Efficient inhibition of b-secretase gene expression in HEK293 cells by tRNA Val -driven and CTE-helicase associated hammerhead ribozymes Barbara Nawrot 1 , Slawomir Antoszczyk 1 , Maria Maszewska 1 , Tomoko Kuwabara 2 , Masaki Warashina 2 , Kazunari Taira 2 and Wojciech J. Stec 1 1 Centre of Molecular and Macromolecular Studies, Polish Academy of Sciences, Department of Bioorganic Chemistry, Lodz, Poland; 2 Gene Function Research Laboratory, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba Science City, Japan The b-amyloid peptide (Ab) is a major component of toxic amyloid plaques found in the brains of patients with Alzheimer’s disease. Ab is liberated by sequential cleavage of amyloid precursor protein (APP) by b-andc-secre- tases. The level of Ab depends directly on the hydrolytic activity of b-secretase. Therefore, b-secretase is an excel- lent target for drug design. An approach based on RNA- cleaving ribozymes was developed to control expression of b-secretase. Two sites of mRNA coding b-site APP cleaving enzyme were chosen as target sequences for endogenously delivered ribozymes. The ribozyme cassette was designed to constitute a catalytic hammerhead core and substrate recognition arms, flanked at the 5¢-terminus by tRNA Val and at the 3¢-terminus by constitutive transport element sequences. Ribozyme cassettes were cloned into a pUC19 plasmid and used for transient transfection of HEK293 cells. We demonstrate that such ribozymes efficiently inhibit b-secretase gene expression at both the mRNA (up to 95%) and the protein (up to 90%) levels. Inhibition of b-site APP cleaving enzyme activity directly influences the intra- and extracellular population of Ab peptide. Therefore, such ribozymes may be considered as molecular tools for silencing the b-secretase activity, and further, as therapeutic agents for anti-amyloid treatment. Keywords: Alzheimer’s disease; hammerhead ribozyme; b-secretase. Alzheimer’s disease (AD) is a neurodegenerative disorder characterized by progressive deposition of senile plaques in the brain. The major component of these aggregates is a 4-kDa b-amyloid peptide (Ab), a product of proteolytic cleavage of the amyloid precursor protein (APP) [1]. The processing of the transmembrane precursor glycoprotein APP in vivo occurs by two different pathways. A conven- tional nonamyloidogenic pathway occurs via proteolytic cleavage of APP by a-andc-secretases and results in release of nontoxic soluble a-APP(s) protein and two other shorter products P3 and C7 [2,3]. In normal healthy individuals these products protect neuronal cells against oxidative stress and participate in wound repair [4–7]. Another kind of APP processing prevails in the brains of AD patients with ageing- related dementia. In such cases the cleavage of APP occurs on the amyloidogenic processing pathway. APP is cleaved at the N-terminus of the Ab region by b-secretase and at the C-terminus by c-secretase. The product of these cleavages is a 39–43-amino acid b-amyloid peptide. The major cleavage products are Ab40 and Ab42. According to the amyloid hypothesis, accumulation of Ab in the brain is the primary influence driving AD pathogenesis [8]. The gene encoding b-secretase was sequenced recently [9–13]. It is an aspartyl protease 2 (Asp2), also called b-site APP cleaving enzyme (BACE) or memapsin 2. Several approaches have been undertaken to find an effective inhibitor for human b-secretase activity [9,14–17]. The selectivity of peptidomi- metic inhibitors, however, is limited due to their affinity toward other cellular aspartyl proteases [14]. It has been shown that BACE knockout mice are healthy and show no phenotypic differences from their wild-type littermates [18,18a]. Cortical cultures from such mice showed no detectable b-secretase activity and much less Ab peptide. Inhibition of Ab generation by lowering the activity of the b-secretase may be beneficial for AD treatment. Therefore, Correspondence to B. Nawrot, Centre of Molecular and Macromolecular Studies, Polish Academy of Sciences, Department of Bioorganic Chemistry, Sienkiewicza 112, Lodz, Poland. Fax: + 48 42 681 5483, Tel.: + 48 42 681 6970, E-mail: bnawrot@bio.cbmm.lodz.pl Abbreviations:Ab, b-amyloid peptide/amyloid b-peptide; AD, Alzheimer’s disease; AP, alkaline phosphatase; APP, human amyloid precursor protein; BACE, b-site APP cleaving enzyme; CTE, constitutive transport element; DMEM, Dulbecco’s modified of Eagle medium; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HEK293, human transformed primary embryonal kidney cells; HEK293sw, HEK293 overexpressing human APP 695 with the Swedish double mutation; IMR-32, human neuroblastoma cells; pol III, RNA polymerase III; RNAi, RNA interference; SiRNA, small interfering RNA. Dedication: This work is dedicated to Prof. Maciej Wiewiorowski on the occasion of his 85th birthday. (Received 15 May 2003, revised 14 July 2003, accepted 7 August 2003) Eur. J. Biochem. 270, 3962–3970 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03784.x b-secretase is an excellent target for anti-amyloid therapeu- tic drug design [19]. Hammerhead ribozymes are the smallest catalytic nucleic acids able to promote, in a sequence-specific manner, the cleavage of phosphodiester bonds in RNA. This ability makes ribozymes useful molecular tools for very selective degradation of mRNA and inhibition of expression of the genes of ÔunwantedÕ proteins. The successful selection of hammerhead ribozymes, active in human cell lines, allows application of a molecular approach to the design of novel therapeutics [20–22]. Up to now it has been demonstrated that plasmid encoded ribozymes coupled at their 5¢-ends with a tRNA Val gene sequence are expressed intracellularly with high efficiency [23]. Such ribozymes, when mimicking the 3¢-immature tRNA molecule, are recognized by the nuclear protein exportin-t (Xpo-t) and are exported efficiently from the nucleus to the cytoplasm [24–27]. Conjugation of the 3¢-end