7,8-Diaminoperlargonic acid aminotransferase from Mycobacterium tuberculosis, a potential therapeutic target Characterization and inhibition studies Ste ´ phane Mann and Olivier Ploux Synthe ` se Structure et Fonction de Mole ´ cules Bioactives, Universite ´ Pierre et Marie Curie-Paris 6, UMR 7613, Paris, France Tuberculosis remains one of the major infectious dis- eases in the world, with a newly infected human every second, one-third of the total population already infec- ted, and 2 million deaths per year, according to the WHO [1]. Furthermore, strains of Mycobacterium tuberculosis, the pathogen, that are resistant to one or several antibiotics used in therapy have been identified and might thus compromise efforts to eradicate the disease. New therapeutic targets and drugs, as well as new vaccines and public health efforts are thus urgently needed to decrease the incidence of tuberculo- sis worldwide. Keywords 7,8-diaminopelargonic acid aminotransferase; amiclenomycin; biotin biosynthesis; Mycobacterium tuberculosis; S-adenosyl- L-methionine Correspondence O. Ploux, Synthe ` se Structure et Fonction de Mole ´ cules Bioactives, UMR7613 CNRS- UPMC, Universite ´ Pierre et Marie Curie, boı ˆ te 182, 4, place Jussieu, F-75252 Paris cedex 05, France Fax: +33 1 44 27 71 50 Tel: +33 1 44 27 55 11 E-mail: olivier.ploux@upmc.fr URL: http://www.upmc.fr/umr7613/ (Received 1 June 2006, revised 13 July 2006, accepted 23 August 2006) doi:10.1111/j.1742-4658.2006.05479.x Diaminopelargonic acid aminotransferase (DAPA AT), which is involved in biotin biosynthesis, catalyzes the transamination of 8-amino-7-oxonona- noic acid (KAPA) using S-adenosyl-l-methionine (AdoMet) as amino donor. Mycobacterium tuberculosis DAPA AT, a potential therapeutic tar- get, has been overproduced in Escherichia coli and purified to homogeneity using a single efficient step on a nickel-affinity column. The enzyme shows an electronic absorption spectrum typical of pyridoxal 5¢-phosphate- dependent enzymes and behaves as a homotetramer in solution. The pH profile of the activity at saturation shows a single ionization group with a pK a of 8.0, which was attributed to the active-site lysine residue. The enzyme shows a Ping Pong Bi Bi kinetic mechanism with strong substrate inhibition with the following parameters: K mAdoMet ¼ 0.78 ± 0.20 mm, K mKAPA ¼ 3.8 ± 1.0 lm, k cat ¼ 1.0 ± 0.2 min )1 , K iKAPA ¼ 14 ± 2 lm. Amiclenomycin and a new analogue, 4-(4c-aminocyclohexa-2,5-dien-1r- yl)propanol (referred to as compound 1), were shown to be suicide sub- strates of this enzyme, with the following inactivation parameters: K i ¼ 12±2lm, k inact ¼ 0.35 ± 0.05 min )1 , and K i ¼ 20±2lm, k inact ¼ 0.56 ± 0.05 min )1 , for amiclenomycin and compound 1, respectively. The inactivation was irreversible, and the partition ratios were 1.0 and 1.1 for amiclenomycin and compound 1, respectively, which make these inactiva- tors particularly efficient. compound 1 (100 lgÆmL )1 ) completely inhibited the growth of an E. coli C268bioA mutant strain transformed with a plasmid expressing the M. tuberculosis bioA gene, coding for DAPA AT. Reversal of the antibiotic effect was observed on the addition of biotin or DAPA. Thus, compound 1 specifically targets DAPA AT in vivo. Abbreviations AdoMet, S-adenosyl-L-methionine; DAPA, 7,8-diaminopelargonic acid (7,8-diaminononanoic acid); DAPA AT, 7,8-diaminopelargonic acid aminotranferase; KAPA, 8-amino-7-oxononanoic acid; PLP, pyridoxal 5¢-phosphate. 4778 FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS The biosynthesis of biotin (vitamin H), a cofactor for carboxylases, decarboxylases and transcarboxylas- es, has been identified as an interesting target for anti- biotics and herbicides. Indeed, this metabolic pathway is specific to micro-organisms and higher plants [2]. Two antibiotics isolated from Streptomyces species, actithiazic acid [3] and amiclenomycin [4–8], have been found to be active against mycobacteria, and target enzymes of the biotin biosynthesis pathway. Further- more, bioA, the gene coding for 7,8-diaminopelargonic acid aminotransferase (DAPA AT; EC 2.6.1.62), which is involved in biotin biosynthesis, has been implicated in long-term survival of mycobacteria [9]. It thus seems that biotin biosynthesis, and in particular the transami- nation step catalyzed by DAPA AT, are valid targets for antibiotic directed against mycobacteria. Obvi- ously, mycobacteria could reverse the effect of such antibiotics by taking