Intrinsic disorder and coiled-coil formation in prostate apoptosis response factor David S Libich1,*, Martin Schwalbe1,*, Sachin Kate1, Hariprasad Venugopal1, Jolyon K Claridge1, Patrick J B Edwards1, Kaushik Dutta2 and Steven M Pascal1 Centre for Structural Biology, Institute of Fundamental Sciences and Department of Physics, Massey University, Palmerston North, New Zealand New York Structural Biology Centre, NY, USA Keywords circular dichroism; coiled-coil; intrinsically disordered protein; prostate apoptosis response factor 4; solution NMR spectroscopy Correspondence D S Libich or S M Pascal, Institute of Fundamental Sciences, Massey University, Turitea Site, Private Bag 11222, Palmerston North 4442, New Zealand Fax: +64 350 5682 Tel: +64 356 9099 E-mails: d.s.libich@massey.ac.nz; s.pascal@massey.ac.nz *These authors contributed equally to this work (Received 24 March 2009, accepted May 2009) Prostate apoptosis response factor-4 (Par-4) is an ubiquitously expressed pro-apoptotic and tumour suppressive protein that can both activate celldeath mechanisms and inhibit pro-survival factors Par-4 contains a highly conserved coiled-coil region that serves as the primary recognition domain for a large number of binding partners Par-4 is also tightly regulated by the aforementioned binding partners and by post-translational modifications Biophysical data obtained in the present study indicate that Par-4 primarily comprises an intrinsically disordered protein Bioinformatic analysis of the highly conserved Par-4 reveals low sequence complexity and enrichment in polar and charged amino acids The high proteolytic susceptibility and an increased hydrodynamic radius are consistent with a largely extended structure in solution Spectroscopic measurements using CD and NMR also reveal characteristic features of intrinsic disorder Under physiological conditions, the data obtained show that Par-4 self-associates via the C-terminal domain, forming a coiled-coil Interruption of self-association by urea also resulted in loss of secondary structure These results are consistent with the stabilization of the coiled-coil motif through an intramolecular association doi:10.1111/j.1742-4658.2009.07087.x Introduction Prostate apoptosis response factor-4 (Par-4) is an ubiquitously expressed and evolutionary conserved protein that was initially identified as a pro-apoptotic factor in rat AT-3 androgen-independent prostate cancer cells exposed to ionomycin [1,2] The identified pro-apoptotic and tumour-suppressive roles of Par-4 are considered to be its most important cellular functions and, accordingly, Par-4 is downregulated in various cancers [3] The anti-cancer strategy employed by Par-4 is achieved by direct activation of the cell-death machinery (e.g Fas ⁄ FasL) [4] and inhibition of pro-survival factors (e.g nuclear factor-kappa B) [5] Furthermore, ectopic over-expression of Par-4 can either directly induce apoptosis or sensitize cancer cells to apoptotic stimuli, dependent on cell type [6] Primarily a cytoplasmic protein, translocation of Par-4 to the nucleus is linked with the direct induction of apoptosis in cancer cells [3,7,8] Initially characterized in prostate cancer, Par-4 has also been demonstrated to function in renal cell carcinomas [9], leukaemia [10] and Abbreviations CREB, cAMP-responsive element-binding protein; DLS, dynamic light scattering; GST, glutathione S-transferase; HSQC, heteronuclear single quantum coherence; IDP, intrinsically disordered protein; IPTG, isopropyl thio-b-D-galactoside; LZ, leucine zipper; NLS, nuclear localization sequence; Par-4, prostate apoptosis response factor 4; PK, protein kinase; SAC, selective apoptosis of cancer cells 3710 FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS D S Libich et al neuroblastomas [11], as well as endometrial [12], pancreatic [13] and gastric [8] cancers In addition to its role in cancer, Par-4 is thought to assist in normal neuronal development by preventing the hyper-proliferation of nerve tissues, in turn controlling the number of neurones and glial cells in both the peripheral and central nervous systems [14,15] Par-4 is upregulated in several neurodegenerative diseases, such as Alzheimer’s disease [16,17], Parkinson’s disease [18], Huntington’s disease [19] and amyotrophic lateral sclerosis [20] Par-4 is also reportedly involved in immune response modulation [21], synaptic function modulation [22] and apoptosis of neurones that have received a traumatic insult [23] The C-terminal quarter of Par-4 (Fig 1) is highly conserved and shares some homology with the death domains of other apoptotic proteins, such as Fas, receptor-interacting protein, Fas-associated death domain protein and tumour necrosis factor receptorassociated death domain protein [24,25] This region functions as the primary recognition and binding site for various partners of Par-4, including Wilms’ tumour [7], Akt1 ⁄ protein kinase (PK) B [26], atypical PKCs (PKCs f and k ⁄ i) [24], p62 [27], death-associated protein-like ⁄ zipper interacting kinase [28], THAP [29], Amida [30], E2F1 [31], D2 dopamine receptor [32], b-site amyloid precursor protein cleaving enzyme [17], apoptosis-antagonizing transcription factor [33] and topoisomerase [34] In addition, several binding partners have been shown to interact at various sites N-terminal to the aforementioned C-terminal segment, including the androgen receptor [35], F-actin [36], 14-3-3 [26] and the SPRY domain-containing suppressor of cytokine signalling box proteins 1, and [37] Par-4 contains several conserved phosphorylation sites that are modified by kinases, such as PKA, PKC, casein kinase II and Akt1, adding a further level of regulation of the function of Par-4 [38] Phosphorylation of an absolutely conserved threonine (rat T155, human T163 or mouse T156; Fig 1) by PKA is required for nuclear translocation [8] Phosphorylation of a C-terminal serine residue (rat S249, human or mouse S231; Fig 1) by Akt1 effectively inactivates Par-4 by allowing the chaperone protein 14-3-3 to bind and sequester it in the cytoplasm, even if it is phosphorylated on T155 [26] These multiple interactions coupled with a high degree of sequence conservation and post-translational modification suggest that the in vivo role(s) of Par-4 are highly temporally and spatially regulated Similarly, the ubiquitous expression, post-translational modifications and a plethora of binding partners are characteristics common to many intrinsically disor- Intrinsic disorder in Par-4 dered proteins (IDPs) [39] In the present study, we demonstrate that residual structure exists in Par-4 because the measured hydrodynamic radius increased under denaturing conditions, suggesting that the ensemble becomes less compact CD and NMR indicate that Par-4 is primarily intrinsically disordered under physiological conditions and exists as an ensemble of fast-averaging (on the NMR time-scale) structures Furthermore, Par-4 forms a stable coiled-coil through a self-association event mediated by the C-terminus The coiled-coil was probed using increasing concentrations of chaotropic agents and was found to be very stable Using NMR, the segment of Par-4 not involved in the coiled-coil was shown to have spectral features that were similar to those of a C-terminal deletion mutant This is important because it suggests that Par-4 is able to bind more than one partner at a time and thus could function as a hub linking the functions of several proteins The coiled-coil region of Par-4 represents an important functional domain that is an example of a gain of structure upon binding transition, which is another important feature of IDPs [40] Results All sequence numbering is made with reference to rat Par-4, to reflect the recombinant rat (rrPar-4) constructs used in these studies Three constructs were created; rrPar-4FL (Par-4 full-length, residues 1–332), rrPar4DLZ (deleted leucine zipper, residues 1–290) and rrPar4SAC [selective apoptosis of cancer cells (SAC) domain construct, residues 137–195] (Fig 2A) The sequence identity expressed relative to rat Par-4 of mouse and human is 92% and 76%, respectively, whereas African clawed frog and zebra fish share 52% and 47% sequence identity with rat, respectively (Fig 1) The nuclear localization sequences (NLS) (residues 20–25) and (residues 137–153) are strictly conserved in all known Par-4 sequences (Fig 1) The SAC domain, which includes NLS2, is the minimum fragment of Par-4 that is absolutely required for apoptosis [6] and is completely conserved amongst mammals (Fig 1) Furthermore, there is a high degree of sequence conservation in the C-terminal quarter of Par4, which contains primarily a coiled-coil-like sequence (residues 254–332; Figs and 2A) In particular, a leucine zipper (residues 292–330), which is a subset of the coiled-coil domain, is almost conserved in all known Par-4 sequences, suggesting a common functionality (Figs and 2A) Relatively few Par-4 genes have been sequenced It has been suggested that the general pattern of sequence conservation shown in Fig is likely to be conserved across other mammalian sequences [1] FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS 3711 Intrinsic disorder in Par-4 D S Libich et al Fig Sequence alignment of the prostate apoptosis response factor (Par-4) A BLASTP ⁄ CLUSTALW [102,103] alignment of sequences of Par-4 from various species: rat (Rattus norvegicus), mouse (Mus musculus), human (Homo sapiens), African clawed frog (Xenopus laevis) and zebra fish (Danio rero) The amino acids are coloured: red (nonpolar side chains: G, A, V, L, I, M, P, F and W), blue (polar side chains: S, T, N, Q, Y and