of the ribozymes with a consti- tutive transport element (CTE) sequence, which is an aptameric sequence for cellular helicases [28–30], leads to the formation of ribozymes highly active in cellular experi- ments, independent of the secondary structure of the target mRNA [31]. The present work demonstrates an application of endo- genously generated tRNA Val -driven and CTE helicase- associated hammerhead ribozymes as efficient molecular tools for the inhibition of the biosynthesis of b-secretase and for the exclusion of the formation of toxic b-amyloid peptides in HEK293 cells. Materials and methods Construction of plasmids for ribozyme expression Two sites of a b-secretase mRNA (b-site APP cleaving enzyme, BACE, Gene Bank number: AF190725, start codon 5¢-AUG 456 -3¢) were chosen as targets for the hammerhead ribozymes, namely the 5¢-GUC 665 -3¢ and 5¢-CUC 825 -3¢ sequences. Templates containing the hammer- head catalytic sequence, complementary to the selected target sites of BACE mRNA, were synthesized chemically. The sequence of the template encoding ribozyme Rz-1 (directed toward cleavage of the GUC 665 containing sequence) is 5¢-CGGTTCGAAACCGGGCACTACAAA AACCAACTTTGCCCTGCCCCCTGATGAGGCCGA AAGGCCGAAACTTGCCCCTGGTACCCCGGATAT CTTTTTTTCTATCGCGTCGACCT-3¢ and the template encoding Rz-2 (targeted toward CUC 825 containing sequence) is 5¢-CGGTTCGAAACCGGGCACTACAAA AACCAACTTTCACCCTTCCGCTGATGAGGCCGA AAGGCCGAAAGGTCCCGGTGGTACCCCGGATA TCTTTTTTTCTATCGCGTCGACCT-3¢. The ribozyme templates were PCR amplified with primers P1: 5¢-TTCCC GGTTCGAAACCGGGCACTAC-3¢ and P2: 5¢-CTGCA GGTCGACGCGATAGAAAAAAA-3¢. PCR products were digested with KpnIandCsp45I restriction endonuc- leases and were ligated with pUC-KE-tRNA-CTE plasmids that had been digested with both KpnIandCsp45I and treated with calf intestinal alkaline phosphatase. The sequencing was carried out on an ABI PRISM instrument with the PCR primer P7 (5¢-CGCCAGGGTTTTCCCAGT CACGAC-3¢). Oligonucleotides were synthesized in house or purchased from ESPEC Custom Oligo Service, Japan. Plasmids pUC-KE-tRNA-CTE-Rz-1 and pUC-KE-tRNA- CTE-Rz-2, encoding Rz-1 and Rz-2, respectively, were obtained on a multimilligram scale. Constructs containing inactive versions of Rz-1 and Rz-2 were obtained in the same way by using templates as described above but in which the guanosine nucleotides, marked in bold, had been replaced by adenosine nucleotides. Cell culture, transfection and cell lysis Human transformed primary embryonal kidney cell lines HEK293 and HEK293sw (a kind gift from D. Selkoe, Harvard Medical School, Boston, MA, USA) were cultured in Dulbecco’s modification of Eagle’s medium (DMEM, Sigma), supplemented with 10% foetal bovine serum (Gibco BRL), 100 lgÆmL )1 streptomycin and 100 UÆmL )1 penicillin. G418 (200 lgÆmL )1 , Gibco BRL) was used as selection antibiotics for HEK293sw cells. Glass wells were coated with poly L -lysine (Sigma-Aldrich Chemie GmbH). IMR-32 cells were grown in RPMI supplemented with 20% fetal bovine serum and 1% minimal essential medium non essential amino acid (Gibco BRL) and antibiotics as above. Glass wells were coated with fibronectin (2 lgÆcm )2 ,Sigma). Cells were grown in monolayer, at 37 °C in an atmosphere of 5% CO 2 in 10-cm plates and transfected at  70% confluence. Transfection with 40 lg of the ribozyme- containing plasmid was carried out for 12 h using the Lipofectin TM reagent (Gibco BRL) according to the manu- facturer’s protocol. Postincubation was carried out in DMEM for the next 24 h or longer (up to 264 h). Culture medium was collected and frozen at )70 °C. Cells were washed three times with Ca +2 /Mg +2 -free NaCl/P i and lysed with Tri Pure Isolation Reagent (Boehringer Mann- heim). Lysates were kept at )70 °C. Isolation of a total RNA from cell lysates The total RNA fraction was isolated from cell lysates according to the Tri Pure Isolation Reagent protocol (Boehringer Mannheim). The nucleic acid fraction was then treated with RQ1 RNase-free DNase (Promega) and isolated by phenol/chloroform extraction followed by ethanol precipitation. The total RNA was quantified spectrophotometrically at 260 nm. Samples were kept at )70 °C for several months without any decomposition of the RNA. Determination of the level of BACE mRNA and ribozyme RNA expression in mammalian cells The level of BACE mRNA and ribozyme RNA was monitored by RT/PCR using a OneStep RT/PCR kit (Qiagen). For determination of the level of ribozyme RNA the RT/PCR was carried out with two vector primers P1 and P2 (20 l M ) and total RNA (0.5 lg). For BACE mRNA level determination the specific BACE gene primers were designed to give a PCR product 430 nucleotides. RT primer (5¢-GCCTTCCCAGTTGGAGCCGTTGAT-3¢,P1 BACE ), PCR primer (5¢-CGCAGCGGCCTGGGGGGCGCCC C-3¢,P2 BACE ) and total RNA (0.5 lg) were used for the RT/PCR reaction. PCR was programmed for 30 cycles. The Ó FEBS 2003 Inhibition of b-secretase gene expression (Eur. J. Biochem. 270) 3963 reaction product was analysed by 3% NuSieve GTG agarose (FMC BioProducts) gel electrophoresis and stained with ethidium bromide. For experiments performed in co- amplification conditions two pairs of primers P1 BACE and P2 BACE ,forBACEmRNA(20l M ), and P1 GAPDH and P2 GAPDH , for the control glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1.3 l M )wereused. Western blotting HEK293 cells that had been transfected with ribozyme- expression plasmids were lysed with Tri Pure Isolation Reagent according to the manufacturer’s protocol. The protein fraction was isolated and 200 lgsamplewas analysed by SDS/PAGE (12% acrylamide). After electro- phoresis, protein bands were transferred to a poly(vinylid- ene difluoride) membrane (Millipore). The membrane was blocked with 5% nonfat milk in NaCl/Tris containing 0.1% NaN 3 , probed with primary rabbit polyclonal antibodies M83 (Santa Cruz) against BACE for 1.5 h at 37 °C (dilution 1 : 500) and then with secondary anti-rabbit polyclonal IgG–alkaline phosphatase (AP; Santa