The Saccharomyces cerevisiae orthologue of the human protein phosphatase core regulatory subunit R2 confers resistance to the anticancer drug cisplatin ´ C James Hastie1,*, Cristina Vazquez-Martin1,*, Amanda Philp1, Michael J R Stark2 and Patricia T W Cohen1 Medical Research Council Protein Phosphorylation Unit, School of Life Sciences, University of Dundee, UK Division of Gene Regulation and Expression, School of Life Sciences, University of Dundee, UK Keywords cisplatin; platinum-based anticancer drugs; Pph3; protein phosphatase 4; Psy4 Correspondence P T W Cohen, MRC Protein Phosphorylation Unit, School of Life Sciences, MSI ⁄ WTB ⁄ CIR, University of Dundee, Dow Street, Dundee DD1 5EH, UK Fax: +44 1382 223778 Tel +44 1382 384240 E-mail: p.t.w.cohen@dundee.ac.uk *These authors contributed equally to this work (Received 28 April 2006, revised 22 May 2006, accepted 24 May 2006) doi:10.1111/j.1742-4658.2006.05336.x The anticancer agents cisplatin and oxaliplatin are widely used in the treatment of human neoplasias A genome-wide screen in Saccharomyces cerevisiae previously identified PPH3 and PSY2 among the top 20 genes conferring resistance to these anticancer agents The mammalian orthologue of Pph3p is the protein serine ⁄ threonine phosphatase Ppp4c, which is found in high molecular mass complexes bound to a regulatory subunit R2 We show here that the putative S cerevisiae orthologue of R2, which is encoded by ORF YBL046w, binds to Pph3p and exhibits the same unusually high asymmetry as mammalian R2 Despite the essential function of Ppp4c–R2 in microtubule-related processes at centrosomes in higher eukaryotes, S cerevisiae diploid strains with homozygous deletion of YBL046w and two or one functional copies of the TUB2 gene were viable and no more sensitive to microtubule-depolymerizing drugs than the control strain The protein encoded by YBL046w exhibited a predominantly nuclear localization These studies suggest that the centrosomal function of Ppp4c–R2 is not required or may be performed by a different phosphatase in yeast Homozygous diploid deletion strains of S cerevisiae, pph3D, ybl046wD and psy2D, were all more sensitive to cisplatin than the control strain The YBL046w gene therefore confers resistance to cisplatin and was termed PSY4 (platinum sensitivity 4) Ppp4c, R2 and the putative orthologue of Psy2p (termed R3) are shown here to form a complex in Drosophila melanogaster and mammalian cells By comparison with the yeast system, this complex may confer resistance to cisplatin in higher eukaryotes Cisplatin and oxaliplatin are potent chemotherapeutic agents currently used in the treatment of many cancers, including lung, gonadal, head, neck and bowel neoplasias However, the unpredictable resistance of certain tumours to these platinum-based agents, which bind to DNA, poses significant problems The mechan- ism by which resistance arises is obscure, and one approach to dissecting it has been to examine the sensitivity of lower organisms carrying different gene deletions or disruptions to these drugs In a recent genome-wide screen of Saccharomyces cerevisiae deletion strains, most of the genes identified as conferring Abbreviations ERK, extracellular signal-regulated kinase; 5-FOA, 5-fluoro-orotic acid; HEK293, human embryonic kidney cell line 293; IRS4, insulin receptor substrate 4; JNK, c-Jun N-terminal kinase; NF-jB, nuclear factor jB; MMS, methyl methanesulphonate; Pph, Saccharomyces cerevisiae protein phosphatase; Ppp ⁄ PP, protein serine ⁄ threonine phosphatase in mammals and Drosophila; Ppp4c, protein phosphatase catalytic subunit (also termed PP4, PPX); Psy, platinum sensitivity; SMN, survival of motor neuron; TNF-a, tumour necrosis factor-a; TOR, target of rapamycin 3322 FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS C J Hastie et al Resistance to cisplatin sensitivity to oxaliplatin and cisplatin were in the DNA damage and repair pathways However, one strain with a deletion of the protein serine ⁄ threonine phosphatase, Pph3p, was ranked 10th and 14th in sensitivity to oxaliplatin and cisplatin, respectively [1] Suprisingly, Pph21p and Pph22p, the most closely related protein phosphatases to Pph3p in the PPP family (Table [2]), were not found to be sensitive to these drugs Previous studies on Pph3p function had shown that it was encoded by a nonessential gene and had overlapping properties with Pph21p and Pph22p, allowing limited growth in some genetic backgrounds when the PPH21 and PPH22 genes were deleted [3,4] In addition, Pph3p and the other Tap42p interacting phosphatases (Sit4p, Pph21p and Pph22p) are involved in the target of rapamycin (TOR) kinase-mediated modification of Gln3p, a GATA-type transcription factor responsive to different nitrogenous nutrients and starvation [5] In higher organisms, the orthologue of Pph3p is believed to be the protein phosphatase catalytic subunit (Ppp4c), and the Pph21 ⁄ 22 phosphatases are othologous to PP2Ac ([2,6] Table 1) In contrast to S cerevisiae Pph3p, Ppp4c is encoded by an essential gene in Drosophila melanogaster, where it is required for the recruitment of c-tubulin to the centrosomes and formation of the mitotic spindle [7] In Caenorhabditis elegans, Ppp4c is encoded by two genes, one of which is similarly required for the maturation of centrosomes and the formation of the spindle in mitosis as well as for sperm meiosis and the formation of chiasmata during meiosis [8] Recently, it has become increasingly clear that Ppp4c may perform a multiplicity of functions in higher eukaryotes A Ppp4 complex interacts with the survival of motor neuron (SMN) complex and enhances the temporal localization of the small nuclear ribonucleoproteins in human cells, indicating a function in spliceosomal assembly [9] Ppp4c may participate in cellular signalling path- ways, including the tumour necrosis factor-a (TNF-a)induced activation of c-Jun N-terminal kinase (JNK), the hematopoietic progenitor kinase JNK pathway [10,11] and the TNF-a downregulation of insulin