up external biotin. However, such a transporter remains elusive in the annotated genes of M. tuberculosis [10,11], and reversal of the amicleno- mycin antibacterial effect is observed at biotin concen- trations above 0.01 lgÆmL )1 [4], a concentration at least 10 times higher than that found in human plasma [12]. Interestingly, the recently described bioA mutant of Mycobacterium smegmatis survived poorly in rich medium, suggesting that the observed phenotype was not reversed by the presence of external biotin [9]. DAPA AT is a pyridoxal 5¢-phosphate (PLP) enzyme that catalyzes the transamination of 8-amino- 7-oxononanoic acid (KAPA) to yield 7,8-diaminonona- noic acid (DAPA) [13,14] (Fig. 1). In Escherichia coli, the amino donor in this reaction is S-adenosyl-l- methionine (AdoMet) [15]. The enzyme from E. coli has been well characterized [13–17], and its 3D struc- ture determined [18,19]. We have reported the total synthesis of natural amiclenomycin [20] and some of its analogues [21] and have deciphered the mode of action of this antibiotic at the molecular level [22–25]. It irreversibly inactivates E. coli DAPA AT by forming an aromatic adduct with the bound PLP. Interestingly, modification of the structure of amiclenomycin gave some active compounds, encouraging the design of new inhibitors that might be useful in antibiotic devel- opment [25]. In an effort to contribute to the discovery of new therapeutic targets in M. tuberculosis, it is our inten- tion to fully characterize M. tuberculosis DAPA AT and screen likely molecules for their inhibiting proper- ties. We report here the cloning and heterologous expression of the M. tuberculosis bioA gene. M. tuber- culosis DAPA AT was purified to homogeneity and characterized. We also provide evidence that amicleno- mycin and a new analogue irreversibly inactivate M. tuberculosis DAPA AT. Results and Discussion Cloning, expression and purification of M. tuberculosis DAPA AT We used PCR-based technology to construct two M. tuberculosis bioA genes which were cloned into a pUC18 vector, downstream of the lac promoter. The first construct, pUC18-MTbioA, contained a ribosome- binding site consensus sequence 7 bp ahead of the first ATG codon, while the second, pUC18-MTHis 6 bioA, contained the same ribosome-binding site and a sequence coding for His 6 inserted between the first and second codon of the bioA gene. The first construct would therefore produce a M. tuberculosis DAPA AT with the wild-type sequence (referred to as wild-type DAPA AT in this work), and the latter would give an N-terminal His 6 -tagged DAPA AT, for convenient purification. The sequence of the recombinant genes was verified by DNA sequencing. The functionality of the recombinant enzymes was demonstrated in vivo by transforming E. coli C268 bioA – cells with both con- structs. Transformed cells were able to grow on a COOH NH 2 O KAPA NH 2 H 2 N COOH NH 2 OH DAPA COOH NH 2 NH 2 DAPA aminotransferase AdoMet S-Adenosyl- (2-oxo-4-thiobutyrate) Biotin Amiclenomycin Compound 1 Fig. 1. The reaction catalyzed by DAPA AT and the chemical structure of amicleno- mycin and compound 1. S. Mann and O. Ploux M. tuberculosis DAPA aminotransferase FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS 4779 biotin-free Luria–Bertani agar plate (containing 0.45 UÆmL )1 avidin), thus reversing the bio – phenotype by complementation, which proved that the heterolo- gous expression was efficient and that both recombin- ant M. tuberculosis DAPA ATs were functional. The production of soluble His 6 -tagged M. tuberculo- sis DAPA AT was low in E. coli JM105 ⁄ pUC18- MTHis 6 bioA: the crude extract had a specific activity of 0.04 mUÆmg )1 . Induction by isopropyl b-d-thiogal- actopyranoside (0.1–0.5 mm) in this lacI q strain moder- ately increased the production of soluble enzyme by a factor of 2. As we noted the presence in the M. tuber- culosis bioA sequence of codons rarely used in E. coli (eight CCC Pro, one AGG Arg and three CGA Arg codons), we attempted to produce the enzyme in E. coli Rosetta(DE3) ⁄ pLysS or E. coli BL21 Codon- Plus(DE3)RP. In these hosts, the expression was con- stitutive, as the lac repressor is not overproduced, and the specific activity of the soluble extract was 0.10 mUÆmg )1 in E. coli Rosetta(DE3) ⁄ pLysS ⁄ pUC18- MTHis 6 bioA and 0.12 mUÆmg )1 in E. coli BL21 CodonPlus(DE3)RP ⁄ pUC18-MTHis 6 bioA. This slightly increased production compared with that in E. coli JM105 ⁄ pUC18-MTHis 6 bioA was