pH dependence, substrate specificity and inhibition of human kynurenine aminotransferase I Qian Han, Junsuo Li and Jianyong Li Department of Pathobiology, University of Illinois at Urbana-Champaign, Urbana, IL, USA Human kynurenine aminotransferase I/glutamine trans- aminase K (hKAT-I) is an important multifunctional enzyme. T his study systematically studies the s ubstrates of hKAT-I and reassesses t he effects of pH, Tris, amino acids and a-keto acids on the a ctivity of t he enzyme. T he experi- ments were comprised of functional expression o f the hKAT-I in an insect cell/baculovirus expression system, purification of its recombinant protein, and functional characterization of the purified enzyme. This study demon- strates that hKAT-I can catalyze kynurenine to kynurenic acid under physiological pH conditions, indicates indo-3- pyruvate and cysteine a s efficient inhibitors for hKAT-I, and also provides biochemical information about the s ubstrate specificity and cosubstrate inhibition of the enzyme. hKAT-I is inhibited by Tris under physiological pH conditions, w hich explains why it has been concluded that t he enzyme could not efficiently catalyze kynurenine transamination. Our findings provide a biochemical basis towards understanding the o verall physiological role of hKAT-I in vivo and insight into controlling the levels of endogenous kynu renic acid through m odulation o f the enzyme in the human brain. Keywords: cysteine; indo-3-pyruvate; kynurenic acid; kynurenine a minotransferase; p H effect. In mammals, kynurenine aminotransferase I/glutamine transaminase K (EC 2.6.1.64; KAT-I) is a multifunctional enzyme. In vitro, the enzyme catalyzes the t ransamination o f several amino acids (e.g. glutamine, methionine, aromatic amino acids including kynurenin e) and a lso possesses cysteine S-conjugate b-lyase activity (EC 4.4.1.13) [1]. Kynurenic acid (KYNA), the stable product derived from the kynurenine transamination pathway [2–4], is involved in several physiological aspects of the central nervous system (CNS) by acting as an antagonist at both the glutamate- binding site and the allosteric glycine site of the N-methyl- D -aspartate receptor a nd possibly by b locking the 7-nicotinic acetylcholine receptor [5–8]. Low KYNA levels in the central nervous system are correlated to cerebral diseases such as schizophrenia and H untington’s disease [9–13]. Only two pyridoxal 5¢-phosphate (PLP)-dependent aminotransferases that are able to catalyze the transamination of kynurenine to KYNA, arbitrarily termed KAT- I and II , have b een described in r at and human brains [14–16]. In addition, KYNA is involved in maintaining physio- logical arterial blood pressure. In rats, the region of the rostral and caudal medulla in the CNS plays an important role in regulating cardiovascular function [17–20]. Sponta- neously hypertensive rats that have higher arterial blood pressure were found to h ave significantly l ower KAT activity and KYNA content in their rostral and caudal medulla than the control rats [20]. Injection o f KYNA into the rostral ventrolateral medulla of these rats significantly decreased their arterial pressure [21], which suggests that KYNA is involved in maintaining physiological arterial blood pressure. Recently, the mutant KAT-I from all the strains o f s pontaneously hypertensive rats dis played a ltered kinetics; l ower initial velocity and K m for both kynurenine and pyruvate [22]. This mutation m ay explain the enhanced sensitivity to glutamate and nicotine seen in spontaneously hypertensive rats, suggesting it m ay be related t o a n underlying mechanism of hypertension and increased sen- sitivity to stroke [22]. However, Cooper suggested that another mechanism, i.e. the involvement of altered gluta- mine transamination and sulfur and aromatic amino acid metabolism should also be considered [1]. Although a number o f studies described t he characters of the enzyme ([1] and references therein), only an insect homologue, Aedes aegypti kynurenine aminotransferase [23] and a bacterium homologue [24] were systematically characterized using purified recombinant proteins. To compare the characteristics of KAT-Is in different living organisms, determine s ubstrate s pecificity, and evaluate the possible effect of other amino acids and keto a cids on hKAT-I, we expressed the enzyme in a baculovirus/insect cell protein expression system. Our large scale hKAT-I expression and subsequent purification enabled us to obtain a large amount (mg range) of pure hKAT-I f or extensive biochemical characterization. Our results revealed some Correspondence to J. L i , Department of Pathobiology, University of Illinois at Urbana-Champaign, 2001 South Lincoln Avenue, Urbana, IL 61802, USA. Fax: +1 217 2447421, Tel.: + 1 217 2443913, E-mail: jli2@uiuc.edu Abbreviations:AeKAT,Aedes aegypti kynurenine aminotransferase; CNS, central nervous system; hKAT-I, human kynurenine amino- transferase I; HTS, high-titre viral stocks; KYNA, kynurenic acid; aKMB, a-keto-methylthiobutyric acid; PLP, pyridoxal 5¢-phosphate; Sf9, Spodoptera frugiperda insect cells. Enzymes: kynurenine a mino transferase I /glutamin e transaminase K (EC 2.6.1.64); cysteine 5 -conjugat e b-lyase (EC 4.4.1.13). (Received 2 3 August 2 004, revised 13 October 2004, accepted 21 October 2004) Eur. J. Biochem. 