receptor substrate (IRS4) [12] Members of the nuclear factor jB (NF-jB) family of transcription factors associate with Ppp4c, which stimulates NF-jB-mediated transcription and DNA binding [13] Interestingly, Ppp4c has recently been implicated in the cisplatin-mediated activation and dephosphorylation of NF-jB p65 (also termed RelA), which may underlie the increased cisplatin resistance found in cell lines following suppression of the extracellular signal-regulated kinase (ERK) pathway, which leads to the activation of NF-jB [14] The subunit composition of the Ppp4 complexes that may be involved in cisplatin resistance are not delineated Ppp4 holoenzymes isolated from mammalian tissues have led to the identification of two regulatory subunits of Ppp4c that not interact with the closely related PP2Ac, namely R1 (105 kDa) [15] and R2 (55 kDa) [16] These regulatory subunits form independent heterodimers with Ppp4c A further regulatory subunit, a4 (39 kDa, putative orthologue of Tap42p), associates with protein phosphatase catalytic subunits of Ppp4, PP2A and Ppp6 to form heterodimeric complexes [17] R2 is likely to be a core regulatory subunit, such that the Ppp4c–R2 complex may then interact with a variable third subunit, as observed for PP2A complexes Gemin3/gemin4 or gemin4 of the SMN complex has been identified as a possible variable subunit associating with the human Ppp4c–R2 complex [9] Putative orthologues of mammalian R2 were identified in several species from sequence similarities, including D melanogaster, C elegans and S cerevisiae [16] Here we examine the properties of the putative S cerevisiae R2 orthologue, YBL046w, and show that deletion of YBL046w, similarly to deletion of PPH3, confers sensitivity to the anticancer drug cisplatin Table Putative protein phosphatase subunit orthologues of S cerevisiae, D melanogaster and H sapiens in the PP2A subfamily of the PPP family R1, R2 and a4 show mutually exclusive binding to Ppp4c Subunit type S cerevisiae Drosophila Human Catalytic subunit Core regulatory subunit of Pph3 ⁄ Ppp4c Regulatory subunit of Pph3 ⁄ Ppp4c Core regulatory subunit of Ppp4c Catalytic subunit Catalytic subunit Catalytic subunit Common regulatory subunit of all the above catalytic subunits Pph3p YBL046w ⁄ Psy4p Psy2p Ppp4c ⁄ Pp4 ⁄ cmm R2 R3 ⁄ flfl Pph21p ⁄ Pph22p Sit4p Ppg1p Tap42p Pp2A ⁄ mts PpV Ppp4c ⁄ PP4 ⁄ PPX R2 R3 R1 PP2Aca ⁄ b Ppp6c ⁄ PP6c Tap42 a4 FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS 3323 Resistance to cisplatin C J Hastie et al Results Identification of the protein encoded by YBL046w as a regulatory subunit of Pph3 The protein encoded by S cerevisiae ORF YBL046w (SPTREMBL P38193) was suggested to be a putative orthologue of the mammalian R2 core regulatory subunit of Ppp4c (Table 1) from an alignment of amino acids 97–135 with amino acids 176–212 of the human protein, which showed 46% identity [16] However, outside this region, the proteins are difficult to align because identity between the two proteins is low Nevertheless, the alignment in Fig shows that the overall similarity of the protein encoded by YBL046w to human ⁄ Drosophila R2 sequences is 36% We sought to determine whether the properties of R2 and the protein encoded by ORF YBL046w were also similar Bacterially expressed human GST–R2 was shown to interact with native Ppp4c and not with other protein phosphatase catalytic subunits in the PPP family [16] S cerevisiae cells expressing YBL046w tagged at its C-terminus with an MYC13 epitope were independently transformed with specific PCR-generated transformation modules such that derivatives were generated in which either Pph3p, Pph21p, Sit4p or Ppg1p was expressed with a triple haemagglutinin (HA) tag at the N-terminus (Tables and 3) Figure shows that when HA-tagged Pph3p (the putative orthologue of Ppp4c) was immunoadsorbed from cell extracts, MYC13-tagged YBL046w was also adsorbed together with the HA-tagged phosphatase In contrast, even though Pph21p, Sit4p and Ppg1p are the most closely related yeast protein phosphatases to Pph3p, MYC13-tagged YBL046w did not coimmunoprecipitate with any of these other three HA-tagged phosphatase catalytic subunits (Fig 2) A further characteristic of human R2 was that, although its molecular mass calculated from its amino acid sequence is 55 kDa, it eluted from Superose with an apparent molecular size of 450 kDa [16] Bacterially expressed S cerevisiae Flag-tagged YBL046w (calculated molecular mass 51.6 kDa and 50.6 kDa with and without the Flag tag, respectively) elutes from Superose at the same anomalous position of  450 kDa as Drosophila His6–R2 (Fig 3) and human His6–R2 [16] Examination of the phenotype of S cerevisiae strains carrying a deletion of the YBL046w gene Haploid yeast strains carrying a null allele of YBL046w in AY925 and AY926 backgrounds and diploid strains homozygous for this allele in an AY927 background are viable and showed no growth differences from wild-type 3324 control cells on agar plates of rich medium (YPD), synthetic medium (SC) containing either glucose or galactose, or rich medium depleted in nitrogen Cell size was similar to that of the wild type in both log and stationary phases, as visualized by microscopy Mating and sporulation were normal The YBL046w null mutants did not show increased sensitivity to low or high temperatures in the range 14–37 °C, heat shock at 55 °C, caffeine (1.5–6 mm) or vanadate (2 mm) The sensitivity of the YBL046w null mutants to calcofluor white (0.1– 0.2%), calcium chloride (100 mm), sorbitol (1 m) and SDS (0.005–0.01%) indicated that the integrity of the cell wall was not compromised compared with the wild type Sensitivities to reagents that block the cell cycle, hydroxyurea (0.2 m), nocodazole (2–45 lgỈmL)1) and benomyl (2–25 lgỈmL)1), were identical to those of the wild-type cells Examination of the phenotype of S cerevisiae carrying deletions for both the YBL046w gene and the TUB2 gene Since decreased expression of Ppp4c in D melanogaster and C elegans leads to