attributed to the overproduction of the rare tRNAs. However, when produced in E. coli BL21 CodonPlus(DE3)RP ⁄ pUC18- MTHis 6 bioA, DAPA AT was predominantly in an insoluble form. Unfortunately, attempts to solubilize the precipitated proteins in 8 m urea and renature the DAPA AT were unsuccessful. The His 6 -tagged DAPA AT was thus purified from the soluble crude extract of E. coli BL21 CodonPlus(DE3)RP ⁄ pUC18-MTHis 6 bioA using a single purification step, nickel affinity chroma- tography. Homogeneous enzyme was thus obtained, as judged by SDS⁄ PAGE analysis (Fig. 2). Three milligrams of pure protein with a specific activity of 8.8 ± 0.3 mUÆmg )1 , was obtained from 1 L of culture, making this purification scheme quite efficient, with a 73-fold purification. Concentration of the protein solu- tion was achieved by ammonium sulfate precipitation followed by solubilization and dialysis rather than by ultrafiltration which caused precipitation. The pure enzyme was kept at )80 °C without significant loss of activity. Wild-type M. tuberculosis DAPA AT was similarly produced in E. coli BL21 CodonPlus(DE3)RP ⁄ pUC18- MTbioA. However, purification of the enzyme from the soluble fraction required a two-step purification protocol using Q-Sepharose and Mono Q columns. The specific activity of the pure enzyme was 9.4 ± 0.3 mUÆmg )1 , a value very similar to that for the His 6 - tagged enzyme, which shows that the six N-terminal histidine residues of His 6 -tagged DAPA AT do not perturb the catalytic activity. Biochemical characterization As shown in Fig. 2, wild-type and His 6 -tagged M. tuberculosis DAPA AT showed a single band when separated by SDS ⁄ PAGE, with an approximate molecular mass of 45 kDa, in agreement with the bioA DNA sequence. The two enzymes were separately chromatographed on a calibrated Superdex HR S200 column, in native conditions, at pH 8.0. Both recom- binant proteins were eluted as a single species with an estimated molecular mass of 189 kDa. Therefore, M. tuberculosis DAPA AT behaved as a homotetramer in solution. The electronic absorption spectrum of pure His 6 - tagged M. tuberculosis DAPA AT, at pH 8.0, exhibited characteristic bands at 332 nm and 414 nm, typical of the internal aldimine of PLP-dependent enzymes [26], which we attributed to the internal aldimine between the bound PLP and the enzyme (Fig. 3). The absorb- ance ratio, A 414 ⁄ A 280 , was 0.219 for the pure enzyme. The specific activity of His 6 -tagged M. tuberculosis DAPA AT was measured at different pH values, from 6.8 to 9.1, in the presence of 20 lm KAPA and 1 mm AdoMet. Figure 4 shows the data on a log-log plot together with the pH profile for E. coli DAPA AT, measured in the same conditions, for comparison. The data were fitted to Eqn (1) assuming one ionisable group on the enzyme (pK a1 ): a ¼ a max =ð1 þ 10 p K a1 ÀpH Þð1Þ As Fig. 4 shows, the maximum specific activity for the M. tuberculosis enzyme is 10 times lower than that measured for the E. coli enzyme. The pK a values Fig. 2. Analysis by SDS ⁄ PAGE of the purification of His 6 -tagged M. tuberculosis DAPA AT on a Ni-affinity column. Lane 1, crude extract; lane 2, unretained fraction; lane 3, molecular mass stand- ards (from top to bottom: 66 kDa, 45 kDa, 36 kDa, 29 kDa, 24 kDa); lanes 4–9, fractions eluted with 400 m M imidazole; lane 10, purified wild-type M. tuberculosis DAPA AT; lane 11, purified His 6 -tagged M. tuberculosis DAPA AT; lane 12, molecular mass standards (66 kDa, 45 kDa, 36 kDa, 29 kDa, 24 kDa, 20 kDa). M. tuberculosis DAPA aminotransferase S. Mann and O. Ploux 4780 FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS obtained were 7.6 and 8.0 for E. coli and M. tuberculo- sis DAPA AT, respectively. It should be noted that the data points between pH 6.5 and pH 7.1 for M. tuber- culosis DAPA AT do not fit well to the simple ioniza- tion model described by Eqn (1). Further pH studies are necessary to clarify this. Indeed, interpretation of simple pH effects on activity are not straightforward [27], but because the substrates were almost at satur- ating concentrations, one can reasonably attribute the ionization observed to the active-site base that cata- lyses the proton transfer. In E. coli DAPA AT, the active-site base has been proposed to be Lys274 on the basis of structural data. This lysine residue is con- served in all DAPA AT sequences known so far [19]. There is no doubt that the corresponding lysine in the M. tuberculosis enzyme, Lys283, plays