C) and green (polar, charged side chains: K, R, H, D and E) Symbols: residues in that column are identical in all sequences (*); substitutions are conservative (:); and substitutions are semi-conservative (.) The high degree of sequence conservation of Par-4 suggests functional significance and thus resistance to evolutionary pressure With reference to the numbering of rat Par-4, several segments are of notable interest: two nuclear localization sequences [NLS1 (20–25) and (137–153)], which are completely conserved among all known Par-4s, and the SAC domain (137–195), which is defined by being the absolute minimum fragment required for apoptosis and includes NLS2 [6] The C-terminal domain (254–332) is a coiled-coil (CC) motif that encompasses a LZ (292–330) as a subset Two important phosphorylation sites, T155 and S249, are denoted by red arrows Based on disembl analysis [41], the majority (> 70%) of Par-4 is predicted to be disordered The putative regions of order in Par-4, as indicated by grey bars in a 3712 disembl plot (Fig 2B), align with or occur within functionally important regions of Par-4 (Fig 2A), namely NLS1, NLS2, SAC and the coiled-coil Secondary FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS D S Libich et al Intrinsic disorder in Par-4 Fig (A) A block diagram of the three constructs of rrPar-4 used in the present study Marked on each construct are the primary regions of functional importance, including the nuclear localization sequences [NLS1 (20–25) and (137–153), coloured green], the region necessary for SAC (137–195), the coiled-coil C-terminal domain (CC, 254-332, coloured red) and the LZ (292–330, shown with hatching) The rrPar4DLZ construct lacks residues 291–332, which is approximately one-half of the coiled-coil and the entire leucine zipper The rrPar-4SAC construct represents residues 137–195 of Par-4, including NLS2 All three constructs used in the present study have an N-terminal GGS tag, a remnant from the cleavage of the purification tag, which is omitted here for simplicity (B) DISEMBL predicts regions of order ⁄ disorder in proteins using neural networks trained on multiple definitions of disorder [41] The dashed line in (B) represents a threshold value separating order and disorder (C) Secondary structure (a-helix only shown) prediction using GOR4 [42] and (D) hydrophobic cluster analysis (HCA) [43], a visually enhanced representation of the primary sequence that highlights clustering of hydrophobic residues using symbols ( , T; , S; Ô, G; w, P) and colours (red: P and acidic residues D, E, N, Q; blue: basic residues, H, K, R; green: hydrophobic residues, V, L, I, F, W, M, Y; black: all other residues, G, S, T, C, A) The grey bars indicate the predicted regions of order in (B) and, for comparison, are extended over (C) and (D) structure prediction using gor4 [42] shows that the regions with the highest helical propensity also occur in the aforementioned regions and align with the disembl predicted ordered regions (Fig 2C) The hydrophobic cluster analysis [43] of Fig 2D indicates that the most hydrophobic regions align with the putative ordered and predicted helical regions A plot of mean net charge against mean hydrophobicity determined from a protein’s primary structure may be used to classify it as folded or intrinsically disordered Plot space is divided by an empirically deter  mined line (R ¼ 2:785H À 1:151) based on an analysis by Uversky et al [44] The three constructs used in this study are plotted in Fig 3A along with several ‘classically folded’ proteins Here, rrPar-4FL, rrPar-4DLZ and rrPar-4SAC clearly fall into disordered space generally characterized by low mean hydrophobicity and high net charge The construct representing the SAC domain (rrPar-4SAC), with 14 positively charged and 13 negatively charged residues but few hydrophobic residues, lies further in the disordered region Figure 3B describes the sequence complexity of rrPar-4FL by comparison with the percent difference between the amino acid usage of a set of known IDPs FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS 3713 Intrinsic disorder in Par-4 D S Libich et al Table Hydrodynamic properties of rrPar-4 constructs using vari˚ ous biophysical techniques MW (kDa) and hydrodynamic radius (A) are shown in the format MW (RS) for three constructs using four techniques RS and MW were calculated from the primary structure in reference to a folded conformation using log(RS) = 0.357 · log(MW) ) 0.204 Method of analysis Construct divisor between intrinsically disordered (high charge, low hydrophobicity) and structured (low charge, high hydrophobicity) space Proteins such as aprotinin [104], actin [105], ubiquitin [106] and 3C protease [107] are plotted as examples of classically folded proteins (B) Sequence complexity of rrPar-4FL (grey bars) compared with the average amino acid distribution of IDPs (black bars) relative to the average amino acid distribution of globular proteins The relative distributions were sampled from proteins (both IDPs and folded) deposited in the Protein Data Bank Positive and negative values indicate an enrichment or depletion, respectively, of a particular residue relative to globular proteins Residues marked with an asterisk occur two-fold more or less frequently, on average, in IDPs than in globular proteins [46] versus a set of folded proteins (black bars) Positive values indicate a depletion, whereas negative bars indicate an enrichment relative to folded proteins The pattern of amino acid usage for rrPar-4FL (grey bars) is in accordance with that generally observed for IDPs [45,46], namely a depletion of order-promoting amino acids (L, N, F, Y, I, W, C) and enrichment of disorder-promoting residues (S, Q, K, P, E) The amino 3714 MS PAGE DLS rrPar-4FL rrPar-4-DLZ rrPar-4 SAC Fig (A) Charge ⁄ hydrophobicity plot of rrPar-4FL (335 residues), rrPar-4DLZ (293 residues), and rrPar-4SAC (61 residues) The divid  ing line R ¼ 2:785H À 1:151 represents an empirically determined Sequence 36.1 (26.5) 31.1 (25.1) 7.0 (14.8) 36.2 (26.5) 31.2 (25.1) 7.1 (14.8) 49.5 (29.6) 41.5 (27.8) 12.5 (18.1) 8899 (189) 64.1 (32.5) 18.7 (20.9) acid usage for rrPar-4DLZ and rrPar-4SAC follows a similar pattern (not shown) As calculated (i.e from sequence) and experimentally determined [i.e from MS, Tricine-PAGE and dynamic light scattering (DLS)], the molecular weights for rrPar-4FL, rrPar-4DLZ and rrPar-4SAC are given in Table Because DLS measures the Stokes radius (RS) of a particle, the equation log(RS) = 0.357 · log(MW) ) 0.204 was used to convert RS to MW for comparative purposes [47,48] Although this approximate calculation does not take into account the shape of the particle (i.e it assumes a sphere), the result is useful for illustrating the degree of extended structure in the protein The primary structure predicts MWs of 36.1, 31.1 and 7.0 kDa for rrPar-4FL, rrPar-4DLZ and rrPar-4SAC, respectively MALDI-TOF mass spectroscopy was used to assess the purity and determine the sizes of the constructs produced The sizes determined for rrPar-4DLZ (44.5 Da difference between expected and observed) and rrPar-4SAC (6.6 Da difference between expected and observed after accounting for 15N labelling of the sample used for MS analysis) agree within error (approximately 0.1%) with the sizes predicted from sequence analysis (Table 1) MS revealed that the rrPar-4FL construct is approximately 0.2 kDa larger than expected Relative mobility analysis of the electrophoretic profiles of rrPar-4FL, rrPar-4DLZ and rrPar-4SAC using a denaturing Tricine-PAGE system (see Experimental procedures) determined apparent molecular weights of 49.1, 41.5 and 12.4 kDa, respectively These sizes are significantly larger (36%, 33% and 77% larger for rrPar-4FL, rrPar-4DLZ and rrPar-4SAC, respectively) than the expected MWs determined from the primary structure or MS (Table 1) The results of DLS experiments are shown in Table and summarized in Table The measured RS for ˚ rrPar-4FL was 189 A, which is much larger than expected for a monomeric random coil, suggesting a polymeric state for rrPar-4FL under these conditions FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS D S Libich et al Intrinsic disorder in Par-4 Table Comparison of experimental and theoretical values of Stoke’s radii (RS) Measured RS was recorded in 10 mM Tris (pH 7.0), 20 mM NaCl in the presence or absence of urea Calculated RS was obtained using the mean values from equations given in Uversky [47] for globular (folded) (G), molten globule (MG), pre-molten globule (PMG), random coil (RC) and urea-denatured (U) states ˚ Measured RS (A) Construct MW (kDa) rrPar-4FL rrPar-4DLZ rrPar-4SAC 36.1 31.1 7.0 189 32.5 20.9 M urea ˚ Calculated RS (A) M urea 78.4 43.6 28.1 For comparison, the RS (calculated) for rrPar-4FL as either monomeric globular (i.e folded), molten globule, pre-molten globule, extended chain or urea-denatured states are given in Table The experimentally deter˚ mined RS for rrPar-4DLZ (32.5 A) and rrPar-4SAC ˚ ) are larger than the expected folded RS (25.1 (20.9 A ˚ and 14.8 A, respectively) but still smaller than the calculated random coil RS for either protein (Table 2) This suggests that these constructs exist in an unfolded yet monomeric form under these conditions The volume weighted distributions for rrPar-4FL, rrPar4DLZ and rrPar-4SAC are shown in the Supporting information (Fig S1A) The relatively broad distribution of sizes recorded for all three proteins is consistent with an ensemble of interconverting conformations rather than one single conformation Upon addition of m urea, the measured RS for both rrPar-4DLZ and rrPar-4SAC