aberrant growth and ⁄ or organization of microtubules at centrosomes, coupled with an arrest during mitosis, it seemed likely that mutation of the core regulatory subunit R2 and its orthologues in lower eukaryotes would also lead to a similar phenotype Although ybl046wD mutants of S cerevisiae did not show increased sensitivity to the microtubule-depolymerizing drugs nocodazole and benomyl, we sought to test whether compromising the function of TUB2 encoding b-tubulin might uncover a role for YBL046w in microtubule nucleation or organization in yeast Since homozygous deletion of TUB2 in diploid S cerevisiae strains is lethal, whereas heterozygous null TUB2 mutants are more sensitive to benomyl [18], S cerevisiae strains heterozygous for a TUB2 deletion in the Euroscarf background were created (Table 4) Figure shows that there is an effect of TUB2 ⁄ tub2D::HISMX6 heterozygosity on benomyl sensitivity in the BY4743 background, as expected (compare the growth of strains BY4743 and BY4743 TUB2 ⁄ tub2D::HISMX6 on plates containing 12 and 16 lgỈmL)1 benomyl) However, there is no clear effect of the homozygous deletion of YBL046w on benomyl sensitivity with either two or one functional copies of TUB2 Effect of cisplatin on PPH3 (YDR075w), YBL046w and PSY2 (YNL201c) deletion strains A genome-wide screen of S cerevisiae genes that, when individually deleted, conferred sensitivity to the FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS C J Hastie et al Resistance to cisplatin Fig Alignment of the Saccharomyces cerevisiae protein encoded by ORF YBL046w with human (Hs) and Drosophila melanogaster (Dm) R2 Identities between any two proteins are in black and similarities are in grey (GenEMBL accession numbers AJ271448 and AJ271449) anticancer agents cisplatin and oxaliplatin, identified among the top 20 most sensitive genes PPH3 and a gene of unknown function, YNL201c, which the authors termed PSY2 (for platinum sensitivity 2) [1] Psy2p and YBL046w were among several proteins found to associate with Pph3p in each of two separate genome-wide screens for interacting proteins [19,20] However, ybl046wD was not identified as sensitive to cisplatin and oxaliplatin We therefore decided to compare the sensitivity of pph3D, ybl046wD and psy2D diploid strains to increasing concentrations of cisplatin Figure 5A shows that all three homozygous diploid deletion strains were more sensitive than the control strain to mm and mm cisplatin, and that ybl046wD was just as sensitive to cisplatin as pph3D and psy2D In order to corroborate the effects of cisplatin on the ybl046wD strain, this strain was transformed with YCplac111 YBL046w We found that the growth of FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS 3325 3326 PPG1 N-terminal 3HA tag SIT4 N-terminal 3HA tag SIT4 N-terminal 3HA tag TUB2 deletion R5 F6 R6 F13 pF6a-HIS3MX6 TUB2 deletion PPH21 N-terminal 3HA tag PPH3 N-terminal 3HA tag PPH3 N-terminal 3HA tag PPG1 N-terminal 3HA tag R3 F4 R4 F5 R13 PSY4(YBL046w) deletion PSY4(YBL046w) deletion PSY4 C-terminal 13MYC tag PSY4 C-terminal 13MYC tag PPH21 N-terminal 3HA tag F1 R1 F2 R2 F3 pMPY-3xHA pMPY-3xHA pMPY-3xHA pF6a-HIS3MX6 GTTGGTGTTCTCATCGATTGTCAAACCACAATAAAAAGCTCGGATCCCCGGGTTAATTAA CAAATGGGAAGTTGTTGGTAGAGAAGTCATCTCTCGATCAGAATTCGAGCTCGTTTAAAC CCGTGAGAATATTAGCAGTCCATTAGGCAAGAAGTCCAGACGGATCCCCGGGTTAATTAA CAAATGGGAAGTTGTTGGTAGAGAAGTCATCTCTCGATCAGAATTCGAGCTCGTTTAAAC CATAGTGGAAAGAGGGATATAAATTATCGCATAAAACAATAAACAAAAAGAAAAATG AGGGAACAAAAGCTGGAG GGGAGTCAGCTGTTCGGTAACAGCATCTTGCATAGGCACATCTAAATCTGTATCCTGTAGGGCGAATTGGG GCAAAGTAAAACAGCACGAAAAAAGTGATTACAAATTTCAAGGGAGATATGATGAGGGAACAAAGGCTGGAG GGTTTCTTCAGGAATATGTTTTCCGTCTCTCAGTGATGCTATAATCTTATCTAAGTCCTGTAGGGCGAATTGGG GTATCCCCACTGTGTACTTTTATTTTTGGTTAGAGAATTGGCCCAGTAGAGATGGAA AGGGAACAAAAGCTGGAG GTAACTTCAGGTAGTAACTGGGCCTTGTATAGCCTTTCTAAACATTCGTCCAACTGTAGGGCGAATTGGG GAAATACTATTGAAGCTCAAAAACATCCATAATAAAAGGAACAATAACAATGGTAAGGGAACAAAAGCTGGAG GCGCCTGGCATTTCTTTATTGTTTCAAGCCATTCGTCGGGGCCTCTAGACTGTAGGGCGAATTGGG GGCAATTGGAGTGACATAGCAGCTACTACAACTACAAAAGCAAAATCTCCACAAAGTAAT CGGATCCCCGGGTTAATTAA CCAAGTGCTTCAATCCTAGAGAAGAAGAAAGGTAAGAAAAAGAAAGGAAAGCAACTTAAT GAATTCGAGCTCGTTTAAAC pFA6a-HIS3MX6 pFA6a-HIS3MX6 pFA6a-13Myc-HIS3MX6 pFA6a-13Myc-HIS3MX6 pMPY-3xHA Gene modification pMPY-3xHA pMPY-3xHA pMPY-3xHA pMPY-3xHA Primer sequence (5¢- to 3¢) Transformation module C J Hastie et al Primer Table Oligonucleotide primers used for amplification of transformation modules and subsequent gene deletion or tagging Sequences corresponding to the gene to be deleted or tagged are underlined and those specific to the transformation module are in italics Transformation modules are described in Longtine et al [24] and Schneider et al [26] Those specific to the transformation module are not underlined Resistance to cisplatin this rescued strain on plates containing mm and mm cisplatin was the same as that of the control strain transformed with the vector YCplac111 (data not shown) The YBL046w gene was therefore termed PSY4 (for platinum sensitivity 4) The primary target of cisplatin in cells is DNA Since interaction with DNA may impair the DNA and activate the DNA damage response pathways, we sought to examine whether Pph3p, YBL046w and Psy2p are involved in cisplatin effects via participation in the Rad53p pathways In response to DNA damage caused by treatment of cells with methyl methanesulphonate (MMS), Rad53p becomes phosphorylated, as can be seen in Fig 5B However, cisplatin did not elicit the Rad53p phosphorylation in control, pph3D, ybl046wD or psy2D cells Thus, we have no evidence that cisplatin activates the Rad53p DNA damage pathways or that the Pph3p–Psy4p–Psy2p complex modulates the phosphorylation of Rad53p in response to cisplatin Ppp4c, R2 and R3 form a complex in human and Drosophila cells A putative human orthologue of YNL201c ⁄ Psy2p was identified in the NCBI database from sequence similarities, and termed R3 (accession number BC02409) Immunoadsorption of endogenous R2 from Drosophila Kc and S2 cell lysates showed the