271, 4804–4814 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04446.x interesting biochemical characteristics of hKAT-I, which have not been systematically addressed before. For example, the pH p rofile of hKAT-I exhibits high activity under neutral conditions, which contrasts its reported pH profile showing that the enzyme exhibited high activity only at basic pH values [15,25]. Tris buffer significantly inhibited enzyme activity at neutral c onditions, but showed no inhibition under basic conditions, which might explain why previous studies have reported that hKAT-I had limited activity at physiological pH conditions and displayed optimum activity at fairly basic conditions. Moreover, for the first time, we found that cysteine and indo-3-pyruvate are effective inhibitors of the enzyme in vitro. Our data provide a better overall picture of the enzyme and should be helpful in a comprehensive under- standing of the role of hKAT-I, especially in KYNA biosynthesis in the human brain. Experimental procedures Enzyme expression and purification Construction of recombinant transfer vectors. The codin g sequence of hKAT-I was am plified from first s trand human liver cDNA (Clontech, Palo Alto, CA, USA) using a specific forward (5¢- CTCGAGATGGCCAAACAGCTG CAG) and reverse primer (5- AAGCTTAGAGTTCCAC CTTCCACTT) containing a XhoIandaHindIII restriction site (underlined sequence), respectively. The P CR products were cloned into a TOPO TA cloning vector and then subcloned into a baculovirus transfer vector pBlueBac4.5 (Invitrogen, Carlsbad, CA, USA). Recombinant transfer vectors were sequenced and confirmed to ensure that the inserted DNA sequences were in frame. Production of recombinant baculoviruses. Recombinant pBlueBac4.5 transfer vectors were cotransfected with linearized Bac-N-Blue TM Autographa californica multiple nuclear polyhedrosis virus DNA in the presence of InsectinPlus TM insect cell-specific liposomes to Spodoptera frugiperda (Sf9) insect cells (Invitrogen). The recombinant baculoviruses were purified through the plaque assay procedure. Blue putative recombinant plaques were trans- ferred to 12-well microtitre plates and amplified in Sf9 cells. Viral DNA was isolated for PCR analysis to d etermine the purity of the recombinant viruses. High-titre viral stocks (HTS) for individual recombinant viruses were generated by amplification in Sf9 cell suspension culture. Recombinant protein expression. Sf9 insect cells were used for protein expression. The cells were cultured at 27 °Cinan Ultimate Insect TM serum-free medium (Invitrogen) supple- mented with 10 unitsÆmL )1 heparin (Sigma, St. Louis, MO, USA) in culture spinner flasks and constant stirring at 80 r.p.m. W hen the cell d ensity reached 2 · 10 6 cellsÆmL )1 , they were inoculated with the HTS of recombinant baculoviruses at a multiplicity of infection of six viral particles per cell. Purification of recombinant hKAT-I. Sf9 cells in 2 L of cell culture were harvested on the fourth day after hKAT-I recombinant virus inoculation by centrifugation (800 g for 15 min at 4 °C) and the ce ll pe llets were dissolved in a lysis buffer containing 25 m M phosphate, 0.1 m M pyridoxal 5¢-phosphate (PLP), 2 m M dithiothre- itol, 2 m M EDTA, 1 m M phenylmethylsulfonyl fluoride and 150 m M NaCl with a final pH of 7.4. After incubation on ice for 30 min, cell lysates were centrifuged at 18 000 g fo r 20 min at 4 °C and the supernatant was collected and a ssayed for KAT-I activity. Soluble proteins in the supernatant were precipitated with 65% saturation of ammonium sulfate. Protein precipitate was then redissolved in 10 % saturated ammonium sulfat e and applied to a phenyl sepharose column. A linear gradient of ammonium sulfate from 10% to 0% in 10 m M sodium phosphate buffer (pH 7.0) was used for protein elution. The hKAT-I active fractions were pooled, dialyzed and then separated by DEAE Sepharose chromatography with a linear NaCl gradient (0–500 m M ) in the same phosphate buffer. The active fractions were collected, concentrated and then separated by a Super- dex TM 200 gel filtration column. The hKAT-I active fractions were collected and concentrated. The purity of the enzyme was assessed by SDS/PAGE a nalysis. hKAT-I content was determined by a Bio-Rad (Hercules, CA, USA) protein assay kit using bovine serum albumin as a standard. The concentration of hKAT-I stock solution was adjusted to 20 mgÆmL )1 in 20 m M phos- phate buffer (pH 7.5), aliquoted into 200 lLmicrocen- trifuge tubes with 10 lLineachandfrozenat)80 °C. Biochemical characterization hKAT-I activity assay. All chemicals were purch ased from Sigma Chemical Company unless otherwise specified. hKAT-I activity assay was based on methods described in previous reports [26,27]. Briefly, a typical r eaction m ixture of 50 lL containing 5 m M kynurenine, 2 m M a-ketobu ty- rate, 40 l M PLP and 2 lg hKAT-I was prepared using a 200 m M phosphate buffer, pH 7.5. The reaction mixture was incubated for 10 min at 45 °C, and the reaction was stopped by adding an equal volume of 0.8 M formic acid. Supernatant w as obtained by centrifugation o f t he reaction mixture at 1 5 000 g at 4 °C for 10 min and analyzed by HPLC-UV at 330 nm for KYNA. The amount of KYNA formed in the reaction mixture was calculated based on a standard curve generated using authentic KYNA and the specific activity of the enzyme was expressed as lmolÆmin )1 Æmg )1 . Effect of buffer and pH on hKAT-I. To determine the effect of pH on hKAT-I activity, a buffer mixture consisting of 100 m M phosphate and 100 m M boric acid was prepared and the pH of the buffer was adju sted to 6.0, 6.5, 7.0, 7 .5, 8.0, 8.5, 9.0, 9.5, respectively. The buffer mixture was s elec- ted to maintain a relatively consistent buffer composition and i onic strength, yet have sufficient buffering capacity for relatively broad pH range. A typical reaction mixture containing 5 m M kynurenine, 2 m M a-ketobutyrate, and 2 lg hKAT-I was prepared using the buffer mixture at different pHs. The reaction mixture was incubated a nd analyzed as described in the hKAT-I activity assay. Initial results showed that the specific activity of hKAT-I in the reaction mixture prepared in Tris buffer was much lower Ó FEBS 2004 Characterization of human kynurenine aminotransferase I (Eur. J. Biochem. 