slightly increases (Table 2; see also Fig S1B,C) Conversely, the introduction of m urea to rrPar-4FL decreases the mea˚ sured RS from 189 to 78.4 A, yet it remains larger than the calculated RS of a random coil protein (Table 2; see also Fig S1A) A classically folded protein is less susceptible to proteolysis than an IDP upon equilateral exposure to a protease such as trypsin because most of its cleavage sites are protected by tertiary folding [49,50] The results of a limited trypsin digest of rrPar-4FL, rrPar4DLZ, rrPar-4SAC and BSA are shown in Fig After 15 of exposure to trypsin rrPar-4DLZ was more than 95% digested, rrPar-4FL and rrPar-4SAC were over 80% digested, whereas BSA was only 10% digested BSA was chosen for comparison because it has a similar percentage of predicted cut sites to that of the Par-4 constructs Figure shows the full range (5 °C steps from 5–75 °C) and a sub-set of four spectra (5, 25, 45 and 65 °C) of a temperature series recorded by CD spectroscopy for rrPar-4FL (Fig 5A,B), rrPar-4DLZ (Fig 5C,D) and rrPar-4SAC (Fig 5E,F) Significant a-helical character in rrPar-4FL is immediately evident and remains stable up to 65 °C (Fig 5A,B) By con- G MG PMG RC U 26.5 25.1 14.8 29.4 28.0 17.1 37.7 35.6 19.9 49.6 46.1 22.2 53.1 49.2 22.7 Fig Limited proteolysis of rrPar-4FL (filled circles), rrPar-4DLZ (open circles), rrPar-4SAC (filled triangles) and BSA (open triangles) The proteins were dissolved in 20 mM NaPO4 (pH 7.5), 50 mM NaCl and exposed to trypsin in a 280 : (w ⁄ w) ratio trast, the CD spectra for rrPar-4DLZ (Fig 5C,D) and rrPar-4SAC (Fig 5E,F) show a typical profile of IDPs with a deep transition at 200 nm [51] Pairwise overlays of 1H-15N heteronuclear single quantum coherence (HSQC) spectra for rrPar-4FL, rrPar-4DLZ and rrPar-4SAC are shown in Fig The spectra of all three proteins display the features that characterize disorder in proteins, namely sharp peaks and narrow 1H chemical shift dispersion [51,52] Chemical shift similarities indicate some structural similarity between rrPar-4FL and rrPar-4DLZ (Fig 6A) Fewer peaks share similar chemical shifts when comparing rrPar-4FL or rrPar-4DLZ with rrPar4SAC (Fig 6B,C) Thus, the majority of residues in rrPar-4SAC experience a different local environment and possibly a different conformation than the SAC domain in the context of either the rrPar-4FL or rrPar-4DLZ constructs Only 160 of the 308 peaks expected (335 – N-terminal residue – 26 prolyl residues) for rrPar-4FL and 152 of the 266 expected peaks (293 – N-terminal residue – 26 prolyl residues) for rrPar-4DLZ are readily picked Conversely, 58 peaks FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS 3715 Intrinsic disorder in Par-4 D S Libich et al Fig Temperature dependence of the CD spectrum of (A, B) rrPar-4FL, (C, D) rrPar-4DLZ and (E, F) rrPar-4SAC Data for all constructs were recorded in 10 mM Tris (pH 7.0), 20 mM NaCl over a temperature range of 5–75 °C Traces for each temperature recorded in the experiment are shown in (A, C, E) For clarity, four equally spaced temperatures from the sampled range are shown in (B, D, F) of the expected 60 (62 – N-terminal residue – one prolyl residue) were readily identifiable for rrPar-4SAC with only two glycyl residues being unobservable To assess the degree of a-helicity in the rrPar-4FL C-terminus, a CD difference spectrum between rrPar4DLZ and rrPar-4FL (25 °C) is shown in Fig 7A This spectrum indicates a well-defined coiled-coil type structure (Fig 7A) The two constructs differ in the deletion of the leucine zipper (Fig 2A); thus, rrPar-4FL forms a stable coiled-coil under these conditions and the majority of the a-helical character observed in rrPar-4FL (Fig 5A,B) may be attributed to this structure The melting temperatures (based on the reduction of the 222 nm transition in CD spectra) for rrPar-4FL 3716 are 75, 55 and 25 °C when dissolved in native buffer, native buffer + m urea or native buffer + m urea, respectively (Fig 7B) The results of the DLS experiments on rrPar-4FL under the same conditions are shown in Fig 7C As the concentration of urea is increased from to m, the effective RS for rrPar-4FL ˚ is reduced from 189 to 58.5 A The latter value is very close to the predicted RS of a random coil of the same molecular weight (for comparison, see Table 2) Discussion The structure-defines-function paradigm of molecular biology is currently under scrutiny because many FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS D S Libich et al Intrinsic disorder in Par-4 Fig Pairwise overlays of 1H-15N HSQC spectra of (A) rrPar-4FL (black contours) and rrPar-4DLZ (blue contours), (B) rrPar-4DLZ (blue contours) and rrPar-4SAC (red contours) and (C) rrPar-4FL (black contours) and rrPar-4SAC (red contours) The compositions of the samples were: rrPar-4FL, 0.48 mM in 10 mM Tris (pH 7.0), 20 mM NaCl, 5% D2O, 15N-rrPar-4DLZ, 0.09 mM in 20 mM NaPO4 (pH 7.5), 100 mM NaCl, mM dithiothreitol, 5% D2O and 15N-rrPar-4SAC, 0.34 mM in 10 mM Tris (pH 7.0), 20 mM NaCl, 5% D2O All spectra were recorded at °C and the processing parameters (see Experimental procedures) were identical for qualitative comparison proteins have been identified that are functional without the need for well-defined secondary or tertiary structure [46,53,54] The occurrence of intrinsic disorder in proteomes is correlated to the complexity of the cell; thus, eukaryotic proteins have a higher proportion of disorder (35–51% of proteins with disordered regions of 40 residues or longer) than proteins from prokaryotes and archaea (6–33%) [55] The prevalence of intrinsic disorder is higher in proteins that are involved in cell signalling, cytoskeletal organization and ribosomal or cancer-related processes [56] Disorder in proteins that control these processes appears to be of functional importance because these events are often tightly controlled and highly dynamic and often become deregulated in cancerous cells [57] Many signalling proteins function in pathways associated with cancer For example, the well-characterized IDP p53 functions as a transcription regulator during the G1 cell cycle phase Critical mutations of p53 lead to loss of its transcriptional control and thus lead to inappropriate survival of damaged or mutated cells [58] Sequence analysis of Par-4 Bioinformatic analysis of rrPar-4FL reveal characteristic features of IDPs, including high net charge, low mean hydrophobicity and low sequence complexity [45,59] Relative to the amino acid usage observed in folded proteins, rrPar-4FL, rrPar-4DLZ and rrPar4SAC are depleted in order-promoting amino acids and enriched in disorder promoting residues (Fig 3B) The lack of hydrophobic residues inhibits the formation of a hydrophobic core and thus the formation of stable tertiary structure (Fig 2D) [46] More than 70% of rrPar-4FL is predicted to be disordered by disembl, providing a strong argument against the formation of stable global tertiary structure (Fig 2B) Hydrophobic cluster analysis is a method of displaying the primary structure such that the clustering of hydrophobic residues and thus regions of possible order become evident [43] The regions of greatest hydrophobic clustering in rrPar-4FL correlate well with the predicted regions of order (Fig 2B) and with the secondary structure predictions (Fig 2C) Although the majority of rrPar-4FL is predicted to be disordered, this does not preclude the formation of short regions of structure or larger but transient secondary structure elements Indeed, gor4 predictions of a-helical structure (Fig 2C) coincide with the more ordered regions of rrPar-4FL and fall within the highly conserved segments of the protein (Fig 1) Thus, regions of rrPar-4FL may be capable of forming a-helices either independently or upon association with binding partners Furthermore, the predicted regions of order in rrPar-4LZ occur within the functionally relevant regions, namely NLS1 and 2, SAC and the FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS 3717 Intrinsic disorder in Par-4 D S Libich et al coiled-coil (Fig 2) raising the possibility that Par-4 function may be associated with structure stabilization in these regions Intrinsic disorder in proteins is often erroneously considered to be a featureless random coil, although proteins not achieve a completely random conformation even in strongly denaturing conditions [60] A more accurate depiction is that IDPs exist as ensembles of rapidly interchanging conformers that sample varying regions of secondary structure space [46] IDPs can be broadly categorized into three non-exclusive groups (i.e a single IDP may fall into more than one category): random coil, pre-molten globule or molten globule [61] Because of the high percentage of rrPar-4FL that is predicted as disordered, a random coil-like classification of the ensemble would appear to be the most appropriate Similar to the structural ensemble described for activator for thyroid hormone and retinoid receptors [62], in the absence of interacting partners, rrPar-4FL exists predominantly unfolded in solution The kinase-inducible transcriptional-activation domain of cAMP-responsive element-binding protein (CREB) has been shown to be an IDP that folds into an orthogonal a-helix structure upon association with CREB binding protein [63,64] The intrinsically disordered nature along with the CREB binding protein-induced helical regions could be accurately predicted from its primary structure [53] Similarly, the primarily intrinsically disordered nature and potential helical regions of Par-4 are predicted here (Figs and 3) Par-4 displays aberrant electrophoretic mobility and is susceptible to