presence of endogenous R3 and Ppp4c in the immunopellets (Fig 6) Conversely, immunoadsorption of endogenous R3 from the same cells showed the presence of R2 and Ppp4c in immunopellets In addition, anti-FLAG immunopellets from human cells (HEK293) cells expressing FLAG–R2 showed the presence of R3 and Ppp4c (Fig 6) These results demonstrate that Ppp4c, R2 and R3 form a complex in higher eukaryotes Discussion Diploid S cerevisiae strains that are homozygous for deletion of the protein phosphatase catalytic subunit gene PPH3 are more sensitive to the anticancer drugs cisplatin and oxaliplatin than wild-type yeast [1] Pph3p is believed to be the orthologue of mammalian Ppp4c, although it shows only marginally greater sequence similarity to human Ppp4c than to human PP2A or Ppp6c [2] In mammalian cells, Ppp4c is found in high molecular mass complexes, some of which comprise Ppp4c bound to a regulatory subunit R2 [16] We show here that Pph3p specifically interacts with YBL046w ⁄ Psy4p, a protein with sequence similarity to R2 In addition, YBL046w ⁄ Psy4p shows FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS C J Hastie et al Resistance to cisplatin Table Oligonucleotide primers used for amplification of markers and ⁄ or genes subsequent to gene deletion or tagging The numbers relative to the initiating ATG of the gene are indicated Primer Gene modification Primer sequence (5¢- to 3¢) F7 R7 F8 R8 F9 R9 F10 R10 F11 R11 F12 R12 PSY4(YBL046w) deletion PSY4(YBL046w) deletion PSY4 C-terminal 13MYC tag PSY4 C-terminal 13MYC tag PPH21 N-terminal 3HA tag PPH21 N-terminal 3HA tag PPH3 N-terminal 3HA tag PPH3 N-terminal 3HA tag PPG1 N-terminal 3HA tag PPG1 N-terminal 3HA tag SIT4 N-terminal 3HA tag SIT4 N-terminal 3HA tag (1) ATGAGCTCGACGATGTGGGATG (22) (1323) TCTGGACTTCTTGCCTAATGGAC (1301) () 26) CGATTGTCAAAGCACAATAAAAAGCT () 1) (1346) GTAGAGAAGTCATCTCTCGATCA (1324) () 419) GTTACAGGTTCCTTTCGACGCAC () 397) (1409) CAAGCAGCCTGAAGAATGGAAGTTC (1385) () 695) GGTACGGTCGACCTGGATTCCAG () 673) (1422) GACCTTGCCTGGAATCCCAGG (1402) () 114) CAGCGAGTTGTAGGTAATTTGGAAC () 90) (1285) GGAAGATTATGAGGTACATGATCAG (1261) () 457) GCCGCGGGTAACATGAAGCGG () 437) (1048) GTGTATCGTATCGTAGCAAATGGCG (1024) the same anomalous behaviour as both human and Drosophila R2 on gel filtration, suggesting that YBL046w ⁄ Psy4p, like human and Drosophila R2, is a highly asymmetrical or unfolded protein The major phenotype seen in D melanogaster and C elegans deficient in Ppp4c expression is defective nucleation or growth of microtubules at centrosomes leading to an arrest in the formation of the mitotic spindle [7,8] We therefore sought to examine whether deletion of YBL046w ⁄ PSY4 in S cerevisiae would lead to any abnormalities in microtubule-related processes by testing growth in the presence of the microtubuledepolymerizing drug benomyl We used strains heterozygous for deletion of the TUB2 gene, which encodes b-tubulin, in an attempt to make cells more sensitive to any defects in tubulin-related processes However, this did not uncover a role for YBL046w ⁄ PSY4 in any microtubule-related events In accordance with these studies, we found that C-terminally MYC13-tagged YBL046w ⁄ Psy4p has a nuclear localization with no evidence of localization at the spindle pole bodies (data not shown) This contrasts with the situation in human A431 and HeLa cells, where R2 has been localized to centrosomes [16] Ppp4c has been localized to centrosomes in human, Drosophila and C elegans cells [7,8,21], but there are no reports of Pph3p being present at spindle pole bodies, and pph3 deletion strains are viable [3] Thus it appears that the essential function of Ppp4c–R2 in microtubule-related processes at centrosomes in higher eukaryotes is not required or may be performed by a different phosphatase in yeast Two different screens of the S cerevisiae proteome identified several proteins showing association with Pph3p [19,20] However, there were only two proteins identified that were common to both screens; one was YBL046w ⁄ Psy4p, the orthologue of R2, and the other was an unknown protein YLN201c, later named Psy2p because it was also found to be sensitive to cisplatin and oxaliplatin [1] Data from the proteome analysis indicate that Psy2p, like YBL046w ⁄ Psy4p, is found in acomplex with Pph3p From sequence similarities, we have identified putative human and Drosophila orthologues (termed R3) of yeast Psy2p and shown that R3 forms a complex with R2 and Ppp4c in both higher eukaryotes These studies point to the existence of a trimeric complex, indicating that Ppp4 and Pph3 subunit structures may thus resemble those of PP2A and Pph21 ⁄ Pph22, where a core regulatory subunit forms a complex with the catalytic subunit to which a third variable subunit may bind Since YBL046w ⁄ Psy4p would appear to be an obligatory core subunit of Pph3p required for the binding of Psy2p, we examined the sensitivity of the YBL046w ⁄ Psy4p deletion strain to cisplatin The comparable increased sensitivities to cisplatin of the homozygous diploid deletion strains pph3D, ybl046w ⁄ psy4D and psy2D compared to wildtype yeast indicate a role for the Pph3p–(YBL046w ⁄ Psy4p)–Psy2p complex in conferring resistance to the anticancer drug cisplatin and suggest that the Ppp4c– R2–R3 complex in human cells may perform a similar function Cisplatin and oxaliplatin are platinum-based drugs that bind to DNA The results suggest that Pph3p– (YBL046w ⁄ Psy4p)–Psy2p and possibly the human orthologue Ppp4c–R2–R3 may regulate processes directly related to DNA function The low pI of all subunits (£ 5.1) indicates that the Pph3p and Ppp4c complexes are unlikely to bind directly to DNA but are more likely to modulate the function of transcription factors or other DNA-binding proteins In this respect, it is relevant that Pph3p has been found to play a role in the regulation of Gln3p, a transcription factor FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS 3327 Resistance to cisplatin C J Hastie et al A B C D E Fig Analysis of the interaction