271) 4805 than in the above buffer mixture. To compare hKAT-I activity in different buffers, 200 m M phosphate alone with pH 6.0–8.0, and 200 m M Tris alone with pH 7.5–8.5 were prepared and used for hKAT-I activity assays under the same conditions. Spectral analysis. PLP has an absorption peak in the visible region under neutral or weak basic conditions. Its visible peak shifts to wards longer wavelengths when associated with transaminase and diminishes upon forma- tion of pyridoxamine after reacting with amino group donors (the half reaction of the overall transaminase- mediated reactions). The spectrum of hKAT-I i n phosphate buffer, pH 7.5, was analyzed using a Hitachi U2001 double- beam spectrophotometer and compared to t he spectrum o f free PLP i n the same buffer. The s ame spectral a nalysis was also used to evaluate the potential interaction o f P LP and Tris through comparison of the spectral characteristics of PLP in Tris buffer at different pHs with those of PLP in phosphate buffer at the same pH conditions. Substrate specificity. To determine the possible transam- ination activity of hKAT-I to o ther amino a cids, a different amino acid at varying concentrations (0.1–32 m M )wasused to replace kynuren ine and 16 m M a-ketobutyrate used a s an amino group acceptor in the t ypical reaction mixture (50 lL total volume prepared in 200 m M phosphate buffer, pH 7.5) specified in the hKAT-I activity assay. The mixture was incubated for 10 min a t 4 5 °C. The product was quan tified based on the detection o f o-phthaldialdehyde thiol (OPT)- amino acid produ ct conjugate by HPLC with fluorescent detection ( excitation: 325 nm; emission: 465 nm) after their corresponding reaction mixtures were derived by OPT reagent [28]. To determine the substrate specificity for a-keto acids, 16 individual a-keto acids were tested for t heir ability to f unction as the amino group acce ptor for hKAT-I. In the assays, a different a-keto acid at varying concentra- tions (0.25–16 m M ) was used to replace a-ketobutyrate in the presence of 15 m M kynurenine in the typical reaction mixture a nd the r ate of KYNA production was determined as described in the hKAT-I activity assay. Presence of other amino acids or other keto acids on hKAT-I catalyzed KYNA formation. Analysis of substrate specificity revealed t hat a number of amino acids a nd a-keto acids can serve as the amino group donor and acceptor, respectively, for hKAT-I. To determine the effect of a competing a mino acid or keto acids on hKAT-I catalyzed KYNA production from kynurenine, a different amino acid (with a final concen tration of either 2 m M or 32 m M )ora different a-keto acid (with a final concentration of 2 m M ) was incorporated into the typical re action mixture c ontain- ing 5 m M (for testing amino acids) or 15 m M (for testing a-keto acids) kynurenine, 2 m M a-ketobutyrate, and 2 lg hKAT-I in a total volume of 50 lL and the enzyme activitywasassayedinthesamemannerasdescribedfor the hKAT-I activity assay. All assays were performed in at least triplicate. The results for the e ffects o f ke to acids and amino acids w ere analyzed by using the Student’s t-test. The kinetic parameters of the recombinant enzyme towards different amino acids or a-ke to acids were calculated by fitting the experimental data to the Michaelis–Menten equation using the ENZYME KINETICS MODULE (SPSS Science, Chicago, IL, USA). Results Spectral characteristics of the recombinant hKAT-I Purified hKAT-I showed a single protein band on SDS/ PAGE with a relative molecular mass of 46 kDa (Fig. 1A, insert), which closely matches its calculated mass (47 875 Da). Spectral analysis of the purified enzyme in phosphate buffer (pH 7.5) revealed an absorption peak in the visible region with a k max at 422 nm, which corresponds to protein associated PLP. The protein associated PLP w as easily distinguished from free PLP that had its visible absorption peak with a k max at 388 nm (Fig. 1A). Based on protein concentration in comparison with the absorbance of protein associated PLP, an approximate 1 : 1 ratio of the protein against PLP was established. The 4 22 nm A B Fig. 1. Spectral characteristics of hKAT-I. (A) The absorption peak of protein a ssociated PLP in the visible region in phosphate buffer, pH 7.5, has a k max at 422 nm, which can be distinguished from the corresponding absorption peak of free PLP that has a k max at 388 n m. Insert is SDS/PAGE gel that illustrates s oluble protein f rom hKAT-I recombinant baculovirus in fected insect cells (lane 1), purified hKAT-I (lane 2) and protein standard (lane 3), respectively. (B) Spectral changesofhKAT-Ifollowingtheadditionof10m M glutamine into hKAT-I solution. The concomitant decrease of the 422 nm peak an d increase of the 335 nm peak indicate the c onversio n of the enzyme associated PLP to pyridoxamine. The reaction mixture wa s scanned a t 1 min intervals f ollowing glutamine a ddition. 4806 Q. Han et al.(Eur. J. Biochem. 271) Ó FEBS 2004 absorption peak was rapidly diminished upon incorporation of glutamine into the reaction mixture with the conco mitant formationofanewabsorptionpeakwithak max at 33 5 nm (Fig. 1B), indicating the formation of pyridoxamine f rom the e nzyme associated PLP. Addition of kynurenine dimin- ished the 422 nm peak, but the absorption peak of kynurenine overlapped with the pyridoxamine peak and partially overlapped with the 422 nm peak (not shown). Incorporation of a-ketobutyrate or other a-keto acid concomitantly decreased and increased the 335 nm and 422 nm peak, respectively, and the relative dimensions of the pyridoxamine peak (335 nm) and enzyme-PLP peak (422 nm) were dependent on the molar ratio between the amino grou p donor and the acceptor in t he mixture. These results established that the expressed recombinant protein is folded properly with its PLP p rosthetic group and r etains its biochemical activities. Effect of buffer and pH on hKAT-I activity When the phosphate and borate buffer mixture, adjusted to pH 6.0–9.5, was used to prepare hKAT-I/kynurenine/ a-ketobutyrate reactio n mixtures, hKAT-I showed little activity with pH 6.0, beca me fairly active at pH 6.5–7.0, and displayed high activity at pH 7.5–9.0 (Fig. 2A). The high activity of hKAT-I in catalyzing the kynurenine t o K YNA Fig. 2. Effect of pH a n d Tr is buffer on hKAT-I a ctivity. hKAT-I was incubated in the presence of 5 m M kynurenine and 2 m M a-ketobutrate as described in Experimental procedures. (A) hKAT-I activity profiles at diffe rent pHs in a bu ffer mixture contain ing 100 m M phosphate and 100 m M boric a cid. The pH ranged from 6.0 to 9.5. (B) Inhibition of hKAT-I activity by Tris at ne utral and weak basic condition: ))), hKAT-I activity in a r eaction mixture prepared using 200 m M Tris buffer; ÆÆÆÆ, hKAT-I a ctivity in a reac tion mixture prepared using 200 m M phosphate buffer. Fig. 3. Interaction of free PLP with Tris amine under different pH conditions. One h undred microliters of either 20 m M phosphate b uffer or Tris buffer at pH 7 .0, 7.5, 8.0, o r 8.5 w as mixed with 400 lLof 0.25 m M PLP prepared in distilled water and the spectra of the mixtures were recorded using a Hitachi U2001 double-beam spectro- photometer 2.0 m in after b uffer add ition. (A) Sp ectra of PL P in the presence of phosphate, pH 8.0 (trace 1) a nd Tr is, pH 8.0 (trace 2). (B) Spectra of PLP in Tris p H 7.0 (trace 1), 7.5 (trace 2), 8.0 (t race 3)or 8.5 (trace 4). (C) Spectra of PLP in phosphate pH 8.0 before (trace 1) and after incorporation of 4 m M glutamine (trace 2),whichservesasa control for suggesting a similar interaction of Tris amine with PLP a s that of amino acid s ubstrate. Ó FEBS 2004 Characterization of human kynurenine aminotransferase I (Eur. J. Biochem. 