 with the destination vector pDEST R4-R1 resulted in the deletion vector, which was designated pKVK108. Finally, a 2.6 kb PEX11 deletion cassette was obtained by PCR with the primers PEX11-del3.1 + PEX11-del3.2, using pKVK108 as template; this was used to transform H. polymorpha wild-type leu1.1 ura3 cells. Uracil prototrophic transformants were selected. Correct integration was confirmed by PCR with primers PEX11-4.1 and PEX11-4.2, as well as by Southern blot analysis (data not shown). The resulting strain was designated pex11. To enable visualization of peroxisomes in pex11 cells grown on glucose media by fluorescence microscopy, we cloned the GFP–SKL gene behind the constitutive H. poly- morpha TEF1 promoter. For this, a 0.8 kb BamHI–SalI fragment containing GFP–SKL [30] was inserted between the BamHI and SalI sites of vector pHIPX7 [31]. The resulting plasmid, designated pFEM35, was linearized with StuI in the TEF1 region and was used to transform wild- type and pex11 cells. A plasmid containing the entire PEX11 gene (region )614 to +272) was isolated by PCR using primers PEX11 comp-fw and PEX11 comp-rev, with wild-type genomic H. polymorpha DNA as template. The resulting product was digested with BamHI and SphI and cloned between the BamHI and SphI sites of vector pHS6A, resulting in plasmid pHS6A PEX11. Construction of an H. polymorpha Pex11p-overproducing strain For overproduction of Pex11p in wild-type H. polymor- pha, we cloned PEX11 behind the strong inducible promoter of the H. polymorpha AOX gene. A DNA fragment containing the complete PEX11 gene was obtained by PCR using primers PEX11-fw and PEX11- rev. The PCR product was digested with HindIII and SalI, and subsequently ligated in pHIPZ4 DsRed-SKL digested with HindIII and SalI, thereby replacing the DsRed-SKL gene. The resulting plasmid was designated pHIPZ4 PEX11. Subsequently, pHIPZ4 PEX11 was linearized with SphI and was used to transform H. polymorpha wild-type cells. Proper integration was tested by PCR using primers AOX- detect-F and PEX11-rev and by southern blotting (data not shown). A strain containing a single copy of the expression cassette was selected for further studies. Table 3. Primers used in this study. Primer Sequence (5¢-to3¢) PEX11-attB4-fw GGGGACAACTTTGTATAGAAAAGTTGCAGACAGTTATCCAAGGTTTGCGACACG PEX11-attB1-rev GGGGACTGCTTTTTTGTACAAACTTGCGCAGCAATCCTAGCAACTTG PEX11-attB2-fw GGGGACAGCTTTCTTGTACAAAGTGGCACTAGCACGACCGAGTCTTC PEX11-attB3-rev GGGGACAACTTTGTATAATAAAGTTGGGTCGGTAGTCTAGTGGTATG Entr221_URA_F GGGGACAAGTTTGTACAAAAAAGCAGGCTGAGCTTCAACTGATGTTCAGC Entr221_URA_R GGGGACCACTTTGTACAAGAAAGCTGGGTCGAAGCACATCAACTGGATCG PEX11-del3.1 CAGACAGTTATCCAAGGTTTGCG PEX11-del3.2 GGTCGGTAGTCTAGTGGTATG PEX11–4.1 GTCCAATCCGCGTTCTCCTC PEX11–4.2 GCGACTGATTCGGCAAGATG INP1GFP fw CCCAAGCTTGGGCTATGTGAGGTATTGGGC INP1GFP rev GGAAGATCTCCACCCAAACACTCGCGTGC EMK2 GTGCAGATGAACTTCAGGGTCAGCTTG INP1GFP int GTACCCACACAAACAATAACG PEX11-fw ATACTGAAGCTTATGGTTTGCGACACGATAAC PEX11-rev ACATTGGTCGACTCATAGCACAGAAGACTCGG AOX-detect-F CACCAGCGGATCTTCCTGG PEX11 comp-fw CGGGATCCCGTTGAACCCGATCGACAGG PEX11 comp-rev GTACATGCATGCCGATGTGCTCATTATGAGCG Inp1-1 CCGCTCGAGGGTAAGCCATCCGAGTTTGG Inp1–2 CCAATGCATTGGTTCTGCAGCGACCGTCGCACTATGTCC Inp1–3 AGATCTTCCACGAGGAGGACAAAGACGAC Inp1–4 TTTTCCTTTTGCGGCCGCCCATGTTGCGTAGTTCTTCC Inp1 del forward GTGTCTGGTAGCTCATTCTGG Inp1 del reverse GCGTGCCTCGTTGTTGAGCC Ura3 forward ACGCCGATCCAGTTGATGTG Inp1 reverse CCATGTTGCGTAGTTCTTCC A role of Pex11 in peroxisome retention in yeast A. M. Krikken et al. 1436 FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS Construction of an H. polymorpha INP1 null mutant An INP1 deletion strain (inp1) was made by replacing the genomic region of INP1 by the auxotrophic marker URA3. To this end, a deletion cassette was constructed as follows. First, two DNA fragments comprising the regions )344 to +197 and +910 to +1515 of the INP1 genomic region were obtained by PCR, using primers Inp1-1 + Inp1-2 and Inp1-3 + Inp1-4, respectively. After digestion with XhoI+PstI and NotI+BglII, respectively, the resulting fragments were inserted