between the YBL046w protein and several protein phosphatase catalytic subunits Extracts were prepared from Saccharomyces cerevisiae b derived from AY925 strains coexpressing YBL046w–MYC13 and one of four different HA-tagged protein phosphatase catalytic subunits Supernatant and pellet fractions of the cell lysates were obtained by centrifugation following immunoadsorption from lysates with HA antibodies and protein G Sepharose Ten micrograms of lysate protein and the equivalent relative loadings of supernatant and pellet fractions were analysed by SDS ⁄ PAGE and immunoblotting with MYC antibodies (A) YBL046w–MYC13 and HA3– Pph3p (B) YBL046w–MYC13 and HA3–Sit4p (C) YBL046w–MYC13 and HA3–Pph21p (D) YBL046w–MYC13 and HA3–Ppg1p (E) Supernatant and pellet fractions of the cell lysates were obtained by centrifugation following immunoadsorption from lysates with MYC antibodies and protein G Sepharose; WT, AY925; MTAY925, YBL046w-MYC13, HA3PPA4 Twenty micrograms of lysate protein, 30 lg of protein from the supernatant fraction and the pellet fraction from mg of lysate protein were analysed by SDS ⁄ PAGE and immunoblotting with HA antibodies Arrows indicate the positions of YBL046w–MYC13, HA3–Pph3p and the IgG heavy chain Molecular mass markers are indicated in kDa 3328 FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS C J Hastie et al Resistance to cisplatin A B Fig Analysis of Flag–YBL046w and Drosophila His6–R2 by gel filtration Bacterially expressed Flag–YBL046w and Drosophila His6– R2 were subjected to gel filtration on Superose Column eluate fractions were analysed by SDS ⁄ PAGE and stained for protein with Coomassie blue: (A) Flag–YBL046w, (B) His6–DmR2 Column eluate fraction numbers are indicated above each lane Molecular mass markers for SDS ⁄ PAGE are indicated in kDa Arrows indicate the elution position of the molecular mass markers for Superose gel filtration, thyroglobulin (670 kDa) and ferritin (450 kDa) responsive to nitrogenous nutrients and starvation In humans, rapidly growing cancer cells may become starved of certain nutrients and therefore more dependent on the Ppp4-regulated systems However, the sensitivity of yeast to cisplatin was seen in optimal growth conditions, suggesting a wider role of the Pph3p– (YBL046w ⁄ Psy4p)–Psy2p complex in transcription and ⁄ or other DNA-related processes Recent studies have suggested that Psy2p may play a role in the DNA damage response [22], and a twohybrid study identified an interaction between Psy2p and Rad53p [23], which lies on the DNA damage response pathways We therefore investigated whether Rad53p is phosphorylated in response to cisplatin treatment Although we were able to show that Rad53p is phosphorylated in response to MMS, which causes DNA damage, we did not observe phosphorylation of Rad53p on treatment of control yeast strains or those carrying deletions of PPH3, YBL046w ⁄ PSY4 and PSY2 with cisplatin It is therefore unlikely that the Pph3p–(YBL046w ⁄ Psy4p)–Psy2p complex confers resistance to cisplatin through the Rad53p pathways We also found no evidence that the cell wall permeability was compromised in the YBL046w ⁄ PSY4 deletion strain, suggesting that cisplatin resistance was unlikely to be caused by increased entry of the drug Thus, other possibilities, such as a role for Pph3p– (YBL046w ⁄ Psy4p)–Psy2p in DNA repair processes, appear more likely to underlie the cisplatin sensitivity Table Saccharomyces cerevisiae strains Accession numbers for the Euroscarf strains (http://www.uni-frankfurt.de/fb15/mikro/euroscarf/ data/) are given in parentheses Diploid strain are indicated; all other strains are haploid PPH3 is ORF YDR075w, PSY4 is ORF YBL046w, and PSY2 is ORF YNL201c Ac number, Accession number Strain Genotype Reference AY925 AY926 AYS927 AY925 psy4D AY926 psy4D AYS927 psy4D (diploid) AY925 PSY4–MYC13 AY926 PSY4–MYC13 AY925 PSY4–MYC13, HA3–PPH21 AY925 PSY4–MYC13, HA3-PPH3 AY925 PSY4–MYC13, HA3–PPG1 AY925 PSY4–MYC13, HA3–SIT4 BY4743 (Y20000, diploid) MATa, ade2-1, his3-11, leu2-3, trp1-1, ura3-1, can1-100 MATa, ade2-1, his3-11, leu2-3, trp1-1, ura3-1, can1-100 Diploid of AY925 and AY926 AY925 psy4D::LEU2 AY926 psy4D::LEU2 AYS927 psy4D::LEU2 ⁄ psy4D::LEU2 AY925 PSY4–MYC13–HISMX6 AY926 PSY4–MYC13–HISMX6 AY925 PSY4–MYC13–HISMX6, HA3–PPH21 AY925 PSY4–MYC13–HISMX6, HA3–PPH3 AY925 PSY4–MYC13–HISMX6, HA3–PPG1 AY925 PSY4–MYC13–HISMX6, HA3–SIT4 MATa ⁄ MATa; his3D1 ⁄ his3D1; leu2D0 ⁄ leu2D0; MET15 ⁄ met15D0; LYS2 ⁄ lys2D0; ura3D0 ⁄ ura3D0 BY4743pph3D::kanMX4 ⁄ pph3D::kanMX4 BY4743psy4D::kanMX4 ⁄ psy4D::kanMX4 BY4743psy2D::kanMX4 ⁄ psy2D::kanMX4 BY4743TUB2 ⁄ tub2D::HIS3MX BY4743TUB2 ⁄ tub2D::HIS3MX, psy4D::kanMX4 ⁄ psy4D::kanMX4 Fernandez-Sarabia et al [29] Kim Arndt Black et al [30] This study This study This study This study This study This study This study This study This study Ac number Y34010 (diploid) Y33072 (diploid) Y32011 (diploid) MSYD504 and MSYD505 (diploid) MSYD503 and MSYD508 (diploid) FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS Ac number Ac number Ac number This study This study 3329 Resistance to cisplatin C J Hastie et al Fig Examination of the benomyl sensitivity of Saccharomyces cerevisiae strains homozygous for ybl046wD ⁄ ybl046wD and heterozygous for tub2D Cultures of BY4743 (TUB2 ⁄ TUB2 YBL046w ⁄ YBL046w:1, 2), Y33072 (TUB2 ⁄ TUB2 ybl046wD ⁄ ybl046wD: 3, 4), MSYD504 (TUB2 ⁄ tub2D YBL046w ⁄ YBL046w: 5), MSYD505 (TUB2 ⁄ tub2D YBL046w ⁄ YBL046w: 6), MSYD503 (TUB2 ⁄ tub2D ybl046wD ⁄ ybl046wD: 7) and MSYD508 (TUB2 ⁄ tub2D ybl046wD ⁄ ybl046wD: 8) were grown overnight Suitable 10-fold serial dilutions were prepared and  lL samples of each (containing  25 000,  2500,  250 and  25 cells) were spotted in that order (from left to right) on plates containing the indicated concentrations of benomyl and grown at 26 °C for days of strains carrying deletions of PPH3, YBL046w ⁄ PSY4 and PSY2 Experimental procedures Yeast strains, plasmids, media and general methods Saccharomyces cerevisiae strains used in this study are described in Table The