271) 4807 Table 1. Kinetic parameters of hKAT-I towards different amino acids and comparison with the rate of purified brain hKAT-I and the k cat /K m of other aminotransferases. The activities w ere measured as d escribe d in E xperimental procedures. T he a-keto butyrate concentrations were 16 m M in the presence of different concentrations of amino acids. The kinetic p arameters of the enzyme to amino acids were calculated by fitting the experimental data to th e M ichaelis–Menten e quation u sing the ENZYME KINETICS MODULE . BGlnAT, bacterium homologue, glutamine:phenylpyruvate aminotransferase from Thermus thermophilus HB8 [24]; AeKAT, insect homologue, from Aedes aegypti [23]; RGlnAT, rat glutamine transaminase K/KAT-I[30];BhKAT-I,hKAT-I,purifiedfromhuman brain [ 29]; 3-HK, 3-hydroxykynurenine. Amino acid hKAT-I BGlnAT AeKAT RGlnAT BhKAT-I K m m M k cat min )1 k cat /K m min )1 Æm M )1 k cat /K m min )1 Æm M )1 k cat /K m min )1 Æm M )1 k cat /K m min )1 Æm M )1 rate lmolÆmin )1 Æmg )1 Glutamine 2.8 ± 0.5 440.5 ± 28.7 157.3 4 147.8 0.04 1.8 Phenylalanine 1.7 ± 0.3 91.0 ± 4.8 53.5 13 80.9 0.17 0.37 Leucine 7.6 ± 3 339.9 ± 43.1 44.7 1.3 · 10 )4 22 < 0.05 Kynurenine 4.7 ± 0.4 201.1 ± 19.2 42.8 5.7 40.2 2.1 Tryptophan 1.2 ± 0.3 43.1 ± 3.4 35.9 3 22 0.17 Methionine 6.4 ± 0.9 215.4 ± 14.4 33.7 6.3 116.6 0.012 < 0.05 Tyrosine 3.2 ± 0.4 91.0 ± 4.8 28.4 200 154.7 0.0031 < 0.05 Histidine 5.4 ± 1 143.6 ± 14.4 26.6 1.2 · 10 )3 112 < 0.05 Cysteine 0.7 ± 0.1 9.6 ± 0.48 13.7 158.8 < 0.05 Amino-butyrate 21.3 ± 4.7 38.3 ± 4.8 1.8 3.4 Asparagine 23.1 ± 5.7 14.4 ± 0.14 0.6 2.2 · 10 )3 37.8 Glycine a Alanine a 4.8 · 10 )5 6.3 Arginine a 1.5 · 10 )5 < 0.05 Serine a 5.3 · 10 )4 10.6 Lysine a Threonine b 4 · 10 )6 < 0.05 Isoleucine b Aspartate b 1.4 · 10 )5 < 0.05 Glutamate b 2.3 · 10 )5 < 0.05 Valine b Aminoadipate b < 0.05 3-HK b < 0.05 a The enzyme activity towards these amino acids at 32 m M are 0.06–0.4 lmolÆmin )1 Æmg )1 , K m >32m M . b The enzyme activity towards these amino acids at 32 m M was < 0.05 lmolÆmin )1 Æmg )1 , and the enzyme shows no detectable activity towards 3-hydroxykynurenine. Fig. 4. Transamination activity o f hKAT-I towards different amino acids with a-ketobutyrate a s an a mino acceptor. Pur ified recombinant hK AT-I was incubated with each of the 24 ami no acids at 20 m M (A), except 3-hydroxykynurenine, which was not tested at 20 m M due to its low solubility in aqueous solutio n, an d 2 m M (B) in the presen ce of 16 m M a-ketobutyrate or oxaloacetate (for activity towards aminobutyrate), respectively as described in Experimental procedures. The activity w as quantified by t he amount of am inobut yrate or aspartate pro duced in the r eaction mixture. 4808 Q. Han et al.(Eur. J. Biochem. 271) Ó FEBS 2004 pathway under physiological conditions contrasted with previous reports that mammalian KAT-I had extremely limited activity in catalyzing the production of KYNA from kynurenine under neutral conditions [14,15,25,29]. However, when the same reaction mixtures were prepared in Tris buffer alone, as described in some previous reports, hKAT-I showed extremely low activity at pH 7.5, and essentially no activity at pH 8.0, but became active at pH 8.5 (Fig. 2B, dashed line), which is quite similar to earlier studies [14,15,25,29]. It is intriguing that the pH profiles of enzyme activity were so different between Tris and phosphate buffer (Fig. 2B, dotted line). The aldehyde group of PLP can react with a primary amine to form a fairly stable Schiff base, so the inhibition of Tris on hKAT-I might be due to competition of the amino group on Tris molecules with enzyme associated PLP. When 400 lL of a PLP solution, prepared in distilled water at 0.25 m M , was mixed with 100 lLof20m M phosphate bufferor20 m M Tris b uffer at pH 8.0, the visible absorption peak of PLP was shifted towards longer wavelengths a fter the addition of Tris buffer, as compared to that of PLP a fter the addition of phosphate buffer (Fig. 3A). Other than a slight change in peak dimension, pH changes of phosphate buffer ( pH 6.5–8.0) did not lead to a noticeable spectral shift of the PLP absorption peak (not shown), but apparent spectral shift towards longer wavelengths was observed in the PLP solution after the addition of Tris at pH 7.5, 8.0, and 8 .5, respectively, as compare d to the addition of Tris at pH 7.0 (Fig. 3B). The same s pectral shift was also observed when glu tamine was added to the phosphate prepared PLP Fig. 5. Cosubs trate specificity of h KAT-I . hKAT-I was incubated in t he presence of k y nurenine at 1 5 m M and a different am ino group acceptor (a-keto acid) at concentrations ranging from 0.1 to 16 m M as described in Experimental procedures. The activity was quantified by the amount of KYNA produced in the reaction mixture. Ó FEBS 2004 Characterization of human kynurenine aminotransferase I (Eur. J. Biochem. 