the same role. Several potential amino donors were tested at high concentration (5 mm) on our enzyme: l-Asp, l-Glu, l-Met, l-Lys, and d,l-homocysteine. None of them was a substrate for the transamination reaction, i.e., no activity was detected when AdoMet was replaced by these amines. Consequently, AdoMet was consid- ered to be the natural amino donor and used for further kinetic studies. Of all the DAPA ATs characterized [13,14,28], the enzyme from Bacillus subtilis is the only one that does not use AdoMet as the amino donor. It uses lysine as the amino donor instead [29]. Thus, there might be two different classes of DAPA AT that differ with regard to the second substrate. Determination of the kinetic parameters of the His 6 -tagged DAPA AT The double-reciprocal plot of initial velocities against KAPA concentration for several concentrations of the second substrate, AdoMet, is typical of a Ping Pong Bi Bi mechanism, with strong substrate inhibition by KAPA (Fig. S1) [30]. The plot is very similar to those already published by Stoner & Eisenberg [14] and us [24], for the E. coli enzyme, i.e., at low KAPA concen- tration the lines appear parallel, whereas at higher KAPA concentration they bend up as they approach the ordinate axis. Such plots are problematic for determin- ing the four kinetic parameters, i.e., K iKAPA , K mKAPA , K mAdoMet , and V m . We thus used a different strategy to obtain an estimation of the kinetic parameters (a full description is available in the Supplementary material). When KAPA concentrations above 10 lm were used, this substrate appeared as a simple compet- itive inhibitor of the reaction, as shown in the Hanes– Woolf plot of the data (Fig. 5A). The parallel lines are characteristic of competitive inhibition by KAPA, i.e., KAPA forms a dead end complex with the enzyme– PLP form, in competition with AdoMet. Replotting the apparent K m ⁄ V m as a function of KAPA con- centration gave: K iKAPA ¼ 14 ± 2 lm, K mAdoMet ¼ 0.1 1.0 10.0 100.0 6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0 Specific activity (mU.mg -1 ) pH Fig. 4. Activity versus pH profile for the His 6 -tagged M. tuberculo- sis DAPA AT and for E. coli DAPA AT. The specific activities of both enzymes were determined in the presence of saturating con- centrations of substrates at various pH values. See Experimental procedures for details. The specific activity was plotted against the pH on a log-log plot. The data points were fitted to Eqn (1). h E. coli DAPA AT; d His 6 -tagged M. tuberculosis DAPA AT. 0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 300 350 400 450 500 550 Absorbance Wavelength (nm) Fig. 3. UV-visible spectrum of His 6 -tagged M. tuberculosis DAPA AT. The absorption spectrum of purified His 6 -tagged M. tuber- culosis DAPA AT (0.44 mgÆmL )1 )in50mM Tris ⁄ HCl buffer (pH 8.0) ⁄ 10 m M 2-mercaptoethanol was recorded against a blank containing the same buffer. S. Mann and O. Ploux M. tuberculosis DAPA aminotransferase FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS 4781 0.58 ± 0.1 mm and V m ¼ 22 ± 6 mUÆmg )1 (Fig. 5B). Thus the catalytic constant is k cat ¼ 1.0 ± 0.2 min )1 . To estimate K mKAPA , we used the constant ratio method [14,30]. Initial velocities were measured using a constant molar ratio of the two substrates, AdoMet and KAPA. The double-reciprocal plot in these condi- tions gave straight lines, a characteristic of the Ping Pong mechanism, but in our case they did not intersect at the same point on the ordinate axis, because inhibi- tion by KAPA was not negligible (Fig. S2). The secon- dary plots (Fig. S3 and Fig. S4) allowed the estimation of K mAdoMet ¼ 0.96 ± 0.1 mm and V m ¼ 21 ± 7 mUÆmg )1 and K mKAPA ¼ 3.8 ± 1.0 lm. Because two different values for K mAdoMet were obtained by our analyses, the mean of these values (0.78 ± 0.20 mm) was considered to be the best estimate. Comparison of the kinetic parameters of the E. coli and M. tuberculosis enzymes shows that the K m values for the latter are 3–4 times higher, and that the k cat for the M. tuberculosis enzyme is eight times lower than that of the E. coli enzyme. Furthermore, the inhibition constant, K iKAPA , for the M. tuberculosis enzyme is half that measured for the E. coli enzyme. Overall, M. tuberculosis DAPA AT is much less efficient than the E. coli enzyme. This result is quite surprising as the two enzymes share strong sequence identity (50%) and all the active-site residues are conserved. Deter- mination