HIS3MX marker was employed as a selective marker for deletion of the PSY4 ⁄ YBL046w gene using a single-step PCR-based method [24] with plasmid pFA6aHis3MX6 as template and source of the HIS3 gene and primers F1 and R1 (Table 2) Single-step tagging of YBL046w with sequences encoding MYC13 at the C-terminus was performed by an initial PCR [24] using primers F2 and R2 with the template pFA6a-13MYC-HisMX6, a protein-tagging module consisting of DNA encoding MYC13 together with the S cerevisiae ADH1 terminator Transformation of yeast cells with the PCR products was carried 3330 out using a lithium acetate method [25] N-terminal HA tagging of PPH21, PPH3, PPG1 and SIT4 was performed by PCR with template pMPY-3xHA and primers F3 and R3 to F6 and R6 (Table 2) The template contained the URA3 gene flanked by three direct repeats of the HA epitope tag [26] After transformation with the PCR fragment (selecting on Ura dropout plates to allow integration of the PCR product), strains were grown on 5-fluoro-orotic acid (5-FOA) plates to select for direct repeat mediated ‘pop-out’ of the URA3 gene, leaving behind the 3HA epitope All transformants were verified by PCR of genomic DNA using gene-specific primers (Table 3) Oligonucleotides were synthesized by K Jarvie (School of Life Sciences, University of Dundee) YPD medium contained 1% yeast extract, 2% peptone and 2% glucose Synthetic complete medium (SC) contained 0.67% yeast nitrogen base (Difco Laboratories, Detroit, MI, USA), 2% glucose and amino acids and bases as described [27], omitting histidine as required for selection or adding G418 (200 lgỈmL)1 on agar plates) to select for FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS C J Hastie et al Resistance to cisplatin A Fig (A) Investigation of the effects of the cisplatin sensitivity of Saccharomyces cerevisiae homozygous for pph3D, ybl046wD and psy2D Serial dilutions of independent colonies (WT 1, and 3) on all plates are from the control Y20000 (BY4743) strain Serial dilutions of independent colonies (MT 4, and 6) are from strain Y32011 (BY4743 psy2D ⁄ psy2D, left panel), strain Y33072 (BY4743 ybl046wD ⁄ ybl046wD, middle panel), and strain Y34010 (BY4743 pph3D ⁄ pph3D, right panel) The cisplatin concentration in each row of plates is indicated on the right Plates were incubated at 30 °C for days The whole experiment was repeated three times with similar results (data not shown) (B) Comparison of the effects of cisplatin and methyl methanesulphonate (MMS) on Rad53p Control strain Y20000 (BY4743), strain Y33072 (BY4743 ybl046wD ⁄ ybl046wD) and strain Y32011 (BY4743 psy2D ⁄ psy2D) were grown in YPD in the absence and presence of 0.03% MMS or mM cisplatin Cell lysates were prepared and the lysate proteins were separated by SDS ⁄ PAGE and immunostained with antibodies to Rad53, which also recognize phosphorylated Rad53 (Rad53-P) B kanamycin resistance Sporulation medium contained 1% potassium acetate and 0.1% yeast extract Medium depleted in nitrogen was YPD without the yeast nitrogen base S cerevisiae cells were grown at 28 °C unless otherwise stated To analyse the response to different media and sensitivity to various compounds, S cerevisiae cells were grown from independent colonies overnight in YPD, cooled to °C, sonicated briefly and counted in a CASY1 cell counter (Scharfe Systems, Rentlingen, Germany), and diluă ted in YPD to 2–5 · 106 cellsỈmL)1; this was followed by three serial 10-fold dilutions, and all dilutions were spotted onto agar plates (5 lL per spot) using a multipronged inoculation device (Dan-Kar Corp St Woburn, MA, USA) Benomyl was dissolved in DMSO and added to near-boiling YPD agar Plates for each concentration of benomyl were poured from the same batch and so are directly comparable Cisplatin was dissolved in DMSO and diluted immediately into YPD agar before pouring the plates Plates were used on the day of preparation and incubated at 26–30 °C for days for colony growth Immunological analyses of S cerevisiae protein phosphatase complexes and Rad53 S cerevisiae transformants expressing different 3HAtagged protein phosphatase catalytic subunits and Psy4p ⁄ YBL046w-MYC13 were grown at 26 °C to a density of 107 cellsỈmL)1 in selective media without histidine Yeast cells were harvested by centrifugation at 5000 g for 10 in a SX4750 rotor (Beckman Coulter, High Wycombe, UK), washed in an equal volume of water, and suspended in lysis buffer [50 mm Tris ⁄ HCl, pH 7.5, 100 mm MgCl2, mm EDTA, 0.1% (v ⁄ v) 2-mercaptoethanol, 1% (v ⁄ v) Triton X-100, · complete protease inhibitors (Roche Diagnostics, Lewes, UK) Acid-washed glass beads (0.4 mm diameter; 0.7 gỈmL)1) were added and the cells were lysed by 20 cycles of vortexing for 30 s followed by 30 s on ice Extracts were centrifuged in a F45-24-11 rotor (Eppendorff, Cambridge, UK) for at 14 000 g at °C and the supernatant was removed The glass beads were washed with one pellet volume of lysis buffer and the supernatants were pooled FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS 3331 Resistance to cisplatin C J Hastie et al affinity antibodies and 40 lL of a 50% suspension of protein G Sepharose, or with 30 lL of anti-c-MYC agarose conjugate (Sigma-Aldrich, Poole, UK) The immunopellets were washed 10 times with lysis buffer and resuspended in Novex sample buffer for analysis by SDS ⁄ PAGE on Novex 4–12% Bis-Tris gels, followed by immunoblotting For analysis of Rad53p after treatment of S cerevisiae with MMS and cisplatin, yeast cultures were grown overnight in YPD, diluted to D600 of 1.0 and incubated for 60 with shaking at 30 °C Following addition of 0.03% (v ⁄ v) MMS or mm cisplatin, the cultures were incubated similarly for 90 The cells were collected by centrifugation at 5000 g, in a SX4750 rotor (Beckman Coulter), and the proteins from the cell lysates were prepared by extraction with trichloracetic acid [28] Proteins were separated by SDS ⁄ PAGE using Novex 4–12% Tris ⁄ glycine gels and examined by immunoblotting with two Rad53p antibodies (yN-19 and