Cruz) for 1.5 h at room temperature (dilution 1 : 500). Bands were visualized by addition of Nitro Blue tetrazolium and 5-bromo-4-chloroindol-3-yl phosphate (Sigma-Aldrich Chemie GmbH) in 100 m M Tris/HCl pH 9.5 buffer con- taining 100 m M NaCl and 5 n M MgCl 2 . Immunoprecipitation of b-amyloid peptide and dot blot analysis The level of b-amyloid peptide in conditioned cultured medium and in cells was determined by immunoprecipita- tion and dot blot analysis. Conditioned medium was collected from the ribozyme-transfected HEK293 cell cul- ture postincubated for 48 or 60 h. Conditioned medium from cells transfected with lipofectin only was used as a control. The conditioned medium (1 mL) was subjected to a preclearing process by treatment with Protein A Sepharose 4 Fast Flow (50 lL, 50% slurry, Amersham Pharmacia Biotech AB). Immunoprecipitation of the b-amyloid pep- tide Ab40 with primary rabbit polyclonal antibody Anti- b-Amyloid 40 (BioSource International Inc.) was performed according to the Immunoprecipitation Starter Pack proto- col (Amersham, Pharmacia Biotech AB). For antigene– antibody complex precipitation Protein A Sepharose 4 Fast Flow was added (50 lL, 50% slurry) to the precleared conditioned medium (500 lL). The complex was washed three times with lysis buffer (NP-40) and once with wash buffer (50 m M Tris, pH 8.0). The pellet was suspended in reducing buffer (1% SDS, 100 m M dithiothreitol, 50 m M Tris pH 7.5), heated for 3 min at 95 °C and centrifuged at 12 000 g for 20 s. Supernatant (5 lL)wasappliedtoa cellulosenitrate (E) membrane (Schleicher & Schuell). The membrane was dried, washed in NaCl/Tris and incubated in 5% nonfat milk for 1.5 h at room temperature. After saturation the membrane was washed twice with NaCl/Tris and then treated with the secondary anti-rabbit IgG conjugated with AP (Santa Cruz Biotechnology) for 1.5 h at room temperature. After three washes in NaCl/Tris supplemented with 0.04% Tween 20, and once with AP buffer (100 m M Tris pH 9.5, 100 m M NaCl), the membrane was incubated with Nitro Blue tetrazolium and 5-bromo-4- chloroindol-3-yl phosphate and washed finally with ddH 2 O. Immunoprecipitation of b-amyloid peptide Ab40 from the ribozyme-transfected HEK293 cells postincubated for 48 or 60 h was performed as follows. Cultured cells were lysed with Tri Pure Isolation Reagent according to the manufacturer’s protocol. The preclearing process of the cell protein extract (100 lg of protein in 500 lLof extract) was carried out as described above. Immuno- precipitation and determination of the intracellular level of Ab40 was carried out according to the procedure described above. Synthetic b-amyloid peptide, fragment 1–40 (Sigma- Aldrich Chemie GmbH) (100 ng) was used as a control for the dot blotting process and for quantification of the immunoprecipitation level. The blots were quantified by using the IMAGE QUANT program. Results Design of ribozymes Ribozymes with a hammerhead catalytic core possess the ability to cleave substrate RNA after the 5¢-NHH-3¢ sequence, where N is A, U, C or G and H is A, U or C [32], with the most efficient cleavage of the substrate possessing the triplet GUC or CUC [23]. The messenger RNA of BACE, which functions as a b-secretase in the process of releasing Ab, was selected as our target molecule. Two sites of the BACE mRNA were chosen for hammer- head cleavage: 5¢-GUC 665 -3¢ and 5¢-CUC 825 -3¢. The lowest energy secondary structure of BACE mRNA, generated with the help of the MFOLD program [33] shows that the 5¢-GUC 665 -3¢ target sequence is not involved in hydrogen bonding. However, the availability of the 5¢-CUC 825 -3¢ triplet, which is the target sequence for Rz-2, as well as the availability of the recognition arms of both substrates, are rather poor for hybridization with ribozymes. To overcome the problem of target/ribozyme involvement within the intramolecular hydrogen bonding, we took advantage of our recent achievements in the design of ribozymes with significantly improved intracellular activity [23–26,31]. First, we applied tRNA Val -driven ribozymes. An intra- cellular transcription of such tRNA Val -driven ribozymes is performed by the RNA polymerase III (pol III) system and provides a high level of endogenous ribozyme expression. Moreover, in somatic cells, the transport of tRNA- mimicking transcripts of ribozymes from nucleus to cyto- plasm is facilitated by Xpo-t [27]. Such ribozymes exhibit significantly higher cytoplasmic activity due to their colocal- ization with the target mRNA. The tRNA-driven ribozymes were flankedon their5¢-endsby a tRNA Val motif [25]. Thelast seven bases of the wild-type mature tRNA Val were replaced by a linker 5¢-ACUACAAAAACCAAC-3¢ sequence, which prevents the processing of the 3¢-end of the transcript and secures cloverleaf secondary structure of the tRNA motif. Extension of the linker by the three additional uridine nucleotides allowed us to design ribozymes with the required secondary structure, as generated by MFOLD . To ensure the efficacy of endogenously generated cata- lytic nucleic acids our hammerhead ribozymes were exten- ded at their 3¢-termini with a CTE sequence. The CTE motif 3964 B. Nawrot et al. (Eur. J. Biochem. 