of the 3D structure of M. tuberculosis DAPA AT will certainly shed light on this issue. Inactivation and titration of His 6 -tagged DAPA AT by amiclenomycin and 4-(4c-aminocyclohexa- 2,5-dien-1r-yl)propanol (compound 1) When the His 6 -tagged M. tuberculosis DAPA AT was preincubated, at pH 8.0, in the presence of amicleno- mycin or compound 1 at various concentrations, inactivation occurred. The remaining activity was measured under standard conditions. In these condi- tions, the inhibitor was diluted in the assay mixture (30-fold dilution), thus stopping the inactivation pro- cess. Figure 6A shows the remaining activity against time on a semi-log plot for the inactivation by ami- clenomycin. Because M. tuberculosis DAPA AT is a rather slow enzyme, its concentration was sometimes comparable to the inactivator concentration in these experiments. Nevertheless, the data fitted well to a pseudo-first-order kinetic process, and the observed inactivation rates, k obs , varied hyperbolically with the inactivator concentration. Thus, the simple two-step model for irreversible inactivation may apply, and the following kinetic parameters, K i and k inact , were derived from a Kitz–Wilson plot (Fig. 6B), for amiclenomycin and compound 1, respectively: K i ¼ 12±2lm, k inact ¼ 0.35 ± 0.05 min )1 , and K i ¼ 20±2lm, k inact ¼ 0.56 ± 0.05 min )1 . The inactiva- tion was irreversible, as a sample of His 6 -tagged M. tuberculosis DAPA AT inactivated at 90% by ami- clenomycin did not recover its activity after prolonged dialysis in the presence of 0.1 mm PLP. The partition ratio for the inactivation by amiclenomycin was meas- ured by incubating the His 6 -tagged M. tuberculosis DAPA AT (5.7 lm) for 45 min with a substoichiometric 0.0 10.0 20.0 30.0 40.0 50.0 60.0 70.0 01234567 [AdoMet]/v (10 3 min) [AdoMet] (mM) A 0.0 10.0 20.0 30.0 40.0 0 50 100 150 K m app /V m (10 3 min) [Racemic-KAPA] (µM) B Fig. 5. Hanes–Woolf plot of the inhibition of His 6 -tagged M. tuber- culosis DAPA AT by KAPA. (A) The activity was measured at var- ious AdoMet and KAPA concentrations. n 20 l M KAPA; h 50 lM KAPA; d 70 lM KAPA; s 100 lM KAPA; r 140 lM KAPA. (B) Re- plot of the ordinate intercepts against KAPA concentrations. Data were fitted to straight lines using linear regression analysis. M. tuberculosis DAPA aminotransferase S. Mann and O. Ploux 4782 FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS amount of amiclenomycin and by measuring the resid- ual enzymatic activity. Plotting the fraction of residual activity against the molar ratio of amiclenomycin over that of the enzyme active sites (Fig. 7) gave a straight line that intersected the abscissa at 1.1 molar ratio. The same experiment was run for the inactivation by compound 1, and the partition ratio was found to be 1.0. Thus, these suicide substrates inactivate M. tuber- culosis DAPA AT almost every turnover, which make these inactivators particularly efficient. Figure 8 shows the mechanism by which amiclenomycin and analogues inactivate E. coli DAPA AT [25]. There is no doubt that the inactivation of M. tuberculosis DAPA AT observed here follows the same reaction pathway. This mechanism is reminiscent of that proposed by Rando [31] for the inactivation of c-aminobutyric acid transa- minase by gabaculine and more recently by others for the inactivation of c-aminobutyric acid transaminase [32], d-amino acid aminotransferase [33], and alanine racemase [34] by cycloserine. It is quite interesting to note that all these PLP-dependent enzymes are inhib- ited by a similar mechanism, ultimately yielding an aromatic ring that does not dissociate from the active site. We investigated if the M. tuberculosis DAPA AT was inhibited by gabaculine and the antituberculous drug cycloserine, which seems to be poorly specific. In fact, none of these compounds inhibited DAPA AT even at high concentration (1.3 mm), showing that the DAPA AT is quite specific. As shown above, the nature of the main chain amino acid in amiclenomycin versus alcohol in com- pound 1 has only a very moderate effect on the inacti- vation parameters. This finding is quite encouraging for the design of new inhibitors because the synthesis of amiclenomycin takes longer than that of com- 10 100 01234567 Residual activity (%) Time (min) A 0 2 4 6 8 10 -0.10 -0.05 0.00 0.05 0.10 0.15 0.20 1/k obs (min) 1/[Amiclenomycin] (µ M -1 ) B Fig. 6. Kinetics of inactivation of His 6 -tagged M. tuberculosis DAPA-AT by amiclenomycin. (A) The enzyme was preincubated in the presence of various concentrations of amiclenomycin: d no inhibitor; s 5.7 l M; n 11.4 lM; n 17.1 lM; r 25.7 lM. At different time points, the residual activity was measured and plotted on a semi-log plot against time. The data were fitted to simple exponen- tial decay. The slopes of the lines gave an estimate of the observed inactivation constants, k obs . (B) Double-reciprocal plot of the observed rate of inactivation, k obs , against the inhibitor concentra- tion. The data were fitted to straight lines using a linear regression analysis. 