upstream and downstream of the H. polymorpha URA3 gene in pBSKURA3. From the resulting plasmid, named pAMK18, a deletion fragment was obtained by PCR using primers Inp1 del for- ward + Inp1 del reverse and transformed to H. polymor- pha NCYC495 leu1.1 ura3. Uracil prototrophic transformants were selected. Correct integration was con- firmed by PCR with primers Ura3 forward and Inp1 reverse as well as by Southern blot analysis (data not shown). The resulting strain was designated inp1. To visual- ize peroxisomes in glucose-grown inp1 cells, SphI-linearized pFEM35 was transformed and leucine-resistant colonies were selected for further analysis. Construction of an H. polymorpha strain expressing Inp1–GFP To enable Inp1p localization in H. polymorpha wild-type and pex11 cells, an in-frame fusion was constructed of the C-ter- minus of the INP1 gene with the GFP gene, under the control of its homologous INP1 promoter. The INP1 gene was amplified using primers Inp1GFP fw and Inp1GFP rev, resulting in a product lacking the stop codon. This PCR product was then digested with BglII and HindIII and ligated in pANL31 [23], resulting in plasmid pAMK6. Plasmid pAMK6 was linearized with NruI and integrated into H. polymorpha wild-type and pex11 cells. Proper integration was tested by PCR using primers EMK2 and Inp1GFP int and by Southern blotting (data not shown). To identify peroxisomes in glucose-grown cells, the plas- mid pHIPZ4 DsRed–SKL was digested with BamHI and SalI. The obtained DsRed–SKL fragment was subsequently ligated in pHIPX7 PEX3 [31] digested with BamHI and SalI, resulting in plasmid pAMK15. Plasmid pAMK15 was linearized with DraI and integrated into pex11::P INP1 INP1– GFP and WT::P INP1 INP1–GFP. Biochemical methods SDS ⁄ PAGE and western blotting were performed by estab- lished methods. Equal amounts of protein were loaded per lane. Blots were decorated using monoclonal GFP anti- bodies (B-2; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), using the BM chemiluminescence western blot- ting kit (Roche Diagnostics GmbH, Mannheim, Germany). Microscopy Wide-field fluorescence imaging was performed using a Zeiss Axioskop50 fluorescence microscope (Carl Zeiss, Oberkochen, Germany). Images were taken with a Prince- ton Instruments 1300Y digital camera. GFP signal was visualized with a 470 ⁄ 40 nm bandpass exci- tation filter, a 495 nm dichromatic mirror, and a 525 ⁄ 50 nm bandpass emission filter. DsRed fluorescence was visualized with a 546 ⁄ 12 nm bandpass excitation filter, a 560 nm dichro- matic mirror, and a 575–640 nm bandpass emission filter. Confocal imaging was performed on a Zeiss LSM510 con- focal microscope, using Hamamatsu photomultiplier tubes. GFP signal was visualized by excitation with a 488 nm argon laser (Lasos), and emission was detected using a 500–550 nm bandpass emission filter. The DsRed signal was visualized by excitation with a 543 nm helium neon laser (Lasos), and emission was detected using a 565–615 nm bandpass emis- sion filter. For live cell imaging, the temperature of the objec- tive and the object slide was kept at 37 °C. Six Z-axis planes were acquired for each time interval to ensure that no fluores- cent structures were missed. Image analysis was carried out using imagej (http://rsb.info.nih.gov/nih-image/) and ⁄ or Zeiss lsm image browser. Whole cells were fixed and prepared for electron micros- copy as described previously [32]. Quantification of peroxisomes For quantification, cells were grown until A 663 = 1.0 on mineral media containing glucose, and subsequently fixed using 1% formaldehyde in 10 mm potassium phosphate buffer (pH 7.5) for 1 h. To quantify peroxisome inheri- tance, random pictures of budding cells were taken as a stack in both bright field and fluorescence mode. Z-stacks were made containing 17 optical slices of 0.9 lm thickness to cover the entire cell. The Z-axis spacing was 0.5 lm, to ensure that no fluorescent signals were missed. Using the Zeiss lsm image browser software, the cross- sectional area of the mother and bud cell was determined. Assuming yeast