270) Ó FEBS 2003 was identified as the aptameric RNA sequence for cellular RNA helicases [28–30]. It has already been shown that attachment of a CTE sequence to the ribozyme cassette results in significant improvement of ribozyme efficacy [31]. The intracellular helicase-associated ribozyme possesses an ability to unwind double-stranded sequences of the mes- senger RNA and facilitates the change of mechanism by which the ribozyme searches for its target site. With such a hybrid sequence the ribozyme reaches its target site by the sliding mechanism used by cellular helicases. This pheno- menon significantly improves the efficacy of protein-hybrid ribozymes, due to the ability of such complexes to guide the ribozyme to its target site. Expression of ribozyme plasmids in mammalian cells Three cultured cell lines HEK293, HEK293sw and IMR-32 were used to study the expression of ribozymes, which were cloned into pUC-KE-tRNA-CTE plasmids. Ribozyme encoding plasmids were transiently transfected into the tested cells with the aid of lipofectin. Expression of the ribozymes was observed in the course of time. The nucleic acid fraction, isolated from cell lysates, was treated with RNase-free DNase I to remove traces of plasmid DNA, and the total RNA was used as a reverse transcription template for semiquantitative RT/PCR analysis of the level of ribozyme RNA in the cells. Amplification of pUC-KE- tRNA-CTE-Rz-1 and Rz-2 plasmids gave an expected 295- bp product (Fig. 1, lanes 2 and 4, respectively). When RT/ PCR was carried out with an exclusion of the reverse transcription step, the reaction did not yield the corres- ponding amplification product (lanes 1 and 3). This result confirmed that the RT/PCR product of the expected length did originate from the cellular RNA fraction, and not from plasmid DNA amplification. Similar results were obtained while monitoring an expression of ribozyme plasmids pUC-KE-tRNA-CTE- Rz-1 and Rz-2 in IMR-32 and HEK293sw cells, although the level of ribozyme RNA present in the lysates was significantly lower ( 60% and  20%, respectively, data not shown). This could be caused by decreased transfection efficiency and/or by a low ribozyme expression efficiency in the genetically changed HEK293sw cells. The expression of pUC-KE-tRNA-CTE-Rz-1 in HEK293 cells was also observed over a longer time interval (Fig. 2). As expected for transient transfection of the plasmid, the expression of ribozyme reached its maximum after 24 h of postincubation. The level of ribozyme signi- ficantly decreased during the following 24 h, but even after 11 days we could still detect traces of ribozyme RNA (data not shown). Activity of ribozymes in HEK293 cells At first we checked the activity of the ribozymes by determining the level of the target mRNA in tested cells transfected with ribozyme encoding plasmids. Two sites of BACE mRNA, 5¢-GUC 665 -3¢ and 5¢-CUC 825 -3¢,were selected as target sequences for ribozymes Rz-1 and Rz-2, respectively. Specific primers for the RT/PCR (P1 BACE and P2 BACE ) were designed in such a way that ribozyme degradation sites were included within the amplified BACE mRNA sequence. The amplification product was expected to be 430 bp DNA. As the expression of b-secretase in HEK293 cells is rather low [12,13] it was necessary to determine the number of the PCR cycles suitable for monitoring the changes of the BACE mRNA level. Under standard RT/PCR conditions (0.5 lgtotalRNAand20l M primers) it was possible to observe the appearance of the Fig. 1. Expression of pUC-KE-tRNA-CTE-Rz-1 and Rz-2 plasmids in HEK293 cells determined by semiquantitative RT/PCR. Ribozyme encoding plasmids were transiently transfected into the cells. Thirty-six hours after transfection, the nucleic acid fraction was isolated from cell lysates, treated with RNase-free DNase I and used in RT/PCR. The reaction products were analysed by electrophoresis through 3% agarose and stained with ethidium bromide. As expected, 295-bp products of reverse transcription and PCR amplification of Rz-1 and Rz-2 plasmids with specific vector primers P1 and P2 (see Materials and methods) were obtained (lanes 2 and 4, respectively). When RT/ PCR was performed without a reverse transcription step, the reaction did not yield the corresponding amplification product (lanes 1 and 3). Fig. 2. Semi-quantitative analysis of expression of the pUC-KE-tRNA- CTE-Rz-1 plasmid in HEK293 cells over time. After transfection with Rz-1 plasmid, HEK293 cells were lysed 0, 6, 12, 24, 36 and 48 h post incubation. The total RNA fraction was isolated from the cell lysates, treated with RNase-free DNase I and used in RT/PCR. At postincu- bation time 0 h (12 h after the beginning of transfection, see Materials and methods) only a minimal amount of ribozyme RNA was present in the cell lysates. The level of ribozyme increased with time and reached its maximum 24 h after transfection. The expression of GAPDH mRNA was monitored as internal control. Ó FEBS 2003 Inhibition of b-secretase gene expression (Eur. J. Biochem. 270) 3965 430-bp product only after more than 25 PCR cycles. With more than 30 PCR cycles the amount of amplification product reached a plateau. Thus, in our RT/PCR protocol we used 30 PCR cycles as the standard. The mRNA of the GAPDH protein was amplified as a control. Primers for amplification of GAPDH (P1 GAPDH and P2 GAPDH )were designed to give a 150-bp product. In co-amplification RT/PCR conditions the concentration of primers P1 GAPDH and P2 GAPDH was  15 times lower than primers P1 BACE and P2 BACE . The HEK293 cells were transfected with plasmids encoding Rz-1, Rz-2 and with their inactive versions (Rz-1i and Rz-2i). Transfections of the cells with lipofectin (NO) only or lipofectin and an empty plasmid (EM) were used as controls. The level of the RT/PCR products was determined under co-amplification conditions 36 h after transfection. Figure 3 shows an agarose gel electrophoresis of the RT/PCR products from different transfection experiments. While the level of the 150-bp control product is constant for all six experiments (and below the saturation of the PCR reaction) we could observe no or very little BACE mRNA amplification product (430 bp) for experi- ments where the Rz-1 and Rz-2 plasmids were used. However, no significant lowering of the BACE amplifica- tion product was observed for experiments where inactive forms of ribozymes were used. The level of BACE mRNA in Rz-1 transfected HEK293 cells was also monitored in the course of time under single gene amplification RT/PCR conditions (Fig. 4). Cells were lysed after 6, 12, 24, 36 and 48 h of the postincubation time. The level of GAPDH mRNA was determined in parallel separate experiments. The amount