yC-19) used together (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) A B C Heterologous expression and gel filtration of Flag-tagged Psy4p/YBL046w and human His6-tagged R2 Fig Analysis of Ppp4 complexes in human and Drosophila cells (A) Drosophila S2 cell lysate (1 mg of protein) was used to immunoadsorb endogenous Drosophila R2 using Drosophila R2 antibody coupled to protein G Sepharose Lysate (L, 50 lg), supernatant (SN, 50 lg) and pellet (P) fractions were obtained by centrifugation following the immunoadsorption Sheep preimmune IgG was used for the control in place of the Drosophila R2 antibody Proteins in the lysate, supernatant and pellet fractions were analysed by SDS ⁄ PAGE and subsequent immunoblotting with Drosophila R3 antibodies and Ppp4c antibodies (B) Drosophila S2 cell lysate was similarly used to immunoadsorb endogenous Drosophila R3 using Drosophila R3 antibody coupled to protein G Sepharose Proteins in the lysate, supernatant and pellet fractions were immunoblotted with Drosophila R2 antibodies and Ppp4c antibodies (C) Human HEK293 cells were transfected with a vector expressing Flag–R2 (human) Cell lysate (1 mg of protein) was used to immunoadsorb Flag–R2 using Flag antibody coupled to protein G Sepharose Proteins in the lysate (L, 50 lg), supernatant (SN, 50 lg) and pellet (P) fractions immunoblotted with human R3 antibodies and Ppp4c antibodies Two milligrams of lysate was precleared at °C for h on a shaking platform with 80 lL of a 50% suspension of protein G Sepharose, equilibrated in lysis buffer Following centrifugation for in a F45-24-11 rotor (Eppendorff, Cambridge, UK) at 14 000 g, the supernatant was removed and incubated for h as above with lg of rat HA high- 3332 A construct for bacterial expression of N-terminally Flagtagged Psy4p ⁄ YBL046w was prepared by PCR using a yeast DNA extract as a template and oligonucleotide primers 5¢GAATTCATGGACTACAAGGACGACGATGACAAG ATGAGCTCGACGATGTTGGATGATG-3¢, which incorporated an EcoRI site (underlined) and encoded the FLAG tag (DYKDDDDK), and primer 5¢-AAGCTTTCATCTG GACTTCTTGCCTAATGG-3¢, which incorporated a HindIII site (underlined) The resulting PCR product was ligated into the pCR 2.1-TOPO vector and verified by sequencing, and the EcoRI–HindIII fragment was subcloned into the pET21a vector DNA sequencing was performed on an Applied Biosystems (Foster City, CA, USA) 373A automated DNA sequencer using Taq dye terminator cycle sequencing, or on an Applied Biosystems model 3730 automated capillary DNA sequencer using Big-Dye Ver 3.1 chemistry (University of Dundee DNA sequencing service managed by Dr Nick Helps, http://www.dnaseq.co.uk) FLAG-tagged Psy4p ⁄ YBL046w was expressed in Escherichia coli from pET21a, immunoadsorbed from cell lysates using anti-FLAG M2 Affinity gel (Sigma-Aldrich), and specifically eluted from the resin using FLAG peptide (SigmaAldrich) His6–R2 was expressed in insect cells as described previously [16] FLAG-tagged Psy4p ⁄ YBL046w or His6–R2 was subjected to gel filtration analysis on an HR10 ⁄ 30 Superose column (Amersham Biosciences, Chalfont St Giles, UK) equilibrated in 50 mm Tris ⁄ HCl, pH 7.5, 200 mm NaCl, 0.03% (v ⁄ v) Brij-35, mm EDTA, 0.1 mm EGTA, 5% (v ⁄ v) glycerol, and 0.1% (v ⁄ v) 2-mercaptoethanol The column was run at 0.4 mLỈmin)1, with 0.2 mL fractions being collected FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS C J Hastie et al Human and Drosophila cell culture and immunological techniques Human 293 cells were cultured and transfected with Flag– R2 as described in Hastie et al [16] Drosophila S2 and Kc167 cells were propagated at room temperature (22 °C) in Schneider’s Drosophila medium (Gibco BRL, Paisley, Scotland, UK) supplemented with 10% (v ⁄ v) FBS Cells were lysed in 50 mm Tris ⁄ HCl, pH 7.5, 150 mm NaCl, mm EDTA, 0.1 mm EGTA, 5% glycerol, 0.03% Brij-35, 0.1% (v ⁄ v) 2-mercaptoethanol and ‘Complete’ protease inhibitors (Roche Diagnostics) After centrifugation at 16 000 g for 10 in a S40 rotor (Jouan B4i, Waltham, MA, USA), the supernatants were used for immunoadsorption analyses using antibodies coupled to protein-GSepharose as described in Hastie et al [16] Immunoblotting was performed following fractionation of proteins by SDS ⁄ PAGE on 4–12% Bis-Tris gels (Novex Invitrogen, Paisley, Scotland, UK) and transference of the proteins to nitrocellulose membranes (Schleicher and Shull, Dassel, Germany) The blots were probed with affinity-purified antibodies, and antibody binding was detected either using anti-sheep or anti-mouse IgG conjugated to horseradish peroxidase, followed by enhanced chemiluminescence (Amersham Biosciences), or using donkey anti-sheep IgG[H + L] conjugated to an IRDye800 fluorphore (Rockland Immunochemicals, Inc., Gilbertsville, PA, USA) followed by analysis of the immunoblots with the Li-Cor Odyssey system Ppp4 antibodies were raised against the N-terminal 57 amino acids of human Ppp4 as described in Helps et al [7] Human R3 antibodies were raised against amino acids 819–833, Drosophila R3 antibodies against amino acids 860–873, and Drosophila R2 antibodies against amino acids 591–610 Mouse MYC (9E10) antibodies, mouse HA (12CA5) antibodies and rat HA (3F10) highaffinity antibodies were obtained from Roche Diagnostics FLAG antibodies were obtained from Sigma-Aldrich Mouse and sheep secondary antibodies were purchased from Pierce, Chester, UK Acknowledgements The studies were funded by the Medical Research Council, UK References Wu HI, Brown JA, Dorie MJ, Lazzeroni L & Brown JM (2004) Genome-wide identification of genes conferring resistance to the anticancer agents cisplatin, oxaliplatin and mitocin C Cancer Res 64, 3940–3948 Cohen PTW (2004) Overview of protein serine ⁄ threonine phosphatases In Topics in Current Genetics: Protein Phosphatases (Arino J & Alexander DR, eds), pp 1–20 Springer-Verlag, Berlin, Heidelberg Resistance to cisplatin Ronne H, Carlberg M, Hu G-Z & Nehlin JO (1991) Protein phosphatase 2A in Saccharomyces cerevisiae: effects on cell growth and bud