0 20 40 60 80 100 0.0 0.2 0.4 0.6 0.8 1.0 1.2 Residual activity (%) Molar ratio Fig. 7. Titration of His 6 -tagged M. tuberculosis DAPA AT by ami- clenomycin. The enzyme and amiclenomycin, at various molar ratios, were incubated at pH 8.0 for 45 min at 37 °C. The residual activity was then determined and plotted against the molar ratio. The data were fitted to a straight line using linear regression analysis. S. Mann and O. Ploux M. tuberculosis DAPA aminotransferase FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS 4783 pound 1 and other analogues [20,21]. Furthermore, varying this part of the molecule might afford new interesting properties such as bioavailability. In vivo antibiotic effect of compound 1 When E. coli C268 ⁄ pUC18-MTHis 6 bioA was grown on solid rich medium devoid of biotin (avidin-supplemen- ted Luria–Bertani agar medium), growth was inhibited by increasing the concentration of compound 1. The minimal concentration that completely inhibited growth was found to be 100 lgÆmL )1 . When avidin was not added, the biotin present in the Luria–Bertani medium (% 0.2 lm) was sufficient to reverse the growth inhibi- tion. Furthermore, adding 100 lm DAPA to the med- ium in the presence of avidin also reversed the growth inhibition. Taken together, these data indicate that, firstly, compound 1 is able to cross the cell wall, and that, secondly, M. tuberculosis DAPA AT is the only in vivo target of this inhibitor. The in vivo effect of com- pound 1 was similarly tested on M. smegmatis CIP 56.5, a wild-type strain. The minimal concentration that completely inhibited growth, measured in Luria–Bertani medium without biotin, was 10 lgÆmL )1 . Biotin present in the medium was sufficient to reverse the effect. These experiments could not be repeated with amiclenomycin, because we did not have sufficient amounts of this molecule. However, Okami et al. [4–6] reported a mini- mum inhibitory concentration for amyclenomycin of 3–6 lgÆmL )1 , on mycobacteria. This value is lower than that measured for compound 1 for the E. coli strain but similar to that obtained for M. smegmatis. In our case, the target, DAPA AT, is overproduced in the E. coli strain, thus increasing the minimum inhibitory concen- tration. The in vivo effect of compound 1 on M. tuber- culosis cells needs to be studied. In conclusion, we have purified and characterized DAPA AT from M. tuberculosis. The purification scheme is simple enough to provide sufficient pure enzyme for structural studies. This work is underway in our laboratory. We have also provided evidence that amiclenomycin and compound 1 are suicide substrates of M. tuberculosis DAPA AT. The fact that com- pound 1 is active in vivo and that it specifically targets DAPA AT makes this molecule an interesting lead to new antibiotics. Experimental procedures Materials and equipment The M. tuberculosis H37Rv bioA (Rv1568) gene, cloned into a plasmid, was a gift from P. Alzari (Institut Pasteur, Paris, France). M. smegmatis CIP 56.5 was obtained from the Institut Pasteur Collection. E. coli strains JM105 and BL21 Rosetta(DE3) ⁄ pLysS were from Promega (Madison, WI, USA) and E. coli BL21 CodonPlus(DE3)RP was from Stratagene (La Jolla, CA, USA). E. coli C268 (DbioA his Sm R ) was a gift from A. Campbell [35], and E. coli MEC1 (thr-1 leuB6(Am) glnV44(AS) bioA109 LAM- rfbC1 thi-1; CGSC#7257) [36] was generously given by the E. coli Gen- etic Stock Center (Yale, NH, USA). Plasmid pUC18 was from Promega. Synthetic oligonucleotides were products of Proligo (Paris, France) and were used without any further purification. Chemicals were purchased from Sigma-Aldrich (St Louis, MO, USA) and were of the highest purity avail- able. Racemic-KAPA was obtained as already described [37]. (7S,8R)-DAPA was a gift from J. Crouzet (Sanofi- Aventis, Vitry sur Seine, France). Amiclenomycin was pre- pared as already described [20]. Dethiobiotin synthase (EC 6.3.3.3) was expressed and purified as previously described [24]. Restriction endonucleases, Taq polymerase, T4 DNA ligase and molecular biology kits were from either Promega or Roche (Meylan, France). Culture medium components were purchased from Difco Laboratories (Detroit, MI, USA). Chromatographic equipment (GradiFrac, FPLC) and column phases were from Amersham Biosciences Enz-Lys NH 2 N O O HO 3 P N H R H H H Enz-Lys NH 3 N O O HO 3 P N H R H H Enz-Lys NH 2 N O O HO 3 P N H R H H H H Enz-Lys NH 2 N O O HO 3 P N H R H H H Base BaseH External aldimine Quinonoid Aromatic adductPMP adduct Fig. 8. Proposed inactivation mechanism of DAPA AT by amiclenomycin and analogues. The conserved active-site Lys residue is probably responsible for the transamination reaction, and the aromatization step is promoted by an as yet unknown base. R represents the various main chains of the analogues. M. tuberculosis DAPA aminotransferase S. Mann and O. Ploux 4784 FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS (Orsay, France). UV-visible spectra were obtained on a Uvikon-930 Kontron (Munchen, Germany) spectrophoto- meter or a Lambda-40 Perkin–Elmer (Norwalk, CT, USA) apparatus. Sonication was performed on a VibraCell soni- cator from Bioblock (Illkirch, France). SDS ⁄ PAGE was carried out on a Bio-Rad (Hercules, CA, USA) Protean II system, using the conditions described by the manufacturer. DNA electrophoresis was performed on a Mupid (Eurogen- tec, Seraing, Belgium) apparatus, in 40 mm Tris ⁄ acetate buffer (pH 7.5) ⁄ 1mm EDTA. Centrifugations were per- formed in a Sorval RF5plus centrifuge (Kendro, Court- aboeuf, France) or an Eppendorf Centrifuge 5415D (Eppendorf, Le Pecq, France). 1 H-NMR (400 MHz) and 13 C-NMR (100 MHz) spectra were recorded on a ARX400 Brucker spectrometer (Rheinstetten, Germany). CI mass spectra were obtained with a Nermag R 30–10 apparatus (Quad Service, Poissy, France). Synthesis of compound 1 The aminocyclohexadiene 1, 4-(4c-aminocyclohexa-2,5-dien- 1r-yl)propanol, was prepared from its N-allyloxycarbonyl precursor 2, i.e., allyl[4c-(3-oxopropyl)-cyclohexa-2,5-dien- 1r-yl]-carbamate, the synthesis of which has already been published [20]. Phenylsilane (150 lL, 1.2 mmol) and a solu- tion of Pd(PPh 3 ) 4 (15 mg, 0.013 mmol) in dry dichloro- methane (1.5 mL) were added under argon to a solution of precursor 2 (167 mg, 0.7 mmol) in dry dichloromethane (1.5 mL). The mixture was stirred for 50 min at room tem- perature, concentrated under vacuum and chromatographed on a silica gel (flash silica, Merck 230, 0.04–0.063 mm) col- umn using dichloromethane ⁄ methanol (9 : 1, v ⁄ v) as eluent. Eluted fractions were combined and acidified to pH 4 using 1 m HCl. After concentration under vacuum the hydrochlo- ride salt of compound 1 was obtained as an yellow oil (80 mg, 60%). 1 H NMR (D 2 O) d: 1.40–1.48 (m, 4H, CH 2 CH 2 CH 2 O), 2.72 (m, 1H, CHCH 2 ), 3.47 (t, 2H, CH 2 O, 3 J ¼ 5.9 Hz), 4.27 (d, 1H, CHNH 2 , 5 J ¼ 7.9 Hz); 13 C NMR (D 2 O) d: 28.22 (CHCH 2 ), 29.96 (CH 2 CH 2 CH 2 ), 34.74 (CHCH 2 ), 45.03 (CHNH 2 ), 61.78 (CH 2 OH), 119.90 (NH 2 CHCH ¼ CH), 136.11 (NH 2 CHCH ¼ CH); MS (CI) MH + m ⁄ z 154. Cloning of M. tuberculosis bioA gene The wild-type and His 6 -tagged bioA recombinant genes were obtained using PCR amplification of the bioA gene cloned into plasmid pDEST17 (P. Alzari, Institut Pasteur). Amplifications were achieved using the Taq DNA polym- erase (Promega) under the conditions recommended by the manufacturer but in the presence of 6% (v ⁄ v) dimethyl sulfoxide. The following sets of primers were used to obtain the wild-type recombinant gene: 5¢-CGCGCGAATTCAG GAGGAATTTAAAATGGCTGCGGCGACTGGCGGG-3¢ containing an EcoRI restriction site and a ribosome-binding site, and 5¢-GCAAGCTTTCATGGCAGTGAGCCTACG AGCCG-3¢ containing a HindIII restriction site. For the His 6 -tagged bioA gene, the primers were the following: 5¢- CGCGCGAATTCAGGAGGAATTTAAAATGCACCAC CACCACCACCACGCTGCGGCGACTGGCG-3¢ contain- ing an EcoRI restriction site, a ribosome-binding site and a His 6 tag coding sequence, and 5¢-GCAAGCTTTCATG GCAGTGAGCCTACGAGCCG-3¢ containing a HindIII restriction site. The DNA fragments were purified (PCR Preps, Promega), digested with EcoRI and HindIII, purified on agarose gel, and ligated into pUC18 previously cut by the same restriction enzymes. After transformation in E. coli JM105, positive clones were selected, and the plas- mids were extracted and purified (Wizzard Plus Minipreps, Promega) for