proteolysis Fig (A) Difference between the 25 °C traces of rrPar-4FL and rrPar-4DLZ (Fig 5) The difference spectrum is characteristic of a well-defined coiled-coil displaying a h222 ⁄ h208 ratio > (B) Temperature dependence of the molar elipticity measured at 222 nm for rrPar-4FL in buffer (10 mM Tris, pH 7.0, 20 mM NaCl) only (filled circles), buffer + M urea (open diamonds) and buffer + M urea (open triangles) (C) Volume distribution of DLS measurements of rrPar-4FL showing the apparent hydrodynamic radius of the particles: buffer (10 mM Tris, pH 7.0, 20 mM NaCl) only (white bars), buffer + M urea (grey bars) and buffer + M urea (hatched bars) The reduction of the apparent RS upon increasing urea concentration suggests the disruption of a polymeric complex 3718 Aberrant electrophoretic mobility in a denaturing PAGE system is a hallmark of IDPs because their unique amino acid composition reduces the amount of sodium dodecyl sulphate that is able to bind [46,51,65] Aberrant mobility on PAGE gels of Par-4 and Par-4 constructs (i.e deletion mutants) has been demonstrated, although it is not known whether the effects of IDP amino acid composition were considered [34,36] In the present study, slower than expected migration of the Par-4 constructs resulted in apparent MWs that were 1.3- (rrPar-4FL and rrPar-4DLZ) to 1.8- (rrPar-4SAC) fold larger than that predicted from sequence or measured using MS (Table 1) Limited proteolysis can be used to distinguish ordered and disordered proteins based on their relative sensitivity to cleavage by proteases such as trypsin FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS D S Libich et al [45,50,66] Although rrPar-4FL, rrPar-4DLZ and BSA contain an approximately equal percentage of trypsin cut sites, BSA is digested at a much slower rate (Fig 4) This implies that a significant portion of the conformational ensemble of the rrPar-4 proteins are more exposed to the solvent than BSA and largely lack protection by folded and stable tertiary structure The hydrodynamic radius of Par-4 is larger than that predicted by sequence analysis The observable Stokes radius of a protein increases in proportion to its degree of ‘unfoldedness’; thus, an IDP will have an observable RS larger than a folded globular protein of the same MW [48,67] Some examples of IDPs with large RS values relative to MW have been summarized previously [68] In the present study, the RS measured for rrPar-4FL, rrPar-4DLZ and rrPar-4SAC correspond to MWs of 8.9 · 103, 64.1 and 18.7 kDa, respectively, and are much larger (713, 129 and 141%) than what would be expected for a folded globular protein of similar MW The MW estimations shown in Table are used as a point of reference to illustrate that the degree of ‘unfoldedness’ of Par-4 is very high, which is similar to that expected for a coillike as opposed to a pre-molten globule ensemble [48] The extremely large RS observed for rrPar-4FL relative to the other two constructs clearly indicates a polymeric state, as discussed further below IDPs such as CREB and p27Kip1 (i.e cyclin-dependent kinase inhibitor) exist as structurally interconverting populations that have been demonstrated to retain a nascent secondary structure to varying degrees under physiological conditions [69] The width of the volume-weighted distributions for rrPar-4FL, rrPar4DLZ and rrPar-4SAC (see Fig S1) is consistent with this type of conformational exchange Interestingly, although the addition of m urea causes a subtle but significant increase in RS for rrPar4DLZ and rrPar-4SAC (Table 2), the width of the distributions are largely unaltered Together, these observations suggest that m urea can disrupt some folding elements and bring the conformation of the ensemble closer to random coil, but conformational exchange continues Secondary structure of Par-4 assessed by CD and NMR The CD spectra for rrPar-4DLZ and rrPar-4SAC are exemplary of IDPs with a deep transition at 200 nm and a minor transition at 222 nm (Fig 5) [51] The CD spectra of IDPs are often complicated by minor Intrinsic disorder in Par-4 contributions from secondary structure elements, such as alpha or poly-proline type II helices [70] Deconvolution of the 25 °C spectra estimates 32%, 17% and 18% of combined regular and distorted a-helix for rrPar-4FL, rrPar-4DLZ and rrPar-4SAC, respectively [71] All three constructs remain relatively stable throughout the heating cycle because the 5–65 °C traces exhibit similar features Thus, in addition to the coiled-coil region of rrPar-4FL, other regions of these proteins may transiently populate a-helical or other secondary structures Interestingly, although the overall temperature-induced changes are minor, an isodichroic point at 210 nm is observed for rrPar-4SAC, which may be interpreted as a two-state conformational change (Fig 5C) This could be the result of secondary and ⁄ or tertiary structure that is thermally disrupted The atomic resolution of NMR makes it uniquely suited to assess the ‘orderedness’ of an IDP [51] Because most residues of an IDP are solvent exposed and inherently flexible, they share a similar chemical environment and, consequently, share similar NMR frequencies, resulting in significant overlap of resonances (particularly for 1H resonances) and population-weighted average chemical shifts [72] Mobility also results in sharp peaks as a result of increased T2 values [73] The spectra of rrPar-4FL, rrPar-4DLZ and rrPar-4SAC shown in Fig are characteristic of IDPs, with ensemble averages, narrow peaks and poor chemical shift dispersion A total of 52% of residues for both rrPar-4FL and rrPar-4DLZ are not readily observable in an 1H-15N HSQC From the current data, it is impossible to determine whether the same residues (or residues from the same regions) are unobservable in these two constructs Possible reasons for this feature include poor chemical shift dispersion and intermediate exchange [74] A detailed examination of the dynamics of the visible regions of the proteins (dependent on assignments) may help to elucidate the time scales of motion involved and thus more definitive statements could then be made about particular residues or regions of rrPar-4LZ and rrPar-4DLZ [75] The spectrum of rrPar-4SAC (Fig 6) is much more complete than those recorded for rrPar-4FL and rrPar-4DLZ Nonetheless, a similar degree of disorder is suggested by the peak shape and chemical shift dispersion The size of the rrPar-4SAC (7 kDa) relative to that of the other constructs (> 30 kDa) is likely to be a contributing factor in the observance of these resonances because fewer residues equates to less chance of spectral overlap and a lower likelihood of slow to intermediate exchange FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS 3719 Intrinsic disorder in Par-4 D S Libich et al Evidence for self-association of Par-4 mediated by a coiled-coil The putative coiled-coil region of Par-4 (residues 254– 332; Fig 1) is the site of recognition and association for the majority of known binding partners [76]: the deletion of the leucine zipper renders Par-4 incapable of binding to proteins such as Wilms’ tumour 1, aPKCf, p62, death-associated protein-like ⁄ zipper interacting kinase, Akt1, E2F1 and b-site amyloid precursor protein cleaving enzyme [17,31,76,77] Coiled-coils are characterized by the heptad repeat abcdefg with hydrophobic residues at the a and d positions [78] The leucine zipper is a subset type of coiled-coil typified by the occurrence of a leucine at every seventh position (d) [79,80] The CD difference spectra between rrPar-4FL and rrPar-4DLZ is characteristic of a coiled-coil (h222 ⁄ h208 > 1; Fig 7A), suggesting that at least two rrPar-4FL monomers selfassociate forming a coiled-coil Lacking the residues that comprise the leucine zipper region of the coiledcoil (Fig 2A), rrPar-4DLZ was not observed to have strong a-helical character (Fig 5C) or to self-associate (see Fig S2) DLS measured an unusually large RS for rrPar-4FL ˚ (189 A) dissolved in native buffer (Fig 7C, Table 1) Large Stokes radii have previously been measured in rod-shaped proteins, including the winter flounder anti-freeze protein [81], hydrophobin SC3 [82] and various coiled-coils, such as chromogranin A [83] However, the apparent RS of rrPar-4FL was much larger than expected if the ensemble consisted of coil-like monomers The constructs lacking the coiled-coil region (rrPar-4DLZ and rrPar-4SAC) did not have appreciably large RS relative to the estimated random coil values (Table 2) ˚ ˚ The reduction of the RS from 189 A to 78 A for rrPar-4LZ in m urea is likely to be a result of the disruption of a noncovalent interaction Furthermore, ˚ the observed RS in m urea (58 A) is close to the calculated random coil value for rrPar-4FL (Fig 7C) Thus, as the concentration of urea is decreased, a polymeric state of rrPar-4FL forms in association with increased stabilization of the coiled-coil Melt curves constructed from the reduction in intensity of the 222 nm CD transition demonstrate that the rrPar-4FL complex is much less stable in increasing concentrations of urea, and show that the melting temperature for the rrPar-4FL complex increases from 25 °C in m urea to 75 °C in native buffer (Fig 7B) Taken together with the the results of the CD (Fig 7A) and DLS measurements (Fig 7C), these data clearly indicate that rrPar-4FL self-associates via the putative 3720 coiled-coil region, with the leucine zipper being of critical importance for self-association Recently, a 33 kDa isoform of Par-4 that lacks exon (notably NLS2), but retains the coiled-coil region, was reported by Wang et al [84] This isomer cannot