cells to be spherical, the bud volume was determined as percentage of that of the mother cell, tenta- tively set to 100%. Only cells for which the bud volume was < 25% of the mother cell volume were counted. Quantification experiments were performed using two inde- pendent cell cultures (100 cells per culture). Acknowledgements We thank Rhein Biotech GmbH, Du ¨ sseldorf, Germany, for access to the H. polymorpha genome database. We A. M. Krikken et al. A role of Pex11 in peroxisome retention in yeast FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS 1437 thank S. Fekken and K. Kuravi for assistance in pre- paring plasmids and strains. R. Booij is acknowledged for excellent electron microscopy support. References 1 van der Klei IJ & Veenhuis M (2006) Yeast and fila- mentous fungi as model organisms in microbody research. Biochim Biophys Acta 1763, 1364–1373. 2 Wanders RJ & Waterham HR (2005) Peroxisomal disorders I: biochemistry and genetics of peroxisome biogenesis disorders. Clin Genet 67, 107–133. 3 Lazarow PB & Fujiki Y (1985) Biogenesis of peroxi- somes. Annu Rev Cell Biol 1, 489–530. 4 Hoepfner D, Schildknegt D, Braakman I, Philippsen P & Tabak HF (2005) Contribution of the endoplasmic reticulum to peroxisome formation. Cell 122, 85–95. 5 Kragt A, Voorn-Brouwer T, van den Berg M & Distel B (2005) Endoplasmic reticulum-directed Pex3p routes to peroxisomes and restores peroxisome formation in a Saccharomyces cerevisiae pex3Delta strain. J Biol Chem 280, 34350–34357. 6 Tam YY, Fagarasanu A, Fagarasanu M & Rachubinski RA (2005) Pex3p initiates the formation of a preperox- isomal compartment from a subdomain of the endo- plasmic reticulum in Saccharomyces cerevisiae. J Biol Chem 280, 34933–34939. 7 Haan GJ, Baerends RJ, Krikken AM, Otzen M, Veenhuis M & van der Klei IJ (2006) Reassembly of peroxisomes in Hansenula polymorpha pex3 cells on reintroduction of Pex3p involves the nuclear envelope. FEMS Yeast Res 6, 186–194. 8 Motley AM & Hettema EH (2007) Yeast peroxisomes multiply by growth and division. J Cell Biol 178 , 399– 410. 9 Nagotu S, Saraya R, Otzen M, Veenhuis M & van der Klei IJ (2008) Peroxisome proliferation in Hansenula polymorpha requires Dnm1p which mediates fission but not de novo formation. Biochim Biophys Acta 1783, 760–769. 10 Erdmann R & Blobel G (1995) Giant peroxisomes in oleic acid-induced Saccharomyces cerevisiae lacking the peroxisomal membrane protein Pmp27p. J Cell Biol 128, 509–523. 11 Marshall PA, Krimkevich YI, Lark RH, Dyer JM, Veenhuis M & Goodman JM (1995) Pmp27 promotes peroxisomal proliferation. J Cell Biol 129, 345–355. 12 Sakai Y, Marshall PA, Saiganji A, Takabe K, Saiki H, Kato N & Goodman JM (1995) The Candida boidinii peroxisomal membrane protein Pmp30 has a role in peroxisomal proliferation and is functionally homolo- gous to Pmp27 from Saccharomyces cerevisiae. J Bacte- riol 177, 6773–6781. 13 Kiel JA, van der Klei IJ, van den Berg MA, Bovenberg RA & Veenhuis M (2005) Overproduction of a single protein, Pc-Pex11p, results in 2-fold enhanced penicillin production by Penicillium chrysogenum. Fungal Genet Biol 42, 154–164. 14 Lorenz P, Maier AG, Baumgart E, Erdmann R & Clay- ton C (1998) Elongation and clustering of glycosomes in Trypanosoma brucei overexpressing the glycosomal Pex11p. EMBO J 17, 3542–3555. 15 Marshall PA, Dyer JM, Quick ME & Goodman JM (1996) Redox-sensitive homodimerization of Pex11p: a proposed mechanism to regulate peroxisomal division. J Cell Biol 135 , 123–137. 16 van Roermund CW, Tabak HF, van Den Berg M, Wanders RJ & Hettema EH (2000) Pex11p plays a pri- mary role in medium-chain fatty acid oxidation, a pro- cess that affects peroxisome number and size in Saccharomyces cerevisiae. J Cell Biol 150, 489–498. 17 Li X & Gould SJ (2002) PEX11 promotes peroxisome division independently of peroxisome metabolism. J Cell Biol 156, 643–651. 18 Fagarasanu M, Fagarasanu A, Tam YY, Aitchison JD & Rachubinski RA (2005) Inp1p is a peroxisomal mem- brane protein required for peroxisome inheritance in Saccharomyces cerevisiae. J Cell Biol 169, 765–775. 