271) 4809 solution (Fig. 3C). These results suggest that the amino group of the Tris molecule probably interacts with enzyme associated PLP under basic conditions, thereby decreasing its transaminase activity. As a similar spectral shift of PLP towards a longer wavelength was observed in Tris buffer at pH 8.5, other competing mechanisms between the Tris amine and the amino acid substrates may be involved as well, which requires further elucidation. Substrate study of hKAT-I hKAT-I was tested for aminotransferase activity towards different amino acids using a-ketobutyrate as a primary amino group acceptor. The selection of a-ketobutyrate as the amino group acceptor was based on initial r esults that this keto acid showed no substrate inhibition at saturating concentrations (discussed below). hKAT-I showed detect- able activity towards aromatic amino acids (including, kynurenine, phenylalanine, tryptophan and tyrosine); sulfur containing amino a cids (including, methionine an d cysteine) and other aliphatic a mino acids (including, glutamine, leucine, histidine, and aminobutyrate). This is different from a p revious study reporting that hKAT-I exhibited relatively high activity to only four a mino acid substrates [29] (Table 1). h KAT-I also exhibited low activity to other tested amino acids at high concentrations (Fig. 4). Kine tic results provided a better view regarding the efficiency of hKAT-I towards the individual amino acids (Table 1). Basedontheparameterofk cat /K m , it is apparent that hKAT-I is efficient in catalyzing the transamination of a number of amino acids, including glutamine, phenylalanine, leucine, kynurenine, methionine, tyrosine, histidine, cys- teine, and aminobutyrate (Table 1). Although KAT-I enzymes from different species, including insect kynurenine aminotransferase from Aedes aegypti (AeKAT) [23], rat glutamine transaminase K/KAT-I [30] and hKAT-I, behave in a similar manner, they display apparent differ- ences in substrate preference. For example, hKAT-I is most efficient in catalyzing the transamination of glutamine, AeKAT is most efficient toward cysteine and tyrosine, bacterium e nzyme is most efficient toward tyrosine, and rat KAT-I is most efficient to phenylalanine (Table 1). These differences suggest that the enzyme may have different functional priorities in different species. Sixteen a-keto acids wer e tested for their potential as the amino g roup acceptor for hKAT-I with 15 m M kynurenine as the amino group donor. Among them, 12 a-keto acids displayed detectable activity after 10 min of incubation (Fig. 5) and five (a-ketoglutarate, a-ketoiosleucine, indo- 3-pyruvate, a-ketoadipate an d a-ketovaline) showed detect- able activity only when i ncubation time lasted for an hour. Among the 12 a-keto acids capable of functioning as amino group acceptors for hKAT-I, a-ketobutyrate, mecapto- pyruvate and oxaloacetate showed no substrate inhibition at saturating concentrations, but the others, especially p-hydroxy-phenylpyruvate, aKMB and a-ketovalerate, showed substrate inhibition at relatively low concentrations (Fig. 5). Although pyruvate has been the most commonly used amino group acceptor for KAT-I activity assays, it was much less efficient as the amino group acceptor for hKAT-I than a number o f other a-keto acids listed in Table 2 . Due to substrate inhibition, the K m and k cat /K m could not be determined for p-hydroxy-phenylpyruvate, aKMB, a-ketovalerate, and a-ketocaproic acid (Table 2 and Fig. 5), but based on reaction r ates, they should also be more efficient than pyruvate as the amino group acceptor for hKAT-I. Effects of other amino acids on hKAT-I catalyzed kynurenine transamination BasedontheK m of hKAT-I towards different amino a cids, tryptophan, glutamine, phenylalanine, methionine, histi- dine, tyrosine, cysteine and leucine have either similar affinity or better affinity to hKAT-I than kynurenine; accordingly, the presence o f any of these amino acid s i n the kynurenine/hKAT-I/a-keto acid mixture should lead to the competitive inhibition of hKAT-I activity towards kynur- enine. When 32 m M of tryptophan, glutamine, phenylalan- ine, cysteine, methionine, histidine, tyrosine or leucine was incorporated into the kynurenine/hKAT-I/a-ke to acid reaction mixture with 5 m M kynurenine, the r ate of K YNA formation was significantly decreased (Fig. 6B). When 2m M of a d ifferent amino a cid was incorporated into the kynurenine/hKAT-I/a-keto a cid reaction mixture, the rate of KYNA production was decreased only by tryptophan, glutamine, phenylalanine, and cysteine at 70%, 60%, 60%, and 30%, respectively (Fig. 6A). Ap parently, the decrease in the rate of KYNA production in the hKAT-I/kynure- nine/a-keto acid reaction mixture in the presence of a different amino acid was due to competitive inhibition, because t he extent of inhibition approximately matched the K m value of th e corresponding competing a mino acid in the reaction mixture. Cysteine derivatives were proposed to be modulators for KYNA production in the mammalian brain Table 2. Kinetic parameters of hKAT-I towards a-keto acids. The activities were measured as described in Experimental procedures. The K m and k cat for amino acceptors were derived by using varying con- centrations of individual a mino acc eptors in t he presen ce of 15 m M of kynurenine. The parameters were calculated by fitting the experimental data to the Michaelis–Menten e quat ion using the ENZYME KINETICS MODULE (Fig. 5). a-Keto acids K m m M k cat (min )1 ) k cat /K m (min )1 Æm M )1 ) a-Ketoleucine 1 ± 0.3 296.8 ± 28.7 247.4 Glyoxylate 1.5 ± 0.5 263.3 ± 28.7 175.5 Phenylpyruvate 0.8 ± 0.4 110.1 ± 19.2 137.6 Mercaptopyruvate 2.5 ± 0.4 234.6 ± 14.4 93.8 a-Ketobutyrate 3 ± 0.4 234.6 ± 9.6 78.2 Oxaloacetate 4.2 ± 0.4 143.6 ± 9.6 34.2 Pyruvate 12.1 ± 4.9 28.7 ± 4.8 2.4 a-Ketocaproic acid a-Ketovalerate aKMB High activity, but unable to calculate kinetic parameters because of their substrate inhibition at low concentration p-Hydroxy-phenylpyruvate a-Ketoglutarate a-Ketoisoleucine a-Ketoadipate Activity was detectable only when incuba- tion time lasted at least an hour, ranking as listed. a-Ketovaline Indo-3-pyruvate 4810 Q. Han et al.(Eur. J. Biochem. 