translocate to the nucleus and has been proposed to be a negative regulator of Par-4 apoptotic activity by binding to and sequestering Par-4 in the cytoplasm [84] Therefore, self-association of Par-4 may be physiologically relevant as an additional regulator of its pro-apoptotic activity Previous studies have demonstrated that a 47 residue construct derived from the C-terminus (residues 286– 332) of Par-4, which includes all of the leucine zipper but not all of the coiled-coil region, self-associates into a coiled-coil structure under specific pH and temperature conditions [85] Under native conditions (neutral pH and moderate temperature), the construct was predominantly disordered, as judged by CD spectra It was proposed that nonfavourable charge–charge interactions at neutral pH prevented coiled-coil formation and that mitigation of these nonfavourable contacts through changes of pH, temperature, salt concentration or site-directed mutagenesis altered the ensemble equilibrium in favour of a coiled-coil [86] The results obtained in the present study show that, in the context of rrPar-4FL, the C-terminus forms a coiled-coil at neutral pH This suggests that a region N-terminal to the leucine zipper domain provides an electrostatic surface to counter the negative charges in the leucine zipper domain or otherwise helps to stabilize the coiled-coil Using a series of deletion mutants, Gao et al [35] demonstrated that an N-terminal region of Par-4 is able to interact with the coiled-coil region This may be a required intramolecular interaction for stabilization of the coiled-coil during self-association or with other binding partners at neutral pH Alternatively, interactions with other parts of the protein, including the N-terminal region of the coiled-coil (i.e N-terminal to the leucine zipper), may comprise a requisite trigger sequence for coiled-coil formation [87] Although the CD spectrum of rrPar-4FL showed a-helical character (Fig 5A), there is no obvious sign of helix formation in the corresponding HSQC spectrum and, as noted, the total number of peaks observed is only approximately 150 Recently, Liew et al [88] demonstrated that the signals observed in a H-15N HSQC of a glutathione S-transferase (GST) fusion peptide arose almost exclusively from the target protein and not GST They argued that because GST forms a 52 kDa dimer, the signals arising from GST would be broadened beyond observable limits and, thus, the remaining resonances are from the flexible FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS D S Libich et al Intrinsic disorder in Par-4 linker and target protein [88] A similar phenomenon may be occurring in the present study, where the elongated and highly self-associated coiled-coil forms a large core that behaves as a much larger protein Thus, its HSQC signals are unobservable as a result of line broadening, whereas the attached intrinsically disordered regions of the protein are observable because of their relative flexibility Intermediate conformational exchange may also contribute to the broadening of the coiled-coil peaks All of the data presented in the present study are consistent with this hypothesis Also consistent with this view, the overlay of rrPar-4FL and rrPar-4DLZ shows that approximately 50 peaks have identical or reasonably close chemical shifts, suggesting some similarity in the local environment of these proteins (Fig 6A) Non-overlap of remaining peaks indicates that a significant portion of the protein is affected by coiled-coil formation, through direct or relayed interactions One physiological implication of these observations is that Par-4 may be well suited to bind one partner via the coiled-coil, whereas much of the remainder of the intrinsically disordered regions are available for simultaneous interactions with another partner or partners: Par-4 may function as a highly efficient linker protein The majority of the Par-4 binding partners interact with the C-terminus, although a few, such as the SPRY domain and F-actin, have been shown to bind N-terminally [36,37] Indeed, Par-4 has been demonstrated to mediate the ternary complex between aPKCf and p62 [27] and high mobility group protein A, have been shown to interact with multiple binding partners primarily through disorder containing regions [56] Similarly, because of intrinsic disorder, Par-4 could contain multiple specific binding sites such that it binds to different partners simultaneously, as discussed in the case of aPKCf ⁄ p62 An extended conformation also has the advantage of a large amount of accessible surface area being available for intermolecular interactions, relative to a globular protein of the same number of amino acids [92] It is noteworthy that all 26 prolines present in Par-4 occur in the first 255 residues (Fig 1) Prolyl residues favour open conformations and extended structures such as polyproline-type II helices, which easily convert to other conformational states [93] Additionally, proline is considered to promote inter-molecular recognition as a result of the absence of intra-residue hydrogen bonds [94] Because of the precise regulation through post-translational modifications and their promiscuous binding, IDPs often form hubs or nodes that serve to link the functions of several proteins and ⁄ or cofactors together [95] The high mobility group protein A is a chromosome and chromatin modulator that functions as a hub in cancer and other related pathological processes [96,97] We raise the possibility of a similar role for Par-4 The ubiquitous expression, tight temporal and spatial regulation, rapid turnover, multiple binding partners and inherent flexibility uniquely situate Par-4 to function as a control factor hub for apoptosis The advantage of disorder in dynamic processes Conclusions Intrinsic disorder may impart several advantages to Par-4 in its role as a pro-apoptotic factor Because disordered regions are solvent exposed, they are easily accessible for post-translational modifications, such as phosphorylation, ubiquitination or Ubl-conjugation, etc., which enables precise control of function, localization and turnover rate [39,89] Notably for Par-4, the phosphorylation of T155 (Fig 1) is required for nuclear translocation and subsequent initiation of apoptosis [8] The extreme proteolytic sensitivity of IDPs offers an additional layer of cellular control via rapid, controlled turnover [90] Disordered regions also confer an increased structural plasticity and, consequently, IDPs are able to bind multiple targets with high specificity yet in a readily reversible manor The ‘fly-casting’ mechanism has been proposed to describe how disordered segments bind their targets with low affinity and fast association ⁄ dissociation rates [45,51,69,91] Two extensively studied proteins, p53 The data obtained in the present study indicate that Par-4 can be classified as a predominantly intrinsically disordered protein Bioinformatic analysis shows that highly conserved Par-4 has low sequence complexity, is enriched in polar and charged amino acids and is classified as disordered when plotted in charge-hydrophobicity space disembl predicts that the majority of Par-4 (> 70%) is disordered, yet ordered segments align well with predicted secondary structure elements (a-helix) and regions of hydrophobic clusters Limited proteolysis and DLS experiments demonstrate that rrPar-4FL is primarily extended in solution, exhibiting high susceptibility to trypsin and a large hydrodynamic radius Furthermore, CD and NMR experiments revealed characteristic spectral features of intrinsic disorder Taken together, these data demonstrate that rrPar-4FL does not maintain a stabilized global tertiary structure, but does not preclude the possible formation of transient and ⁄ or local structure FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS 3721 Intrinsic disorder in Par-4 D S Libich et al Although primarily disordered, rrPar-4FL is able to self-associate via the C-terminus forming a stable coiled-coil in this region Self-association behaviour was not observed for any of the other constructs used in the present study, each of which lacked the C-terminus Although previous experiments with the leucine zipper domain of Par-4 showed that self-association required acidic pH, the same requirement was not observed in the present study, possibly because of the influence of other regions of Par-4 providing chargemediated or other forms of stabilization Intrinsic disorder imparts many advantages to a multifunctional protein such as Par-4 Protein–protein and protein– ligand interactions can be highly specific yet readily reversible, whereas post-translational modifications allow for very tight control of the functions of Par-4 The results obtained in the present study demonstrate that the combined intrinsically disordered and coiledcoil nature of Par-4 provides unique structural properties through which Par-4 can perform a multifunctional role in various tissues and cellular processes Experimental procedures The PCR primers used were purchased from Sigma Genosys (Sigma-Aldrich PTY Ltd, Castle Hill, Australia) D2O and 15NH4Cl were obtained from Cambridge Isotope Laboratories (Andover, MA, USA) Restriction enzymes were purchased from Roche Diagnostic GmbH (Penzberg, Germany) All other chemicals were of reagent grade or higher and were acquired from either Sigma or Invitrogen (Carlsbad, CA, USA) Expression vector construction A versatile expression vector was designed to be used to either express Par-4 constructs alone or in conjunction with putative binding partners in Escherichia coli cells The pET23a vector from Novagen (Merck Biosciences, Darmstadt, Germany) was used as a template to create pCFETrxH-TEV, which enables the expression of targets as fusion proteins with thioredoxin A hexa-histidine tag is included between thioredoxin and the N-terminus of the target An rTEV-protease cleavage site was included for removal of the thioredoxin and hexa-histidine tags The fusion tag was PCR amplified using pET32a (Merck Biosciences) as a template and subsequently inserted into the NdeI ⁄ BamHI restriction sites of pET23a The primers were: forward 5¢-CTGGCATATGAGCGATAAAATTATTCAC3¢ and reverse 5¢-CCGGGGATCCCTGAAAATACAGG TTTTCGGTCGTTGGGATATCGTAATCGTGATGGTG ATGGTGATGCATATG-3¢ The rrPar-4FL construct (residues 1–332, rat sequence numbering) was prepared by PCR amplification using the 3722 four primers 5¢-CAGGGATCCATGGCGACCGGCG GCTATCGGAG-3¢, 5¢-CTTGGCGGCTGGATCTCCGCC GCTCGAAC-3¢, 5¢-GTTCGAGCGGCGGAGATCCAGCC GCCAAG-3¢ and 5¢-CAGGTCGACTTACCTTGTCAGC TGCCCAACAAC-3¢ to remove an internal BamHI site on the racine Par-4 cDNA The PCR product was then cloned into the BamHI ⁄ SalI sites of pCFE-TrxH-TEV The rrPar4DLZ (residues 1–290) construct lacking the leucine zipper was PCR amplified with the primers 5¢-CAG GGATCCATGGCGACCGGCGGCTATCGGAG-3¢ and 5¢-CCGGAAGCTTTTATTCTTCTTTATCTTGCATCAG3¢ using the full-length construct as a template The PCR product was then cloned into the BamHI ⁄ HindIII sites of pCFE-TrxH-TEV The rrPar-4SAC (residues 137–195) construct representing the SAC domain was cloned in the same manner as rrPar-4DLZ using the primers 5¢-GAGGAT CCAGGAAAGGCAAAGGGCAGATCG-3¢ and 5¢-GCA AGCTTTTATGCTTCATTCTGGATGGTG-3¢ Expression of Par-4 The three rrPar-4 expression vectors were used to transform E coli Rosetta(DE3) cells (Novagen) The cells were grown in LB medium at 37 °C until D600 of 0.6 was reached, induced by the addition of 0.4 mm isopropyl thio-bd-galactoside (IPTG) and grown for a further h at 25 °C Isotopic labels were introduced by growing cells in LB medium at 37 °C until D600 of 0.6 was reached Cells were pelleted by centrifugation and resuspended in one-half the original volume of M9 minimal media using 15NH4Cl as the sole nitrogen source After growth for h at 30 °C, expression was induced by the addition of 0.4 mm IPTG and cells were grown for a further h at 25 °C Cells were harvested by centrifugation, resuspended in lysis buffer (50 mm Tris, pH 8.0, 100 mm NaCl, 25 mm imidazole) or lysis buffer containing m urea and lysed by three passes through a French press (AMINCO, Silver Spring, MD, USA) The resulting lysate was cleared by filtration through a 0.8 lm syringe filter The cleared lysate was passed through a Ni-nitrilotriacetic acid (GE Healthcare, Uppsala, Sweden) column and eluted with 250 mm imidazole in lysis buffer To remove excess imidazole, pooled fractions containing the rrPar-4 fusion proteins were dialysed against lysis buffer The purification tags (thioredoxin and hexa-histidine) were cleaved from the rrPar-4 proteins with rTEV at room temperature and passed again over the Ni-nitrilotriacetic acid column The cleavage leaves a three residue (Gly-Gly-Ser) remnant at the N-terminus of all the rrPar-4 constructs The eluted fractions were subsequently dialysed against 10 mm Tris (pH 7.4) and 20 mm NaCl Ion-exchange chromatography was used as a final purification step for rrPar-4DLZ and rrPar-4SAC The constructs were purified on SP-sepharose column (GE Healthcare) using a linear gradient of 0–100% high salt buffer over FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS D S Libich et al 20 The low salt buffer contained 20 mm NaPO4 (pH 6) and 50 mm NaCl; the high salt buffer contained 20 mm Tris (pH 7.5) and m NaCl Fractions containing the protein of interest were pooled and dialysed against 10 mm Tris (pH 7.0), 20 mm NaCl and were concentrated by centrifugation using a Vivaspin 20 device (Vivascience AG, Hannover, Germany) The rrPar-4FL construct was further ˚ purified by RP-HPLC using a Delta Pak C18-300 A, 300 · 3.9 mm column, (Waters Corporation, Milford, MA, USA) with a linear gradient of 20–45% acetonitrile containing 0.08% trifluoroacetic acid The rrPar-4FL fractions were lyopholized and resolubilized in 10 mm Tris (pH 7.0), 20 mm NaCl Protein concentration was determined by A280 and A205 measurements using the extinction coefficients (13 075 m)1Ỉcm)1 (rrPar-4FL and rrPar-4DLZ) or 1490 m)1Ỉcm)1 (rrPar-4SAC) and the relationship described by Scopes [98] The purified samples were assessed by MALDI-TOF mass spectroscopy (Centre for Protein Research, University of Otago, Dunedin, New Zealand) Limited proteolysis The rrPar-4 constructs or BSA (Sigma-Aldrich, St Louis, MO, USA) were incubated with trypsin at a protein to protease ratio of 280 : (w ⁄ w) in 20 mm NaPO4 (pH 7.5), 50 mm NaCl for 15 at 37 °C Aliquots were taken after 1, 2, 5, 10 and 15 and the reaction was quenched by the addition of Laemmli sample buffer and boiling for Proteins were loaded on a 10% Tricine-PAGE gel [99] The extent of digestion was measured from the relative intensities of the Tricine-PAGE gel band representing the undigested band by densitometry using the Gel Doc Imager and Quantity One software package (Bio-Rad, Hercules, CA, USA) DLS The apparent Stokes radii of the rrPar-4 constructs were analysed using a Zetasizer Nano ZS (Malvern Instruments, Malvern, UK) Sample concentrations were 0.3 mgỈmL)1 in native buffer (10 mm Tris, pH 7.0, 20 mm NaCl) or native buffer plus or m urea DLS data were obtained at 25 °C using a low-volume disposable cm pathlength plastic cuvette (Sarstedt, Nurnbrecht, Germany) and five ¨ successive scans were collected and averaged for each protein sample Samples were prepared day in advance and maintained overnight at °C to allow any bubbles to dissipate and were then allowed to equilibrate to 25 °C before measurements were made The diffusion coefficients were extracted from the correlation curve and the hydrodynamic radius was calculated using the Stokes–Einstein equation The highest peak of the resulting histogram recorded for each sample was taken as the mean diameter for that particular sample Intrinsic disorder in Par-4 CD Spectra were recorded on a Chirascan CD spectropolarimeter (Applied Photophysics, Leatherhead, UK) equipped with a recirculating water bath Samples were at a concentration of 0.3 mgỈmL–1 in native buffer (10 mm Tris, pH 7.0, 20 mm NaCl) or native buffer plus or m urea Spectra were recorded in 0.5 nm steps from 260–190 nm with an integration time of s at each wavelength Three successive scans were recorded, the sample blank was subtracted and the scans were averaged and smoothed using a sliding window function Thermal stability was determined by acquiring CD spectra as a function of temperature at °C intervals from 5–75 °C with of equilibration time at each temperature point Deconvolution was performed using the continll algorithm [100] through the dichroweb server interface [71] NMR spectroscopy NMR experiments were performed on a Bruker Avance 700 MHz spectrometer (Bruker BioSpin GmbH, Rheinstetten, Germany) equipped with a cryoprobe, four rf-channels and gradient pulse capabilities All spectra were acquired at °C on 300 lL samples containing 5% D2O in Shigemi NMR tubes The rrPar-4FL sample concentration was 0.48 mm in 10 mm Tris (pH 7.0), 20 mm NaCl The rrPar4DLZ construct was uniformly 15N labelled with a protein concentration of 0.09 mm in 20 mm NaPO4 (pH 7.5), 100 mm NaCl, mm dithiothreitol Similarly rrPar-4SAC was uniformly 15N labelled at a concentration of 0.34 mm in 10 mm Tris (pH 7.0), 20 mM NaCl H-15N HSQC spectra were recorded with the settings: rrPar-4FL: 200 transients, 2048 · 128 points (F2 · F1) and spectral widths of 8389.2 and 2128.9 Hz for F2 and F1, respectively; rrPar-4DLZ: 20 transients, 2048 · 128 points (F2 · F1) and spectral widths of 8389.2 and 2128.9 Hz for F2 and F1, respectively; rrPar-4SAC: 24 transients, 2048 · 256 points (F2 · F1) and spectral widths of 8389.2 and 2128.9 Hz for F2 and F1, respectively All data sets were linear predicted and zero-filled once in the indirect dimension before Fourier transformation and final processing Spectra were apodised using a shifted (p ⁄ 6) squared sinusoidal bell function using TopSpin 2.1 (Bruker BioSpin GmbH, Rheinstetten, Germany) The 1H and 15N chemical shifts were referenced to the water signal [101] Acknowledgements The authors wish to thank Professor Rangnekar We also acknowledge Mr Trevor Loo and Mrs Michelle Tamehana for providing excellent technical assistance and advice Funding for this project was provided in part by grants from the Royal Society of New Zealand (Marsden Fund Award MAU0507) to S.M.P FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS 3723 Intrinsic disorder in Par-4 D S Libich et al References Boghaert ER, Sells SF, Walid AJ, Malone P, Williams NM, Weinstein MH, Strange R & Rangnekar VM (1997) Immunohistochemical analysis of the proapoptotic protein Par-4 in normal rat tissues Cell Growth Differ 8, 881–890 Sells SF, Wood DP Jr, Joshi-Barve SS, Muthukumar S, Jacob RJ, Crist SA, Humphreys S & Rangnekar VM (1994) Commonality of the gene programs induced by effectors of apoptosis in androgen-dependent and -independent prostate cells Cell Growth Differ 5, 457–466 Ranganathan P & Rangnekar VM (2005) Regulation of cancer cell survival by Par-4 Ann N Y Acad Sci 1059, 76–85 Chakraborty M, Qiu SG, Vasudevan KM & Rangnekar VM (2001) Par-4 drives trafficking and activation of Fas and Fasl to induce prostate cancer cell apoptosis and tumor regression Cancer Res 61, 7255–7263 Camandola S & Mattson MP (2000) Pro-apoptotic action of PAR-4 involves inhibition of NF-kappaB activity and suppression