morphogenesis Mol Cell Biol 11, 4876–4884 Sneddon AA, Cohen PTW & Stark MJR (1990) Saccharomyces cerevisiae protein phosphatase 2A performs an essential cellular function and is encoded by two genes EMBO J 9, 4339–4346 Bertram PG, Choi JH, Carvalho J, Ai W, Zeng C, Chan T-F & Zheng XFS (1993) Tripartite regulation of Gln3p by TOR, Ure2p and phosphatases J Biol Chem 275, 35727–35733 da Cruz e Silva OB, da Cruz e Silva EF & Cohen PTW (1988) Identification of a novel protein phosphatase catalytic subunit by cDNA cloning FEBS Lett 242, 106–110 Helps NR, Brewis ND, Lineruth K, Davis T, Kaiser K & Cohen PTW (1998) Protein phosphatase is an essential enzyme required for organisation of microtubules at centrosomes in Drosophila embryos J Cell Sci 111, 1331–1340 Sumiyoshi E, Sugimoto A & Yamamoto M (2002) Protein phosphatase is required for centrosome maturation in mitosis and sperm meiosis in C elegans J Cell Sci 115, 1403–1410 Carnegie GK, Sleeman JE, Morrice N, Hastie CJ, Peggie MW, Philp A, Lamond AI & Cohen PTW (2003) Protein phosphatase interacts with the survival of motor neurons complex and enhances the temporal localisation of snRNPs J Cell Sci 116, 1905–1913 10 Zhou GS, Mihindukulasuriya KA, MacCorkle-Chosnek RA, Van Hooser A, Hu MCT, Brinkley BR & Tan TH (2002) Protein phosphatase is involved in tumor necrosis factor-alpha-induced activation of c-Jun N-terminal kinase J Biol Chem 277, 6391–6398 11 Zhou G, Boomer JS & Tan T-H (2004) Protein phosphatase is a positive regulator of hematopoietic progenitor kinase J Biol Chem 279, 49551–49561 12 Mihindukulasuriya KA, Zhou G, Qin J & Tan T-H (2004) Protein phosphatase interacts with and down-regulates insulin receptor substrate following tumour necrosis factor-a stimulation J Biol Chem 279, 46588–46594 13 Hu MC-T, Tang-Oxley Q, Qiu WR, Wang Y-P, Mihindukulasuriya KA, Afshari R & Tan T-H (1998) Protein phosphatase X interacts with c-Rel and stimulates c-Rel ⁄ Nuclear Factor jB activity J Biol Chem 273, 33561–33565 14 Yeh PY, Yeh K-H, Chuang S-E, Song YC & Cheng A-L (2004) Suppression of MEK ⁄ ERK signalling pathway enhances cisplatin-induced NF-jB activation by protein phosphatase 4-mediated NF-jB p65 Thr dephosphorylation J Biol Chem 279, 26143–26148 15 Kloeker S & Wadzinski BE (1999) Purification and identification of a novel subunit of protein serine ⁄ threonine phosphatase J Biol Chem 274, 5339–5347 FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS 3333 Resistance to cisplatin C J Hastie et al 16 Hastie CJ, Carnegie GK, Morrice N & Cohen PTW (2000) A novel 50 kDa protein forms complexes with protein phosphatase and is located at centrosomal microtubule organizing centres Biochem J 347, 845–855 17 Chen J, Peterson RT & Schreiber SL (1998) a4 associates with protein phosphatases 2A, and Biochem Biophys Res Commun 247, 827–832 18 Giaever G, Shoemaker DD, Jones TW, Liang H, Winzeler EA, Astromoff A & Davis RW (1999) Genomic profiling of drug sensitivities via induced haploinsufficiency Nat Genet 21, 278–283 19 Gavin A-C, Bosche M, Krause R, Grandi P, Marzioch ă M, Bauer A, Schultz J, Rick JM, Michon A-M, Cruciat C-M et al (2002) Functional organisation of the yeast proteome by systematic analysis of protein complexes Nature 415, 141–147 20 Ho Y, Gruhler A, Heilbut A, Bader GD, Moore L, Adams S-L, Millar A, Taylor P, Bennet K, Boutilier K et al (2002) Systematic identification of protein complexes in Saccharomyces cerevisiae by mass spectrometry Nature 415, 180–183 21 Brewis ND, Street AJ, Prescott AR & Cohen PTW (1993) PPX, a novel protein serine ⁄ threonine phosphatase localized to centrosomes EMBO J 12, 987–996 and 2231 (correction) 22 O’Neill BM, Hanway D, Winzeler EA & Romesberg FE (2004) Coordinated functions of WSS1, PSY2 and TOF1 in the DNA damage response Nucleic Acids Res 32, 6519–6530 23 Hazbun TR, Malmstrom L, Anderson S, Graczyk BJ, ă Fox B, Rife M, Sundin BA, Aranda JD, McDonald WH, Chiu C-H et al (2003) Assigning function to yeast 3334 24 25 26 27 28 29 30 proteins by integration of technologies Mol Cell 12, 1353–1365 Longtine MS, McKenzie A III, Demarini DJ, Shah NG, Wach A, Brachat A, Philippsen P & Pringle JR (1998) Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae Yeast 14, 953–961 Gietz D, St Jean A, Woods RA & Schiestl RH (1992) Improved method for high efficiency transformation of intact yeast cells Nucleic Acids Res 20, 1245 Schneider BL, Suefert W, Steiner B, Yang QH & Futcher AB (1995) Use of polymerase chain reaction epitope tagging for protein tagging Saccharomyces cerevisiae Yeast 11, 1265–1274 Kaiser C, Michaelis S & Mitchell A (1994) Methods in Yeast Genetics A Cold Spring Harbour Laboratory Course Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Foiani M, Marini F, Gamba D, Lucchini G & Plevani P (1994) The B subunit of the DNA polymerase a-primase complex in Saccharomyces cerevisiae executes an essential function at the initial stage of DNA replication Mol Cell Biol 14, 923–933 Fernandez-Sarabia MJ, Sutton A, Zhong T & Arndt KT (1992) SIT4 protein phosphatase is required for the normal accumulation of SWI4, CLN1, CLN2 and HSC26 RNAs during late G1 Genes Dev 6, 2417–2428 Black S, Andrews PD, Sneddon AA & Stark MJR (1995) A regulated MET3–GLC7 gene fusion provides evidence of a mitotic role for Saccharomyces cerevisiae protein phosphatase Yeast 11, 747–759 FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS ... binding to Ppp4c Subunit type S cerevisiae Drosophila Human Catalytic subunit Core regulatory subunit of Pph3 ⁄ Ppp4c Regulatory subunit of Pph3 ⁄ Ppp4c Core regulatory subunit of Ppp4c Catalytic subunit. .. BY4 743 pph3D::kanMX4 ⁄ pph3D::kanMX4 BY4 743 psy4D::kanMX4 ⁄ psy4D::kanMX4 BY4 743 psy2D::kanMX4 ⁄ psy2D::kanMX4 BY4 743 TUB2 ⁄ tub2D::HIS3MX BY4 743 TUB2 ⁄ tub2D::HIS3MX, psy4D::kanMX4 ⁄ psy4D::kanMX4 Fernandez-Sarabia... YBL 046 w ⁄ Psy4p would appear to be an obligatory core subunit of Pph3p required for the binding of Psy2p, we examined the sensitivity of the YBL 046 w ⁄ Psy4p deletion strain to cisplatin The comparable