271) Ó FEBS 2004 [31,32] and cysteine had an intriguing effect on AeKAT [23], so its effect on hKAT-I mediated kynurenine transamination was tested more thoroughly. Cysteine showed apparent inhibition of hKAT-I-catalyzed KYNA production from kynurenine a t concentrations of 2 m M (Fig. 6C), but did not stimulate hKAT-I acitivity at low concentration as seen in the Ae KAT catalyzed reaction [23]. For most of the other tested amino acids, no inhibition on KYNA production was observed (Fig. 6A,B), which c ould be explained by their rather low affinity to the enzyme. Effects of other keto acids on hKAT-I activity Ability to function as the amino group acceptor for a number of biologically relevant keto acids and their substrate inhibition above certain concentrations (Fig. 5) indicated that the presence of two keto acids might have either a positive or negative impact on hKAT-I mediated KYNA production, as compared to the presence o f a single amino group acceptor. To test this hypothesis, a different keto acid was added to the kynurenine/hKAT-I/a-ketobu- tyrate mixture and the rate of KYNA production in the reaction mixture was compared with that of the control reaction mixture with a-ketobutyrate alone. A number of a-ke to acids significantly increased the rate of KYNA production, but indo-3-pyruvate showed significant inhibi- tion on the enzyme, and a-ket oglutarate, a-ketoiosleucine, Fig. 6. Effect of other amino acids on hKAT-I activity. Assay condi- tions were sim ilar to those described in E xperimental procedures, except kynurenine and a-ketob utyrate concentrations were 5 m M and 2m M , respectively. The concentrations of amino acids tested were 2m M (A) and 32 m M (B), respectively. Cysteine was tested from 0.3 m M to 16 m M (C). Th e a ctivity w as quantified by the amo unt o f KYNA produced in the reaction mixture. *P <0.5, **P <0.01 significant difference from the control; 3-HK, 3-hydroxykynurenine. Fig. 7. Eff ect of the multip le a-keto acids on hKAT-I-catalyzed KYNA production. The activities were quantified by the amount of KYNA produced in the reaction mixtures. The vo lume of the reaction m ixture was 50 lLconsistingof2lgofhKAT-I,15m M kynurenine a nd two different a-keto acids. O ther conditions were sim ilar to t hose described in Experimen tal procedures. (A) Rate of KYNA production in the hKAT-I and kynurenine mixture in the presence of 2 m M of a-ketobutyrate and 2 m M of a diff erent a- keto acid. *P <0.5, **P < 0.01, significant difference from the control. (B) Effect of different concen trations of indo -3-pyruvate on hKAT-I activity. p-HPP, p-hydroxyphenylpyruvate. Ó FEBS 2004 Characterization of human kynurenine aminotransferase I (Eur. J. Biochem. 271) 4811 a-ketoadipate, a-ketovaline, pyruvate, and phenylpyruvate had no significant effect on the rate of KYNA production by hKAT-I (Fig. 7A). Because indo -3-pyruvate has not been reported as an inhibitor to hKAT-I in other studies, its inhibition of hKAT-I at a broad range of concentrations wasfurthertested.AnalysisofhKAT-Iactivityinthe presence of varying concentrations of indo-3-pyruvate showed that the compound inhibited hKAT-I a ctivity at a very low concentration of 0.08 m M , and completely abol- ished the enzyme activity at 5.0 m M (Fig. 7B). Discussion Analysis of substrate specificity confirmed that h KAT-I is a multifunctional aminotransferase. Kinetic analysis of the enzyme to wards different amino acids showed that the enzyme is efficient in catalyzing the transamination of glutamine, phenylalanine, leucine, kynurenine, tryptophan, methionine, tyrosine, histidine, cysteine and amino- butyrate, which contrasts an earlier report showing that purified hKAT-I exhibited high activity to only four individual amino acids (kynurenine, glutamine, phenyl- alanine, and t ryptophan) [29] (Table 1). The large spectrum of amino acid substrates of KAT-I supports the proposed role of the enzyme in sparing the essential amino acids methionine, histidine, phenylalanine and tyrosine [1] and providing a mechanism t o maintain a continual equilibrium among the amino acids [33]. Moreover, the high activity of hKAT-I towards kynurenine under physiological pH conditions provides the basis for suggesting its function in brain KYNA synthesis. By studying the pH profile of the enzyme, we demon- strated, for the first time, that h KAT-I has a broad optimal pH range, and is c apable of efficiently catalyzing the kynurenine to KYNA pathway under physiological condi- tions, which contrasts the published pH profile of hKAT-I [15,25]. The inability of hKAT-I to catalyze efficient transamination reactions in previous studies was probably caused by Tris inhibition of the enzyme. In transaminases, PLP is bound in a Schiff base linkage with the e-NH 2 group of an active site lysine residue [34,35]. The mechanisms regarding PLP-mediated transamination reactions (i.e. the protonation of the Schiff base, removal of the Ca proton from the amino acid substrate, electron relocalization and rearrangement of the Schiff base double bond from the pyridoxal aldehyde carbon to the Ca of the amino acid substrate, etc.) have been discussed in numerous reports [36,37]. Spectral shift of free PLP towards longer wave- lengths in the presence of Tris at weak basic conditions suggests that the amine can interact with the enzyme associated PLP, which may lead to the formation of a S chiff base through an initial nucleophilic addition to the carbonyl group of P LP, followed by rapid proton transfer, leading to water elimination a nd the formation of an imine. The apparent spectral shift of PLP in Tris buffer at weak basic pH, the absence of such a spectral shift of PLP in a phosphate buffer of pH 7.0–9.0, in conjunction with the same spectral shift of PLP in phosphate buffer upon incorporation of glutamine and the high activity of hKAT-I in phosphate buffer at both neutral and w eak basic conditions (pHs 7.0–8.0), provides a reasonable basis for suggesting that the extremely low activity o f KAT-I under physiological pH is due to KAT-I inhibition by Tris amine. Our data established that hKAT-I is quite capable of catalyzing the kynurenine to KYNA pathway at physiolo- gical conditions. Data concerning the effect of other amino acids on hKAT-I catalyzed KYNA production determined that KYNA production is not seriously affected by most amino acids, except for tryptophan, glutamine, phenylalanine and cysteine, which decreased KYNA production by 30–70%, which is consistent