19 Ramezani-Rad M, Hollenberg CP, Lauber J, Wedler H, Griess E, Wagner C, Albermann K, Hani J, Piontek M, Dahlems U et al. (2003) The Hansenula polymorpha (strain CBS4732) genome sequencing and analysis. FEMS Yeast Res 4, 207–215. 20 Veenhuis M, Keizer I & Harder W (1979) Characteriza- tion of peroxisomes in glucose-grown Hansenula poly- morpha and their development after the transfer of cells into methanol-containing media. Arch Microbiol 120, 167–175. 21 Chang J, Fagarasanu A & Rachubinski RA (2007) Per- oxisomal peripheral membrane protein YlInp1p is required for peroxisome inheritance and influences the dimorphic transition in the yeast Yarrowia lipolytica. Eukaryot Cell 6, 1528–1537. 22 Kobayashi S, Tanaka A & Fujiki Y (2007) Fis1, DLP1, and Pex11p coordinately regulate peroxisome morpho- genesis. Exp Cell Res 313, 1675–1686. 23 Leao-Helder AN, Krikken AM, van der Klei IJ, Kiel JA & Veenhuis M (2003) Transcriptional down-regula- tion of peroxisome numbers affects selective peroxisome degradation in Hansenula polymorpha. J Biol Chem 278, 40749–40756. 24 Fagarasanu M, Fagarasanu A & Rachubinski RA (2006) Sharing the wealth: peroxisome inheritance in budding yeast. Biochim Biophys Acta 1763, 1669– 1677. 25 van Dijken JP, Otto R & Harder W (1976) Growth of Hansenula polymorpha in a methanol-limited chemostat. Physiological responses due to the involvement of meth- anol oxidase as a key enzyme in methanol metabolism. Arch Microbiol 111, 137–144. A role of Pex11 in peroxisome retention in yeast A. M. Krikken et al. 1438 FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS [...]... 92–100 Supporting information The following supplementary material is available: Video S1 Time-lapse imaging of peroxisomes in H polymorpha wild-type cells growing in the presence of glucose Video S2 Time-lapse imaging of peroxisomes in H polymorpha pex11 cells growing in the presence of glucose Video S3 Time-lapse imaging of peroxisomes in H polymorpha wild-type cells producing Inp1–GFP growing in the presence... carboxy- and amino-terminal targeting signals J Cell Biol 127, 737–749 A role of Pex11 in peroxisome retention in yeast 33 Gleeson MA & Sudbery PE (1988) Genetic analysis in the methylotropic yeast Hansenula polymorpha Yeast 4, 293–303 34 Monastyrska I, Kiel JA, Krikken AM, Komduur JA, Veenhuis M & van der Klei IJ (2005) The Hansenula polymorpha ATG25 gene encodes a novel coiled-coil protein that is required... affect normal peroxisome formation in Hansenula polymorpha: a sharp increase of the protein level induces the proliferation of numerous, small protein-import competent peroxisomes Yeast 13, 1449–1463 32 Waterham HR, Titorenko VI, Haima P, Cregg JM, Harder W & Veenhuis M (1994) The Hansenula polymorpha PER1 gene is essential for peroxisome biogenesis and encodes a peroxisomal matrix protein with both... Time-lapse imaging of H polymorpha pex11 cells producing Inp1–GFP growing in the presence of glucose This supplementary material can be found in the online version of this article Please note: Wiley-Blackwell is not responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author... 25, 3389–3402 29 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F & Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools Nucleic Acids Res 25, 4876–4882 30 Ozimek P, Lahtchev K, Kiel JA, Veenhuis M & van der Klei IJ (2004) Hansenula polymorpha Swi1p and Snf2p are essential for methanol utilisation FEMS Yeast Res 4, 673–682... Molecular Cloning: A Laboratory Manual, 2nd edn Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 27 Faber KN, Haima P, Harder W, Veenhuis M & Ab G (1994) Highly-efficient electrotransformation of the yeast Hansenula polymorpha Curr Genet 25, 305– 310 28 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database . wild-type cells producing Inp1–GFP growing in the presence of glucose. Video S4. Time-lapse imaging of H. polymorpha pex11 cells producing Inp1–GFP growing in. Time-lapse imaging of peroxisomes in H. polymorpha pex11 cells growing in the presence of glucose. Video S3. Time-lapse imaging of peroxisomes in H. polymorpha