of BCL-2 expression J Neurosci Res 61, 134–139 El-Guendy N, Zhao Y, Gurumurthy S, Burikhanov R & Rangnekar VM (2003) Identification of a unique core domain of par-4 sufficient for selective apoptosis induction in cancer cells Mol Cell Biol 23, 5516–5525 Johnstone RW, See RH, Sells SF, Wang J, Muthukkumar S, Englert C, Haber DA, Licht JD, Sugrue SP, Roberts T et al (1996) A novel repressor, par-4, modulates transcription and growth suppression functions of the Wilms’ tumor suppressor WT1 Mol Cell Biol 16, 6945–6956 Gurumurthy S, Goswami A, Vasudevan KM & Rangnekar VM (2005) Phosphorylation of Par-4 by protein kinase A is critical for apoptosis Mol Cell Biol 25, 1146–1161 Cook J, Krishnan S, Ananth S, Sells SF, Shi Y, Walther MM, Linehan WM, Sukhatme VP, Weinstein MH & Rangnekar VM (1999) Decreased expression of the pro-apoptotic protein Par-4 in renal cell carcinoma Oncogene 18, 1205–1208 10 Boehrer S, Chow KU, Puccetti E, Ruthardt M, Godzisard S, Krapohl A, Schneider B, Hoelzer D, Mitrou PS, Rangnekar VM et al (2001) Deregulated expression of prostate apoptosis response gene-4 in less differentiated lymphocytes and inverse expressional patterns of par-4 and bcl-2 in acute lymphocytic leukemia Hematol J 2, 103–107 11 Kogel D, Reimertz C, Mech P, Poppe M, Fruhwald MC, Engemann H, Scheidtmann KH & Prehn JH (2001) Dlk ⁄ ZIP kinase-induced apoptosis in human medulloblastoma cells: requirement of the mitochondrial apoptosis pathway Br J Cancer 85, 1801–1808 3724 12 Moreno-Bueno G, Fernandez-Marcos PJ, Collado M, Tendero MJ, Rodriguez-Pinilla SM, Garcia-Cao I, Hardisson D, Diaz-Meco MT, Moscat J, Serrano M et al (2007) Inactivation of the candidate tumor suppressor par-4 in endometrial cancer Cancer Res 67, 1927–1934 13 Azmi AS, Wang Z, Burikhanov R, Rangnekar VM, Wang G, Chen J, Wang S, Sarkar FH & Mohammad RM (2008) Critical role of prostate apoptosis response4 in determining the sensitivity of pancreatic cancer cells to small-molecule inhibitor-induced apoptosis Mol Cancer Ther 7, 2884–2893 14 Bieberich E, MacKinnon S, Silva J, Noggle S & Condie BG (2003) Regulation of cell death in mitotic neural progenitor cells by asymmetric distribution of prostate apoptosis response (PAR-4) and simultaneous elevation of endogenous ceramide J Cell Biol 162, 469–479 15 Blaschke AJ, Staley K & Chun J (1996) Widespread programmed cell death in proliferative and postmitotic regions of the fetal cerebral cortex Development 122, 1165–1174 16 Loo DT, Copani A, Pike CJ, Whittemore ER, Walencewicz AJ & Cotman CW (1993) Apoptosis is induced by beta-amyloid in cultured central nervous system neurons Proc Natl Acad Sci USA 90, 7951–7955 17 Xie J & Guo Q (2005) PAR-4 is involved in regulation of beta-secretase cleavage of the Alzheimer amyloid precursor protein J Biol Chem 280, 13824–13832 18 Duan W, Rangnekar VM & Mattson MP (1999) Prostate apoptosis response-4 production in synaptic compartments following apoptotic and excitotoxic insults: evidence for a pivotal role in mitochondrial dysfunction and neuronal degeneration J Neurochem 72, 2312–2322 19 Zeitlin S, Liu JP, Chapman DL, Papaioannou VE & Efstratiadis A (1995) Increased apoptosis and early embryonic lethality in mice nullizygous for the Huntington’s disease gene homologue Nat Genet 11, 155–163 20 Pedersen WA, Luo H, Kruman I, Kasarskis E & Mattson MP (2000) The prostate apoptosis response-4 protein participates in motor neuron degeneration in amyotrophic lateral sclerosis FASEB J 14, 913–924 21 Lafuente MJ, Martin P, Garcia-Cao I, Diaz-Meco MT, Serrano M & Moscat J (2003) Regulation of mature T lymphocyte proliferation and differentiation by Par-4 EMBO J 22, 4689–4698 22 Guo Q, Xie J, Chang X, Zhang X & Du H (2001) Par-4 is a synaptic protein that regulates neurite outgrowth by altering calcium homeostasis and transcription factor AP-1 activation Brain Res 903, 13–25 FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS D S Libich et al 23 Payette DJ, Xie J, Shirwany N & Guo Q (2008) Exacerbation of apoptosis of cortical neurons following traumatic brain injury in par-4 transgenic mice Int J Clin Exp Pathol 1, 44–56 24 Diaz-Meco MT, Municio MM, Frutos S, Sanchez P, Lozano J, Sanz L & Moscat J (1996) The product of par-4, a gene induced during apoptosis, interacts selectively with the atypical isoforms of protein kinase C Cell 86, 777–786 25 Valmiki MG & Ramos JW (2009) Death effector domain-containing proteins Cell Mol Life Sci 66, 814–830 26 Goswami A, Burikhanov R, de Thonel A, Fujita N, Goswami M, Zhao Y, Eriksson JE, Tsuruo T & Rangnekar VM (2005) Binding and phosphorylation of par-4 by akt is essential for cancer cell survival Mol Cell 20, 33–44 27 Chang S, Kim JH & Shin J (2002) p62 forms a ternary complex with PKCzeta and PAR-4 and antagonizes PAR-4-induced PKCzeta inhibition FEBS Lett 510, 57–61 28 Page G, Kogel D, Rangnekar V & Scheidtmann KH (1999) Interaction partners of Dlk ⁄ ZIP kinase: co-expression of Dlk ⁄ ZIP kinase and Par-4 results in cytoplasmic retention and apoptosis Oncogene 18, 7265–7273 29 Roussigne M, Cayrol C, Clouaire T, Amalric F & Girard JP (2003) THAP1 is a nuclear proapoptotic factor that links prostate-apoptosis-response-4 (Par-4) to PML nuclear bodies Oncogene 22, 2432–2442 30 Boosen M, Vetterkind S, Koplin A, Illenberger S & Preuss U (2005) Par-4-mediated recruitment of Amida to the actin cytoskeleton leads to the induction of apoptosis Exp Cell Res 311, 177–191 31 Lu C, Chen JQ, Zhou GP, Wu SH, Guan YF & Yuan CS (2008) Multimolecular complex of Par-4 and E2F1 binding to Smac promoter contributes to glutamateinduced apoptosis in human- bone mesenchymal stem cells Nucleic Acids Res 36, 5021–5032 32 Park SK, Nguyen MD, Fischer A, Luke MP, Affarel B, Dieffenbach PB, Tseng HC, Shi Y & Tsai LH (2005) Par-4 links dopamine signaling and depression Cell 122, 275–287 33 Guo Q & Xie J (2004) AATF inhibits aberrant production of amyloid beta peptide 1–42 by interacting directly with Par-4 J Biol Chem 279, 4596–4603 34 Goswami A, Qiu S, Dexheimer TS, Ranganathan P, Burikhanov R, Pommier Y & Rangnekar VM (2008) Par-4 binds to topoisomerase and attenuates its DNA relaxation activity Cancer Res 68, 6190– 6198 35 Gao S, Wang H, Lee P, Melamed J, Li CX, Zhang F, Wu H, Zhou L & Wang Z (2006) Androgen receptor and prostate apoptosis response factor-4 target the Intrinsic disorder in Par-4 36 37 38 39 40 41 42 43 44 45 46 47 48 49 c-FLIP gene to determine survival and apoptosis in the prostate gland J Mol Endocrinol 36, 463–483 Vetterkind S, Illenberger S, Kubicek J, Boosen M, Appel S, Naim HY, Scheidtmann KH & Preuss U (2005) Binding of Par-4 to the actin cytoskeleton is essential for Par-4 ⁄ Dlk-mediated apoptosis Exp Cell Res 305, 392–408 Masters SL, Yao S, Willson TA, Zhang JG, Palmer KR, Smith BJ, Babon JJ, Nicola NA, Norton RS & Nicholson SE (2006) The SPRY domain of SSB-2 adopts a novel fold that presents conserved Par-4-binding residues Nat Struct Mol Biol 13, 77–84 El-Guendy N & Rangnekar VM (2003) Apoptosis by Par-4 in cancer and neurodegenerative diseases Exp Cell Res 283, 51–66 Uversky VN, Oldfield CJ & Dunker AK (2008) Intrinsically disordered proteins in human diseases: introducing the D2 concept Annu Rev Biophys 37, 215–246 Oldfield CJ, Cheng Y, Cortese MS, Romero P, Uversky VN & Dunker AK (2005) Coupled folding and binding with alpha-helix-forming molecular recognition elements Biochemistry 44, 12454–12470 Linding R, Jensen LJ, Diella F, Bork P, Gibson TJ & Russell RB (2003) Protein disorder prediction: implications for structural proteomics Structure 11, 1453– 1459 Garnier J, Gibrat JF & Robson B (1996) GOR method for predicting protein secondary structure from amino acid sequence Comput Methods Macromol Seq Anal 266, 540–553 Callebaut I, Labesse G, Durand P, Poupon A, Canard L, Chomilier J, Henrissat B & Mornon JP (1997) Deciphering protein sequence information through hydrophobic cluster analysis (HCA): current status and perspectives Cell Mol Life Sci 53, 621–645 Uversky VN, Gillespie JR & Fink AL (2000) Why are ‘natively unfolded’ proteins unstructured under physiologic conditions? Proteins 41, 415–427 Dunker AK, Lawson JD, Brown CJ, Williams RM, Romero P, Oh JS, Oldfield CJ, Campen AM, Ratliff CM, Hipps KW et al (2001) Intrinsically disordered protein J Mol Graph Model 19, 26–59 Tompa P (2002) Intrinsically unstructured proteins Trends Biochem Sci 27, 527–533 Uversky VN (2002) What does it mean to be natively unfolded? Eur J Biochem 269, 2–12 Uversky VN (1993) Use of fast protein size-exclusion liquid chromatography to study the unfolding of proteins which denature through the molten globule Biochemistry 32, 13288–13298 Spolaore B, Bermejo R, Zambonin M & Fontana A (2001) Protein interactions leading to conformational changes monitored by limited proteolysis: apo form FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS 3725 Intrinsic disorder in Par-4 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 D S Libich et al and fragments of horse cytochrome c Biochemistry 40, 9460–9468 Hubbard SJ (1998) The structural aspects of limited proteolysis of native proteins Biochim Biophys Acta 1382, 191–206 Receveur-Brechot V, Bourhis JM, Uversky VN, Canard B & Longhi S (2006) Assessing protein disorder and induced folding Proteins 62, 24–45 Dyson HJ & Wright PE (2005) Elucidation of the protein folding landscape by NMR Methods Enzymol 394, 299–321 Dyson HJ & Wright PE (2005) Intrinsically unstructured proteins and their functions Nat Rev Mol Cell Biol 6, 197–208 Uversky VN, Oldfield CJ & Dunker AK (2005) Showing your ID: intrinsic disorder as an ID for recognition, regulation and cell signaling J Mol Recognit 18, 343–384 Dunker