with a previous report, i.e. tryptophan, glutamine and phenylalanine are inhibitors of the enzyme [29]. Cysteine was reported to be a good substrate for glutamine transaminase K [38], but its effect on hKAT-I activity has not been tested. In mammals, endogenous cysteine displays neuroexcitatory a ctions similar to those o f glutamate [39,40]. Cysteine derivatives, homocysteine, cys- teine sulfinate, homocysteine s ulfinate and cysteate, were able to reduce t he production of KYNA in cortical slices in rats, due presumably to their interaction with KATs, and they were considered endogenous modulators of KYNA formation in the brain [31,32]. However, because there are potentially two K ATs in t he brain, which one is inhibited by cysteine derivatives has not been fully understood, altho ugh the possible inhibition of KAT-II has been p roposed [31]. The inhibition of hKAT-I by cysteine in vitro suggests that the reduction of KYNA production in cortical slices in the presence of cysteine or cysteine derivatives could be due to their inhibition to KAT-I. Most naturally occ urring a-keto acids can serve as the amino group acceptor for hKAT-I. Pyruvate has been the most commonly used a mino group acceptor for character- izing hKAT-I [14,15,25,29]. Through kinetic analysis, it is clear t hat pyruvate i s not an efficient amino group accepto r due to its high K m (Fig. 5). The results dealing with cosubstrate profiles in a previous s tudy [29] could have been different if cosubstrate inhibition had been taken into consideration. Our data confirmed that glyoxylate, aKMB, p-hydroxy-phenylpyruvate, a-ketovalerate, a-ketocaproic acid, a-ketoleucine, mercaptopyruvate, a-ketobutyrate, pyenylpyruvate and oxaloacetate are more efficient amino group acceptors than pyruvate for hKAT-I (Fig. 5 and Table 2), which is similar to the previously given information about glutamine transaminase K , i.e. wide a-k eto acid specificity, but high activity with a-KMB and glyoxylate, strong substrate i nhibition with ph enylpyruvate and poor affinity toward alanine and pyruvate [30,41]. In summary, by systematically studying the potential substrates, amino acids and a-keto acids for hKAT-I, a new substrate map for hKAT-I is obtained. This study con- firmed that hKAT-I is a multifunctional enzyme. New pH profiles of hKAT-I were described a nd the reasons why it is different from the reported pH p rofile were discussed. Indo- 3-pyruvate and cysteine were found to be efficient inhibitors for h KAT-I. Based on our data, i t i s reasonable to p ropose that hKAT-I might be an important player in KYNA synthesis under physiological conditions in the human brain. However, much more research is needed to fully understand its overall physiological role in vivo. Neverthe- less, this study provides rather comprehensive bioch emical characteristics of this important enzyme, which should be highly useful towards elucidating the accurate r ole h KAT-I plays in brain KYNA synth esis and towards controlling the 4812 Q. Han et al.(Eur. J. Biochem. 271) Ó FEBS 2004 levels of endogenous kynurenic acid in the human brain through modulating hKAT-I activity. Acknowledgements We are grateful to Prof. Bruce M. Christensen, D epartment of Animal Health and Biomedical Sciences, University of Wisconsin (Madison, WI, USA) and Dr Menico Rizzi (De partment of G enetics, University of Pavia, Italy) f or their crit ical reading of the manus cript. This study w as support ed b y the National Institutes of H ealth G rant AI 44399. References 1. Cooper, A.J. ( 2004) T he role of glutamine transaminase K (GTK) in sulfur and alpha-ke to acid metabolism in t he brain, and i n the possible bioactivation of neurotoxicants. Neurochem. Int. 44,557– 577. 2. Mosca, M., Cozzi, L., Breton, J., Speciale, C ., Okuno, E., Schwarcz, R. & Benatti, L. (1994) Molecular cloning of rat kynurenine aminotransferase: identity with glutamine transami- nase K. FE BS Lett. 353, 21–24. 3. Malherbe, P., Alberati-Giani,D.,Kohler,C.&Cesura,A.M. (1995) Identification of a mitochondrial form of kynurenine aminotransferase/glutamine transaminase K f rom rat brain. FEBS Lett. 367 , 141–144. 4. Abraham, D.G. & Cooper, A.J. (1996) Cloning and e xpression of a rat kidney cytosolic glutamine t ransaminase K that has strong sequence homo logy to kyn urenine pyruvate aminotransferase. Arch. B iochem. Biophys. 335, 311–320. 5. Moroni, F. (1999) Tryptophan metabolism and brain function. Focus on k ynurenine and other indole metabolites. Eur. J. Phar- macol. 375, 87–100. 6. Schwarcz, R. & Pellicciari, R. (2002) Manipulation of brain kynurenines: glial targets, n euronal e ffects, and c linical op portu- nities. J. Pharmacol. Exp. Ther. 303, 1–10. 7. Stone, T.W. & Darlin gton, L.G. (2002) Endogenous kynurenines as targets for dru g discovery and development. Nat. Rev. Drug Discov. 1, 609–620. 8. Alkondon, M . & Pereira, E.F., Yu, P., Arruda, E.Z., Almeida, L.E.,Guidetti,P.,Fawcett,W.P.,Sapko,M.T.,Randall,W.R., Schwarcz, R., Tag le, D.A. & Albuquerque, E.X. ( 2004) Targeted deletion o f the kynurenine aminotransferase ii gene reveals a critical role of endo genous kynurenic acid in the regulation of synaptic transmission via alpha7 nicotinic receptors in the hip- pocampus. J. Neurosci. 24, 463 5–4648. 9. Beal,M.F.,Matson,W.R.,Storey,E.,Milbury,P.,Ryan,E.A., Ogawa, T. & Bird, E.D. (1992) Kynurenic acid c oncentrations a re reduced in Huntington’s disease cerebral cortex. J. Ne urol. Sci. 108, 80–87. 10. Beal, M.F., Matson, W.R., Swartz, K.J., Gamache, P.H. & Bird, E.D. (1 990) Ky nurenine pathway m easurements in H untington’s disease striatum: evid ence for reduced formation of kyn urenic acid. J. Neurochem. 55, 1 327–1339. 11. Jauch, D., Urbanska, E.M., Guidetti, P., Bird, E.D., Vo nsattel, J.P., Whetsell, W.O. Jr & Schwarcz, R. (1995) Dysfunction of brain kynurenic acid metabolism in Huntington’s disease: focus on kynurenine aminotra nsferases. J. Ne urol. Sci. 130, 39–47. 12. Schwarcz,R.,Rassoulpour,A.,Wu,H.Q.,Medoff,D.,Tam- minga, C.A. & Roberts, R.C. (2001) Increased c ortical kynurenic acid co ntent in schizophrenia. Biol. Psychiatry 50, 521 –530. 