of amplification product decreased for the first 24 h after transfection, when it reached < 5% of the control BACE mRNA expressed in the cells transfected with lipofectin only (NO) and lysed after 48 h. Over the next several hours we observed an increase of the BACE mRNA level because of the lower expression of ribozyme. A similar profile of the target mRNA was obtained for the cells transfected with the Rz-2 plasmid (data not shown). Effect of ribozyme expression on BACE protein and b-amyloid peptide levels To examine whether transiently expressed ribozymes affect the amount of b-secretase gene expression on the protein level, Western blotting analyses were performed. The test cells were transfected with Rz-1 and Rz-2 encoding plasmids and after 36 h of postincubation the protein fraction was isolated from the cells and subjected to analysis. As shown in Fig. 5 the extent of protein expression is much lower in the HEK293 cells treated with Rz-1 ( 5%) and with Rz-2 ( 10%) plasmids in comparison to the amount of BACE in the control transfected cells. A protein mixture of known molecular mass was used as a marker to establish the band of BACE protein with a molecular mass of  70 kDa. As our ribozyme constructs were active in the cellular system and efficiently inhibited biosynthesis of b-secretase Fig. 3. Expression of BACE and GAPDH mRNA in HEK293 cells transfected with ribozyme plasmids monitored by RT/PCR. Plasmids encoding Rz-1, Rz-2 and their inactive versions Rz-1i and Rz-2i were used for cell transfection. As controls, only lipofectin (NO) or lipo- fectin and an empty plasmid (EM) were used. The level of the RT/PCR products was determined under co-amplification conditions 36 h after transfection. An agarose gel electrophoresis of the RT/PCR products demonstrates that the level of the 150-bp control product is constant for all six experiments, while no or very little BACE mRNA amplifi- cation product (430 bp) is observed for experiments where the Rz-1 and Rz-2 plasmids were used. Fig. 4. The level of BACE mRNA in HEK293 cells transfected with pUC-KE-tRNA-CTE-Rz-1 monitored over time under noncompetitive RT/PCR conditions. Cells were lysed 6, 12, 24, 36 and 48 h post incubation. The level of GAPDH mRNA was determined in parallel separate experiments. The amount of amplification product decreased for the first 24 h after transfection, when it reached less than 5% of the control BACE mRNA expression in the cells transfected with lipo- fectin only (NO) and lysed after 48 h. Fig. 5. Effect of ribozyme expression on BACE protein level in HEK293 cells. The test cells were transfected with Rz-1 and Rz-2 encoding plasmids and 36 h postincubation the protein fraction was isolated from the cells and subjected to Western blotting analysis. The extent of protein expression is much lower in the HEK293 cells treated with Rz-1 ( 5%) and with Rz-2 ( 10%) plasmids relative to the amount of BACE in the control transfected cells (NO, EM, Rz-1i and Rz-2i). 3966 B. Nawrot et al. (Eur. J. Biochem. 270) Ó FEBS 2003 we asked the question whether we could observe any difference in the level of extra- and intracellular release of b-amyloid peptide, which is a product of the catalytic activity of the target protein. Our efforts to use Western blot analysis for detection of the presence of 4-kDa b-amyloid peptide in the cell extracts, or in the conditioned cultured medium, even using as much as 300 lg of the protein fraction, were unsuccessful. This was probably because of the very low level of b-amyloid peptide in the test cells [2,3]. Thus, we performed immunoprecipitation of the b-amyloid peptide Ab40 either from cell lysates or from conditioned cultured medium. The immunoprecipitation reaction was performed with primary rabbit polyclonal antibody (Anti- b-Amyloid 40). Detection of the Ab/Ab40 complex was per- formed by treatment of the membrane with the secondary anti-(rabbit IgG AP) Ig followed by dot blot visualization with Nitro Blue tetrazolium and 5-bromo-4-chloro- indol-3-yl phosphate reagents. A synthetic b-amyloid peptide, fragment 1–40, was used as a control in immuno- precipitation experiments. In cell cultures transfected with our ribozyme constructs the level of extra- and intracellular Ab peptide was significantly decreased. Figure 6 shows the data for the extracellular level of the Ab peptide 48 and 60 h after transfection of the HEK293 cells with the Rz-1 and Rz-2 encoding plasmids. Forty-eight hours after transfection the amount of Ab peptide reached the level of  65% and  40%, respectively, for cells transfected with Rz-1 and Rz-2, in comparison to the level of a control experiment with lipofectin only transfected cells. A further decrease of the Ab level up to 20% was observed in the following 12 h. However, the intracellular level of Ab peptide decreased only up to  60% during 60 h after transfection with Rz-1 and Rz-2 plasmids in comparison to the control lipofectin only transfection (data not shown). Discussion Engineered ribozymes are of great interest as modern therapeutic agents due to their potential to specifically and efficiently inhibit either ÔunwantedÕ proteins or viral RNA gene expression via catalytic hydrolysis of specific internu- cleotide bonds of the target RNA. The functional activity of endogenously delivered ribozymes depends on many factors including their intracellular concentration, an effective export from the nucleus to the cytoplasm, a colocalization of the ribozyme with the target RNA and the availability of the target sites for enzymatic cleavage. Computer-generated secondary structures of long messenger RNAs suggest their poor availability for association with complementary strands, such as ribozyme and antisense oligonucleotides. We have used tRNA Val -driven CTE-conjugated hammer- head ribozyme cassettes, recently designed by one of our laboratories [24–27,31]. These engineered hammerhead ribozymes fulfil the requirements to be active in a cellular