AK, Obradovic Z, Romero P, Garner EC & Brown CJ (2000) Intrinsic protein disorder in complete genomes Genome Inform Ser Workshop Genome Inform 11, 161–171 Iakoucheva LM, Brown CJ, Lawson JD, Obradovic Z & Dunker AK (2002) Intrinsic disorder in cell-signaling and cancer-associated proteins J Mol Biol 323, 573–584 Hanahan D & Weinberg RA (2000) The hallmarks of cancer Cell 100, 57–70 Hartwell LH & Kastan MB (1994) Cell cycle control and cancer Science 266, 1821–1828 Romero P, Obradovic Z, Li X, Garner EC, Brown CJ & Dunker AK (2001) Sequence complexity of disordered protein Proteins 42, 38–48 Shortle D (1996) The denatured state (the other half of the folding equation) and its role in protein stability FASEB J 10, 27–34 Uversky VN & Fink AL (2004) Conformational constraints for amyloid fibrillation: the importance of being unfolded Biochim Biophys Acta 1698, 131–153 Demarest SJ, Martinez-Yamout M, Chung J, Chen H, Xu W, Dyson HJ, Evans RM & Wright PE (2002) Mutual synergistic folding in recruitment of CBP ⁄ p300 by p160 nuclear receptor coactivators Nature 415, 549–553 Richards JP, Bachinger HP, Goodman RH & Brennan RG (1996) Analysis of the structural properties of cAMP-responsive element-binding protein (CREB) and phosphorylated CREB J Biol Chem 271, 13716– 13723 Radhakrishnan I, Perez-Alvarado GC, Parker D, Dyson HJ, Montminy MR & Wright PE (1997) Solution structure of the KIX domain of CBP bound to the transactivation domain of CREB: a model for activator:coactivator interactions Cell 91, 741–752 3726 65 Hu CC & Ghabrial SA (1995) The conserved, hydrophilic and arginine-rich N-terminal domain of cucumovirus coat proteins contributes to their anomalous electrophoretic mobilities in sodium dodecylsulfatepolyacrylamide gels J Virol Methods 55, 367–379 66 Lacy ER, Wang Y, Post J, Nourse A, Webb W, Mapelli M, Musacchio A, Siuzdak G & Kriwacki RW (2005) Molecular basis for the specificity of p27 toward cyclin-dependent kinases that regulate cell division J Mol Biol 349, 764–773 67 Tcherkasskaya O & Uversky VN (2001) Denatured collapsed states in protein folding: example of apomyoglobin Proteins 44, 244–254 68 Uversky VN (2002) Natively unfolded proteins: a point where biology waits for physics Protein Sci 11, 739–756 69 Galea CA, Wang Y, Sivakolundu SG & Kriwacki RW (2008) Regulation of cell division by intrinsically unstructured proteins: intrinsic flexibility, modularity, and signaling conduits Biochemistry 47, 7598–7609 70 Shi Z, Woody RW & Kallenbach NR (2002) Is polyproline II a major backbone conformation in unfolded proteins? Adv Protein Chem 62, 163–240 71 Whitmore L & Wallace BA (2004) DICHROWEB, an online server for protein secondary structure analyses from circular dichroism spectroscopic data Nucleic Acids Res 32, W668–W673 72 Dyson HJ & Wright PE (2001) Nuclear magnetic resonance methods for elucidation of structure and dynamics in disordered states Methods Enzymol 339, 258–270 73 Dyson HJ & Wright PE (2004) Unfolded proteins and protein folding studied by NMR Chem Rev 104, 3607–3622 74 Cavanagh J (2007) Protein NMR Spectroscopy: Principles and Practice, 2nd edn Elsevier Academic Press, Amsterdam, Boston, MA 75 Dyson HJ & Wright PE (2002) Insights into the structure and dynamics of unfolded proteins from nuclear magnetic resonance Adv Protein Chem 62, 311–340 76 Zhao Y & Rangnekar VM (2008) Apoptosis and tumor resistance conferred by Par-4 Cancer Biol Ther 7, 1867–1874 77 Gurumurthy S & Rangnekar VM (2004) Par-4 inducible apoptosis in prostate cancer cells J Cell Biochem 91, 504–512 78 Harbury PB, Zhang T, Kim PS & Alber T (1993) A switch between two-, three-, and four-stranded coiled coils in GCN4 leucine zipper mutants Science 262, 1401–1407 79 Landschulz WH, Johnson PF & McKnight SL (1988) The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins Science 240, 1759–1764 FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS D S Libich et al 80 O’Shea EK, Rutkowski R & Kim PS (1989) Evidence that the leucine zipper is a coiled coil Science 243, 538– 542 81 Marshall CB, Chakrabartty A & Davies PL (2005) Hyperactive antifreeze protein from winter flounder is a very long rod-like dimer of alpha-helices J Biol Chem 280, 17920–17929 82 Wang X, Graveland-Bikker JF, de Kruif CG & Robillard GT (2004) Oligomerization of hydrophobin SC3 in solution: from soluble state to self-assembly Protein Sci 13, 810–821 83 Mosley CA, Taupenot L, Biswas N, Taulane JP, Olson NH, Vaingankar SM, Wen G, Schork NJ, Ziegler MG, Mahata SK et al (2007) Biogenesis of the secretory granule: chromogranin A coiled-coil structure results in unusual physical properties and suggests a mechanism for granule core condensation Biochemistry 46, 10999–11012 84 Wang G, Silva J, Krishnamurthy K & Bieberich E (2006) A novel isoform of prostate apoptosis response (PAR-4) that co-distributes with F-actin and prevents apoptosis in neural stem cells Apoptosis 11, 315–325 85 Dutta K, Alexandrov A, Huang H & Pascal SM (2001) pH-induced folding of an apoptotic coiled coil Protein Sci 10, 2531–2540 86 Dutta K, Engler FA, Cotton L, Alexandrov A, Bedi GS, Colquhoun J & Pascal SM (2003) Stabilization of a pH-sensitive apoptosis-linked coiled coil through single point mutations Protein Sci 12, 257–265 87 Steinmetz MO, Jelesarov I, Matousek WM, Honnappa S, Jahnke W, Missimer JH, Frank S, Alexandrescu AT & Kammerer RA (2007) Molecular basis of coiled-coil formation Proc Natl Acad Sci USA 104, 7062–7067 88 Liew CK, Gamsjaeger R, Mansfield RE & Mackay JP (2008) NMR spectroscopy as a tool for the rapid assessment of the conformation of GST-fusion proteins Protein Sci 17, 1630–1635 89 Xie H, Vucetic S, Iakoucheva LM, Oldfield CJ, Dunker AK, Obradovic Z & Uversky VN (2007) Functional anthology of intrinsic disorder Ligands, post-translational modifications, and diseases associated with intrinsically disordered proteins J Proteome Res 6, 1917–1932 90 Wright PE & Dyson HJ (1999) Intrinsically unstructured proteins: re-assessing the protein structure-function paradigm J Mol Biol 293, 321–331 91 Shoemaker BA, Portman JJ & Wolynes PG (2000) Speeding molecular recognition by using the folding funnel: the fly-casting mechanism Proc Natl Acad Sci USA 97, 8868–8873 92 Meszaros B, Tompa P, Simon I & Dosztanyi Z (2007) Molecular principles of the interactions of disordered proteins J Mol Biol 372, 549–561 Intrinsic disorder in Par-4 93 Adzhubei AA & Sternberg MJ (1993) Left-handed polyproline II helices commonly occur in globular proteins J Mol Biol 229, 472–493 94 Williamson MP (1994) The structure and function of proline-rich regions in proteins Biochem J 297 (Pt 2), 249–260 95 Dunker AK, Cortese MS, Romero P, Iakoucheva LM & Uversky VN (2005) Flexible nets The roles of intrinsic disorder in protein interaction networks FEBS J 272, 5129–5148 96 Reeves R (1992) Chromatin changes during the cell cycle Curr Opin Cell Biol 4, 413–423 97 Reeves R & Beckerbauer L (2001) HMGI ⁄ Y proteins: flexible regulators of transcription and chromatin structure Biochim Biophys Acta 1519, 13–29 98 Scopes RK (1974) Measurement of protein by spectrophotometry at 205 nm Anal Biochem 59, 277–282 99 Schagger H & von JagowG (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from to 100 kDa Anal Biochem 166, 368–379 100 van Stokkum IH, Spoelder HJ, Bloemendal M, van Grondelle R & Groen FC (1990) Estimation of protein secondary structure and error analysis from circular dichroism spectra Anal Biochem 191, 110– 118 101 Wishart DS, Bigam CG, Yao J, Abildgaard F, Dyson HJ, Oldfield E, Markley JL & Sykes BD (1995) 1H, 13 C and 15N chemical shift referencing in biomolecular NMR J Biomol NMR 6, 135–140 102 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs Nucleic Acids Res 25, 3389– 3402 103 Thompson JD, Higgins DG & Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice Nucleic Acids Res 22, 4673–4680 104 Hamiaux C, Perez J, Prange T, Veesler S, Ries-Kautt M & Vachette P (2000) The BPTI decamer observed in acidic pH crystal forms pre-exists as a stable species in solution J Mol Biol 297, 697–712 105 Kabsch W, Mannherz HG, Suck D, Pai EF & Holmes KC (1990) Atomic structure of the actin:DNase I complex Nature 347, 37–44 106 Vijay-Kumar S, Bugg CE & Cook WJ (1987) Structure of ubiquitin refined at 1.8 A resolution J Mol Biol 194, 531–544 107 Matthews DA, Dragovich PS, Webber SE, Fuhrman SA, Patick AK, Zalman LS, Hendrickson TF, Love RA, Prins TJ, Marakovits JT et al (1999) Structureassisted design of mechanism-based irreversible FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS 3727 Intrinsic disorder in Par-4 D S Libich et al inhibitors of human rhinovirus 3C protease with potent antiviral activity against multiple rhinovirus serotypes Proc Natl Acad Sci USA 96, 11000–11007 Supporting information The following supplementary material is available: Fig S1 Volume distribution representation from DLS results of rrPar-4 constructs 3728 This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors FEBS Journal 276 (2009) 3710–3728 ª 2009 The Authors Journal compilation ª 2009 FEBS ... (2006) Androgen receptor and prostate apoptosis response factor- 4 target the Intrinsic disorder in Par -4 36 37 38 39 40 41 42 43 44 45 46 47 48 49 c-FLIP gene to determine survival and apoptosis in. .. C-terminal segment, including the androgen receptor [35], F-actin [36], 14- 3-3 [26] and the SPRY domain-containing suppressor of cytokine signalling box proteins 1, and [37] Par -4 contains several... observed in folded proteins, rrPar-4FL, rrPar-4DLZ and rrPar4SAC are depleted in order-promoting amino acids and enriched in disorder promoting residues (Fig 3B) The lack of hydrophobic residues inhibits