13. Erhardt, S., Blennow, K ., Nordin, C ., Skogh, E., Lindstrom, L .H. & Engberg, G. (2001) K ynurenic acid levels are elevated in the cerebrospinal fluid of p atient s with schizophrenia. Neurosci. L ett. 313, 96–98. 14. Okuno, E., Nakamura, M. & Schwarcz, R. (1991) Two kynur- enine aminotransferases in human brain. Brain Res. 542, 3 07–312. 15. Guidetti, P., Okuno, E. & S chwarcz, R. (1997) Characterization of rat brain kynurenine aminotransferases I and II. J. Neurosci. Res. 50, 4 57–465. 16. Gramsbergen,J.B.,Schmidt,W.,Turski,W.A.&Schwarcz,R. (1992) Age-related changes in kynurenic acid production in rat brain. Brain R es. 588, 1 –5. 17. Ito, S., Komatsu, K., Tsukamoto, K. & Sved, A.F. (2000) Excitatory amino acids in the rostral ventro lateral medulla support blood pressure in spontaneously hypertensive rats. Hypertension 35 , 413–417. 18. Kiely, J.M. & Gordon, F.J. (1994) Role of rostral ventrolateral medulla in c entrally me diated pre sso r respon ses. Am . J. Physiol. 267, H 1549–H1556. 19. Kapoor, V., Kapoor, R. & Ch almers, J. (1994) Kynu renic acid, an endogenous glutamate antagonist, in SHR an d WKY rats: possible role in central blood pressure regulation. Clin. Exp. Pharmacol. Physiol. 21, 891–896. 20. Kapoor, V., Thuruthyil, S.J. & Human, B. (1998) Reduced kynurenine aminotransferase-I activity in SHR rats m ay be du e to lack of KAT-Ib activity. Ne uroreport 9, 1431–1434. 21. Mizutani, K., Sugimoto, K ., Okuda, T., Katsuya, T., Miyata, T., Tanabe, T., Higaki, J., Ogihara, T., Yamori, Y., Tsujita, Y., Tago, N. & Iwai, N. (2002) Kynureninase i s a novel candidate gene for hypertension in spontaneously hypertensive rats. Hype rtens. Res. 25, 1 35–140. 22. Kwok, J.B., Kapoor, R., Gotoda, T., Iwamoto, Y., Iizuka, Y., Yamada, N., Isaacs, K.E., Kushwaha, V.V., Church, W.B., Schofield, P.R. & Kapoor, V. (2002) A missense mutation in kynurenine aminotran sferase-1 in spontaneously hypertensive rats. J. Biol. Chem. 277 , 35779–35782. 23. .Han, Q. & Li, J. (2004) C ysteine a nd ke to ac ids m odulate m os- quito kynurenine aminotransferase catalyzed kynurenic acid production. FEBS Lett. 577, 381–385. 24. Hosono, A., Mizuguchi, H., Hayashi, H., Goto, M., Miyahara, I., Hirotsu, K. & Kagamiyama, H. (2003) Glutamine: phenylpyruvate Aminotransferase from an Extremely Thermophilic Bacterium, Thermus t hermophilus HB8. J. Biochem. (Tokyo) 134, 843–851. 25. Schmidt, W., Guidetti, P., Okuno, E. & Schwarcz, R. (1993) Characterization of human b rain k ynurenine aminotransferases using [ 3 H]kynurenine as a substrate. Neuro scienc e 55, 177–184. 26. Okuno, E.F ., Ishikawa, T., Tsujimoto, M., Nakamura, M., Schwarcz, R. & Kido, R. (1990) Purification and characterization of kynurenine-pyruvate aminotransferase from rat kidney and brain. Brain R es. 534, 3 7–44. 27. Li, J. & Li, G. (1997) Transamination of 3-hy droxykynurenine to produce x anthu renic ac id: a major branch pathway o f tryptophan metabolism in the mosquito, Aedes aegypti,duringlarvaldevel- opment. Insect Biochem. Mol. Bi ol. 27, 8 59–867. 28. Han, Q. & Li, J. (2002) Comparative characterization of Aedes 3-hydroxykynurenine transaminase/alanine glyoxylate transami- nase and Drosophila se rine pyruvate aminotransferase. FEB S Lett. 527, 1 99–204. 29. Baran, H., O kuno, E ., Kido, R. & Sc hwarcz, R . ( 1994) Purifica- tion and c haracterization of kyn urenine aminotransferase I from human brain. J. Neurochem. 62, 730–738. 30. Cooper, A.J. & Meister, A. (1981) Com parative studies of gluta- mine transaminases from rat tissues. Comp. Biochem. P hys iol. B 69B, 137 –145. 31. Kocki, T., Luchowski, P., Luchowska, E., Wielosz, M., Turski, W.A. & U rbanska, E.M. (2003) L -cysteine sulphinate, endogenous sulphur-containing amino a cid, inh ibits rat brain kynu renic a cid production via selective interference with kynurenine amino- transferase II. Neurosci. Lett. 346, 9 7–100. Ó FEBS 2004 Characterization of human kynurenine aminotransferase I (Eur. J. Biochem. 271) 4813 [...]... (1993) Sulphur-containing excitatory amino acids in intercellular communication Biochem Soc Trans 21, 72–77 40 Turski, W.A., Herrling, P.L & Do, K.Q (1987) Effects of L-cysteine-sulphinate and L-aspartate, mixed excitatory amino acid agonists, on the membrane potential of cat caudate neurons Brain Res 414, 330–338 41 Cooper, A.J & Meister, A (1974) Isolation and properties of a new glutamine transaminase... glutamine transaminase K of Escherichia coli: identity with aspartate aminotransferase Biochem J 360, 617–623 34 Garrett, R & Grisham, C.M (1999) Biochemistry, 2nd edn Saunders College Publications, Fort Worth 35 Rossi, F., Han, Q., Li, J., Li, J & Rizzi, M (2004) Crystal structure of human kynurenine aminotransferase I J Biol Chem 279, DOI: 10.1074/jbc.M409291200 36 John, R.A (1995) Pyridoxal phosphate-dependent... enzymes Biochim Biophys Acta 1248, 81–96 Ó FEBS 2004 37 Jansonius, J.N (1998) Structure, evolution and action of vitamin B6-dependent enzymes Curr Opin Struct Biol 8, 759–769 38 Cooper, A.J., Haber, M.T & Meister, A (1982) On the chemistry and biochemistry of 3-mercaptopyruvic acid, the alpha-keto acid analog of cysteine J Biol Chem 257, 816–826 39 Cuenod, M., Grandes, P., Zangerle, L., Streit, P &... (Eur J Biochem 271) 32 Wejksza, K., Rzeski, W., Parada-Turska, J., Zdzisinska, B., Rejdak, R., Kocki, T., Okuno, E., Kandefer-Szerszen, M., Zrenner, E & Turski, W.A (2004) Kynurenic acid production in cultured bovine aortic endothelial cells Homocysteine is a potent inhibitor Naunyn-Schmiedebergs Arch Pharmacol 369, 300–304 33 Han, Q., Fang, J & Li, J (2001) Kynurenine aminotransferase and glutamine transaminase... excitatory amino acid agonists, on the membrane potential of cat caudate neurons Brain Res 414, 330–338 41 Cooper, A.J & Meister, A (1974) Isolation and properties of a new glutamine transaminase from rat kidney J Biol Chem 249, 2554–2561 . pH dependence, substrate specificity and inhibition of human kynurenine aminotransferase I Qian Han, Junsuo Li and Jianyong Li Department of Pathobiology,. information about the s ubstrate specificity and cosubstrate inhibition of the enzyme. hKAT -I is inhibited by Tris under physiological pH conditions, w hich explains