system independently of the secondary structure of the target mRNA. As the target molecule we have chosen the gene for human b-secretase, which is an aspartyl protease Asp2, also called BACE protein or memapsin 2 [9–13]. This protein is involved in proteolytic cleavage of an amyloid precursor protein APP, and directly influences the release of the toxic b-amyloid peptide. Ab is thought to be a primary patho- genic agent in AD [1]. It was found as a main component of the aggregates leading to ageing dementia. There are many approaches to reduce the level of the b-amyloid peptide. It was thought that inhibition of expression of APP by antisense oligonucleotides might be of interest for therapeutic application [34]. However, because of the functional importance of nonamyloidogenic APP secretion products in healthy individuals this approach does not seem to be suitable. Another approach to the reduction of Ab formation utilizes an application of noncleavable analogues of BACE substrates [14–17]. Several differently modified short peptides were chemically synthes- ized and used successfully for inhibition of b-secretase activity. However, there are several other aspartyl proteases present in cells [19]. Some of them, e.g. cathepsin D, show quite remarkable affinity for BACE inhibitors [14]. Thus, there is still a need for novel molecular tools which would be able to effectively reduce the level of BACE protein, and in consequence, to reduce the amount of Ab peptide released in neuronal cells. We asked the question whether we can inhibit expres- sion of the gene of BACE protein using our engineered ribozymes. In order to check the potential of plasmid coded ribozymes for cleavage of the target sequence we performed an in vitro cleavage reaction of the short 5¢-radioactively labelled RNA substrates (25-mers) with ribozymes obtained by an in vitro transcription. As expected, both ribozymes transcripts exhibit potential for cleaving their short complementary RNA targets (data not shown). Although the highest level of expression of BACE protein was identified in the neuronal cells of the brain, for preliminary experiments we have chosen human embryonal kidney (HEK293) cells as well as HEK293sw cells overex- pressing APP with a Swedish mutation and IMR-32 human Fig. 6. Effect of Rz-1 and Rz-2 activity on the extracellular level of b-amyloid peptide. b-Amyloid peptide Ab40 was immunoprecipitated from the conditioned cultured medium collected 48 and 60 h after transfection of HEK293 cells with the test ribozyme plasmids. Forty- eight hours after transfection, the amount of Ab peptide reached the level of  65% and  40%, respectively, for cells transfected with Rz-1 and Rz-2, relative to the level of a control experiment with lipofectin only transfected cells (first three bars). Further decrease of the Ab level, to below 20%, was observed in the following 12 h (second three bars). Ó FEBS 2003 Inhibition of b-secretase gene expression (Eur. J. Biochem. 270) 3967 neuroblastoma cells. Ribozyme cassettes were introduced into the bacterial plasmid pUC-KE and used for transfec- tion of the test cells. Intracellularly generated ribozyme transcripts were identified in the cell extracts, as shown in Figs 1 and 2. Our goal was to downregulate endogenous BACE mRNA and the target protein as well as to prevent b-amyloid peptide formation. We were able to demonstrate by semiquantitative RT/PCR that an increasing amount of expressed ribozyme directly influences the intracellular level of endogenous BACE mRNA (Fig. 7). The maximum level of ribozyme expression occurs 24 h after transfection, while after that time the expression of BACE mRNA reaches a minimum ( 5%). Typically, for transient transfection the level of expressed ribozyme drops down; however, it could be still detected by RT/PCR even 11 days after transfection. Expression of ribozymes in the other two test cell lines was limited to 60% and 20%, respectively, for the IMR-32 and HEK293sw cells. This could be caused by the different efficiency of the plasmids in the transfection of the test cells or by low ribozyme expression efficiency in the genetically changed HEK293sw cells. As a consequence, the low level of ribozyme expression significantly reduced the efficiency of the BACE mRNA degradation (data not shown). Probably a much bigger amount of ribozyme plasmids should be used for transfection of HEK293sw and IMR-32 cells to reach satisfactory inhibition of BACE expression. The decreased amount of BACE mRNA in HEK293 cells led to the lower biosynthesis of this protein (up to 90%), as monitored 36 h after transfection (Fig. 5). Lowering of BACE amount should directly result in decreased amount of APP cleavage products (b-amyloid peptide, N-terminal b-APPs and b-CTF fragment). Immuno- precipitation of Ab from cell lysates as well as from cell culture medium 48 and 60 h after transfection showed significantly decreased amounts of both the intra- and extracellular b-amyloid peptide in comparison to the Ab isolated from control lipofectin only transfected cells. Functional effects of hammerhead ribozymes as well as their inactive forms were not tested for their influence on the level of other APP proteolysis products. However, as reported earlier, lowering of BACE expression results in lowering of the released amount of Ab, b-APPs and b-CTF fragments [9,11,18]. Although the downregulation of BACE is only partial and transient, it is necessary to test whether our ribozyme constructs are effective for BACE gene silencing and reduction of the level of the toxic b-amyloid peptides in neuronal cell lines. Further experiments on APP transgenic mouse, exhibiting an elevated level of b-amyloid peptide [35], are needed to demonstrate in vivo activity of such ribozymes. The tRNA Val -driven and CTE-coniugated ribo- zymes directed toward murine BACE mRNA are under preparation in our laboratories. Our results kindle some hopes that such hammerhead ribozymes may be used as molecular tools for the specific inhibition of b-secretase activity. Recently, there is growing interest in RNA interference (RNAi) phenomena [36,37]. The power of RNAi is remarkable, because it can serve as a very efficient sequence-specific tool for gene silencing. RNAi is a valuable therapeutic tool for drug design and operates in the cytoplasm. It is induced by small interfering RNAs (siRNAs), which are the products of a double-stranded RNA cleavage by a nuclease dicer [38]. Selective inactivation of genes for BACE1 and BACE2 by siRNA was reported recently [39]. Up to now several expression systems have been designed for endogenous generation of siRNA [40–44]. As our tRNA-driven ribozyme transcripts are efficiently exported from the nucleus to the cytoplasm, where they meet their target mRNA, this expression system is of interest for endogenous generation of siRNA and activation of the RNAi effect in human cells [45]. Studies on an inhibition of BACE gene expression by endogenously generated siRNA via tRNA Val promotion are in progress in our laboratories. Acknowledgements This work was supported by Polish Committee for Scientific Research (project PBZ-KBN-059/T09/09) and European Commission (5th Framework Programme, NAS Complement to the project QLK6- CT-1999–02112). We thank Wieslawa Goss and Barbara Mikolajczyk for excellent technical assistance. References 1. Selkoe, D.J. (1991) The molecular pathology of Alzheimer’s disease. Neuron 6, 487–498. 2. Hendriks, L. & Van Broeckhoven, C (1996) A beta A4 amyloid precursor protein gene and Alzheimer’s disease. Eur. J. Biochem. 237, 6–15. 3. Haass, C. & Selkoe, D.J. (1993) Cellular processing of beta- amyloid precursor protein and the genesis of amyloid beta- peptide. Cell 75, 1039–1042. 4. Barger,S.W.,Fiscus,R.R.,Ruth,P.,Hofmann,F.&Mattson, M.P. (1995) Role of cyclic GMP in the regulation of neuronal calcium and survival by secreted forms of beta-amyloid pre- cursor. J. Neurochem. 64, 2087–2096. Fig. 7. Comparison of the level of BACE mRNA and Rz-1 RNA in HEK293 cells transfected with Rz-1 encoding plasmid as a function of time. Maximum expression of Rz-1 (white bars) is associated with the minimal level of BACE mRNA (grey bars) present in transfected cells, as monitored by RT/PCR. Reaction products were analysed by agarose gel electrophoresis (Figs 2 and 4, respectively) and computer assisted quantification. 3968 B. Nawrot et al. (Eur. J. Biochem. 270) Ó FEBS 2003 5. Kummer,C.,Wehner,S.,Quast,T.,Werner,S.&Herzog,V. (2002) Expression and potential function of beta-amyloid pre- cursor proteins during cutaneous wound repair. Exp. Cell Res. 280, 222–232. 6. Mattson, M.P., Cheng, B., Culwell, A.R., Esch, F.S., Lieberburg, I. & Rydel, R.E. (1993) Evidence for excitoprotective and intraneuronal calcium-regulating roles for secreted forms of the beta-amyloid precursor protein. Neuron 10, 243–254. 7. Mattson, M.P. & Furukawa, K. (1997) Alzheimer’s disease. Short precursor shortens memory. Nature 387, 457–458. 8. Hardy, J. & Selkoe, D.J. (2002) The amyloid hypothesis of Alz- heimer’s disease: progress and problems on the road to thera- peutics. Science 297, 2209. 9. Vassar,R.,Bennett,B.D.,Babu-Khan,S.,Kahn,S.,Mendiaz, E.A., Denis, P., Teplow, D.B., Ross, S., Amarante, P., Loeloff, R.,Luo,Y.,Fisher,S.,Fuller,J.,Edenson,S.,Lile,J.,Jarosinski, M.A.,Bier,A.L.,Curran,E.,Burgess,T.,Louis,J.C.,Collins,F., Treanor, J., Rogers, G. & Citron, M. (1999) Beta-secretase cleavage of Alzheimer’s amyloid precursor protein by the trans- membrane aspartic protease BACE. Science 286, 735–741. 10. Hussain,I.,Powell,D.,Howlett,D.R.,Tew,D.G.,Meek,T.D., Chapman, C., Gloger, I.S., Murphy, K.E., Southan, C.D., Ryan, D.M.,Smith,T.S.,Simmons,D.L.,Walsh,F.S.,Dingwall,C.& Christie, G. (1999) Identification of a novel aspartic protease (Asp 2) as beta-secretase. Mol. Cell Neurosci. 14, 419–427. 11. Yan, R., Bienkowski, M.J., Shuck, M.E., Miao, H., Tory, M.C., Pauley,A.M.,Brashier,J.R.,Stratman,N.C.,Mathews,W.R., Buhl, A.E., Carter, D.B., Tomasselli, A.G., Parodi, L.A., Hei- nrikson, R.L. & Gurney, M.E. (1999) Membrane-anchored aspartyl protease with Alzheimer’s disease beta-secretase activity. Nature 402, 533–537. 12. Sinha, S., Anderson, J.P., Barbour, R., Basi, G.S., Caccavello, R., Davis, D., Doan, M., Dovey, H.F., Frigon, N., Hong, J., Jacobson-Croak,K.,Jewett,N.,Keim,P.,Knops,J.,Lieberburg, I.,Power,M.,Tan,H.,Tatsuno,G.,Tung,J.,Schenk,D.,Seu- bert, P., Suomensaari, S.M., Wang, S., Walker, D., John, V. et al. (1999) Purification and cloning of amyloid precursor protein beta-secretase from human brain. Nature 402, 537–540. 13. Lin,X.,Koelsch,G.,Wu,S.,Downs,D.,Dashti,A.&Tang,J. (2000) Human aspartic protease memapsin 2 cleaves the beta- secretase site of beta-amyloid precursor protein. Proc.NatlAcad. Sci. USA 97, 1456–1460. 14.Ghosh,A.K.,Shin,D.,Downs,D.,Koelsch,G.,Lin,X., Ermolieff, J. & Tang, J. (2000) Design of potent inhibitors for human brain memapsin2 (b-secretase). J. Am. Chem. Soc. 122, 3522–3523. 15. Ghosh,A.K.,Bilcer,G.,Harwood,C.,Kawahama,R.,Shin,D., Hussain,K.A.,Hong,L.,Loy,J.A.,Nguyen,C.,Koelsch,G., Ermolieff, J. & Tang, J. (2001) Structure-based design: potent inhibitors of human brain memapsin 2 (beta-secretase). J. Med. Chem. 44, 2865–2868. 16.Turner,R.T.,III,Koelsch,G.,Hong,L.,Castanheira,P., Ermolieff, J., Ghosh, A.K. & Tang, J. (2001) Subsite specificity of memapsin 2 (beta-secretase): implications for inhibitor design. Biochemistry 40, 10001–10006. 17. Hong,L.,Koelsch,G.,Lin,X.,Wu,S.,Terzyan,S.,Ghosh, A.K., Zhang, X.C. & Tang, J. (2000) Structure of the protease domain of memapsin 2 (beta-secretase) complexed with inhibitor. Science 290, 150–153. 18. Roberds, S.L., Anderson, J., Basi, G., Bienkowski, M.J., Branstetter, D.G., Chen, K.S., Freedman, S.B., Frigon, N.L., Games, D., Hu, K., Johnson-Wood, K., Kappenman, K.E., Kawabe,T.T.,Kola,I.,Kuehn,R.,Lee,M.,Liu,W.,Motter,R., Nichols, N.F., Power, M., Robertson, D.W., Schenk, D., Schoor, M.,Shopp,G.M.,Shuck,M.E.,Sinha,S.,Svensson,K.A., Tatsuno, G., Tintrup, H., Wijsman, J., Wright, S. & McConlogue, L. (2001) BACE knockout mice are healthy despite lacking the primary beta-secretase activity in brain: implications for Alzhei- mer’s disease therapeutics. Hum. Mol. Genet. 10, 1317–1324. 18a. Luo, Y., Bolon, B., Kahn, S., Bennett, B.D., Babu-Khan, S., Denis,P.,Fan,W.,Kha,H.,Zhang,J.,Gong,Y.,Martin,L., Louis, J.C., Yan, Q., Richards, W.G., Citron, M. & Vassar, R. (2001) Mice deficient in BACE1, the Alzheimer’s beta-secretase, have normal phenotype and abolished beta-amyloid generation. Nat. Neurosci. 4, 231–232. 19. Citron, M. (2002) Beta-secretase as a target for the treatment of Alzheimer’s disease. J. Neurosci. Res. 70, 373–379. 20. Lewin, A.S. & Hauswirth, W.W. (2001) Ribozyme gene therapy: applications for molecular medicine. Trends Mol. Med. 7, 221–228. 21. Christoffersen, R.E. & Marr, J.J. (1995) Ribozymes as human therapeutic agents. J. Med. Chem. 38, 2023–2037. 22. Sullenger, B.A. & Gilboa, E. (2002) Emerging clinical applica- tions of RNA. Nature 418, 252–258. 23. Koseki, S., Tanabe, T., Tani, K., Asano, S., Shioda, T., Nagai, Y., Shimada, T., Ohkawa, J. & Taira, K. (1999) Factors gov- erning the activity in vivo of ribozymes transcribed by RNA polymerase III. J. Virol. 73, 1868–1877. 24. Miyagishi, M., Kuwabara, T. & Taira, K. (2001) Transport of intracellularly active ribozymes to the cytoplasm. Cancer Chemother. Pharmacol. 48, S96–S101. 25. Kuwabara, T., Warashina, M., Koseki, S., Sano, M., Ohkawa, J., Nakayama, K. & Taira, K. (2001) Significantly higher activity of a cytoplasmic hammerhead ribozyme than a corresponding nu- clear counterpart: engineered tRNAs with an extended 3¢ end can be exported efficiently and specifically to the cytoplasm in mammalian cells. Nucleic Acids Res. 29, 2780–2788. 26. Kato, Y., Kuwabara, T., Warashina, M., Toda, H. & Taira, K. (2001) Relationships between the activities in vitro and in vivo of various kinds of ribozyme and their intracellular localization in mammalian cells. J. Biol. Chem. 276, 15378–15385. 27. Kuwabara, T., Warashina, M., Sano, M., Tang, H., Wong-Staal, F., Munekata, E. & Taira, K. (2001) Recognition of engineered tRNAswithanextended3¢ end by Exportin-t (Xpo-t) and transport of tRNA-attached ribozymes to the cytoplasm in somatic cells. Biomacromolecules 2, 1229–1242. 28. Braun, I.C., Rohrbach, E., Schmitt, C. & Izaurralde, E. (1999) TAP binds to the constitutive transport element (CTE) through a novel RNA-binding motif that is sufficient to promote CTE-dependent RNA export from the nucleus. EMBO J. 18, 1953–1965. 29. Li,J.,Tang,H.,Mullen,T.M.,Westberg,C.,Reddy,T.R.,Rose, D.W. & Wong-Staal, F. (1999) A role for RNA helicase A in post-transcriptional regulation of HIV type. Proc. Natl Acad. Sci. USA 96, 709–714. 30. Tang, H., Gaietta, G.M., Fischer, W.H., Ellisman, M.H. & Wong-Staal, F. (1997) A cellular cofactor for the constitutive transport element of type D retrovirus. Science 276, 1412–1415. 31. Warashina, M., Kuwabara, T., Kato, Y., Sano, M. & Taira, K. (2001) RNA-protein hybrid ribozymes that efficiently cleave any mRNA independently of the structure of the target RNA. Proc. NatlAcad.Sci.USA98, 5572–5577. 32.Kore,A.R.,Vaish,N.K.,Kutzke,U.&Eckstein,F.(1998) Sequence specificity of the hammerhead ribozyme revisited; the NHH rule. Nucleic Acids Res. 26, 4116–4120. 33. Zucker, M. (1989) On finding all suboptional foldings of an RNA molecule. Science 244, 48–52. 34. Kumar, V.B., Vyas, K., Franko, M., Choudhary, V., Buddhiraju, C., Alvarez, I. & Morley, J.E. (2001) Molecular cloning, expres- sion, and regulation of hippocampal amyloid precursor protein of senescence accelerated mouse (SAMP8). Biochem. Cell Biol. 79, 57–67. Ó FEBS 2003 Inhibition of b-secretase gene expression (Eur. J. Biochem. 270) 3969 35. Irizarry, M.C., McNamara, M., Fedorchak, K., Hsiao, K. & Hyman, B.T. (1997) APPsw transgenic mice develop age-related A beta deposits and neuropil abnormalities, but no neuronal loss in CA1. J. Neuropathol. Exp. Neurol. 56, 965–973. 36. Fire,A.,Xu,S.,Montgomery,M.K.,Kostas,S.A.,Driver,S.E. & Mello, C.C. (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806–811. 37. Elbashir, S., Lendeckel, W. & Tuschl, T. (2001) RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15, 188–200. 38. Bernstein, E., Caudy, A.A., Hammond, S.M. & Hannon, G.J. (2001) Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409, 363–366. 39.Basi,G.,Frigon,N.,Barbour,R.,Doan,T.,Gordon,G., McConlogue, L., Sinha, S. & Zeller, M. (2003) Antagonistic effects of BACE1 and BACE2 on Abeta production in cells. J. Biol. Chem. 278, 31512–31520. 40.Paddison,P.J.,Caudy,A.A.,Bernstein,E.,Hannon,G.J.& Conklin, D.S. (2002) Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells. Genes Dev. 16, 948–958. 41. Brummelkamp, T.R., Bernards, R. & Agami, R. (2002) A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550–553. 42. Sui,G.,Soohoo,C.,Affar,E.,Gay,F.,Shi,Y.,Forrester,W.C.& Shi, Y. (2002) A DNA vector-based RNAi technology to sup- press gene expression in mammalian cells. Proc. Natl Acad. Sci. USA 99, 5515–5520. 43. Yu, J Y., DeRuiter, S.L. & Turner, D.L. (2002) RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc. Natl Acad. Sci. USA 99, 6047–6052. 44.Paul,C.P.,Good,P.D.,Winer,I.&Engelke,D.R.(2002) Effective expression of small interfering RNA in human cells. Nat. Biotechnol. 19, 505–508. 45. Miyagishi, M. & Taira, K. (2002) U6 promoter-driven siRNAs with four uridine 3¢ overhangs efficiently suppress targeted gene expression in mammalian cells. Nat. Biotechnol. 19, 497–500. 3970 B. Nawrot et al. (Eur. J. Biochem. 270) Ó FEBS 2003 . Efficient inhibition of b-secretase gene expression in HEK293 cells by tRNA Val -driven and CTE-helicase associated hammerhead ribozymes Barbara. selective degradation of mRNA and inhibition of expression of the genes of ÔunwantedÕ proteins. The successful selection of hammerhead ribozymes, active in human cell lines,