DNA sequencing (ECSG, Evry, France). Plasmids pUC18-MTHis 6 bioA and pUC18-MTbioA were thus obtained and used to transform various E. coli strains. Transformation and phenotype determination E. coli C268 (DbioA his Sm R ) was transformed with either plasmid pUC18-MTbioA or plasmid pUC18-MTHis 6 bioA using the CaCl 2 technique [38]. A control experiment with no plasmid DNA was run at the same time. Biotin auxotro- phy was determined by plating the cells on Luria–Bertani agar medium containing 100 lgÆmL )1 ampicillin and avidine (0.45 UÆmL )1 ). Plates were incubated overnight at 37 °C. Expression and purification of wild-type and His 6 -tagged recombinant M. tuberculosis DAPA AT Wild-type DAPA AT E. coli BL21 CodonPlus(DE3)RP ⁄ pUC18-MTbioA was grown overnight at 37 °C in Luria–Bertani medium (800 mL batches in Erlenmeyer flasks), supplemented with 100 lgÆmL )1 ampicillin and 50 lgÆmL )1 chloramphenicol. The cells were collected by centrifugation (4000 g, 15 min) and kept at )20 °C until use. All the following steps were carried out at 4 °C. Crude extract The cells were thawed on ice and suspended in 50 mm Tris ⁄ HCl buffer, pH 8.0, 10 mm 2-mercaptoethanol, 0.2 mm PLP, and disrupted by sonication for 70 s (seven 10-s pulses with intermittent 1-min cooling periods). The cellular debris were removed by centrifugation (10 000 g, 20 min). Q-Sepharose The supernatant was loaded on a Q-Sepharose column (2 cm internal diameter · 14 cm long) equilibrated with buffer A (50 mm Tris ⁄ HCl buffer, pH 8.0, 10 mm 2-mer- captoethanol). After the column had been washed with 50 mL buffer A, the proteins were eluted using a linear S. Mann and O. Ploux M. tuberculosis DAPA aminotransferase FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS 4785 gradient (0–0.4 m NaCl in buffer A, 400 mL). Active frac- tions were detected using the coupled enzymatic assay (see below) and pooled. FPLC Mono Q The enzyme was finally purified on a Mono Q HR 10 ⁄ 10 FPLC column using a linear salt gradient (0–450 mm NaCl in buffer A, 80 mL). Active fractions were detected using the coupled enzymatic assay (see below) and pooled. The purified enzyme solution was desalted and concentrated by repetitive ultrafiltrations (Centriprep 30; Millipore, Bedford, MA, USA) and stored in buffer A containing 20% (v⁄ v) glycerol, at )80 °C. His 6 -tagged DAPA AT An overnight preculture (50 mL Luria–Bertani medium, 100 lgÆmL )1 ampicillin, 50 lgÆ mL )1 chloramphenicol) of E. coli BL21 CodonPlus(DE3)RP ⁄ pUC18-MTHis 6 bioA was used to inoculate 5 L Luria–Bertani medium (1-L batches in Erlenmeyer flasks) supplemented with 100 lgÆmL )1 ampi- cillin and 50 lgÆmL )1 chloramphenicol. The culture was shaken (180 r.p.m.) overnight at 37 °C. The cells were col- lected by centrifugation (4000 g, 15 min) and kept at )20 °C until use. The following steps were all run at 4 °C. The cell paste was resuspended in 40 mL buffer B: 50 mm Tris ⁄ HCl buffer, pH 8.0, 0.5 m NaCl, and the suspension was sonicated on ice for 70 s (seven 10-s pulses with inter- mittent 1-min cooling periods). After centrifugation (10 000 g, 20 min), the supernatant was supplemented with PLP (0.1 mm final concentration) and directly loaded on a nickel affinity column (chelating Sepharose; 1.6 cm internal diameter, 5 cm long, 10 mL) prepared as recommended by the manufacturer and equilibrated with buffer B. After loading, the column was washed with 100 mL buffer B, and the proteins were eluted with 100 mL buffer B contain- ing 100 mm imidazole and then 100 mL buffer B containing 200 mm imidazole. The column was run at a flow rate of 2mLÆmin )1 , and 4-mL fractions were collected. The pres- ence of protein in the fractions was detected using the Bradford assay, and the purity of individual fractions was analyzed by SDS ⁄ PAGE. Fractions containing pure DAPA AT were pooled, and the protein was precipitated by the addition of ammonium sulfate at 70% saturation. The pre- cipitated protein was recovered by centrifugation (10 min at 12 000 g), solubilized in 600 lL50mm Tris ⁄ HCl buffer, pH 8.0, 10 mm 2-mercaptoethanol and dialyzed overnight against 1 L of the same buffer supplemented with 0.1 mm PLP. The enzyme solution was then stored at )80 °C. Determination of the oligomerization state The native molecular mass of pure M. tubersulosis His 6 - tagged DAPA AT was estimated by gel filtration on an FPLC apparatus equipped with a calibrated Superdex 200 HR 10 ⁄ 30 column and using 50 mm Tris ⁄ HCl buffer (pH 8.0) ⁄ 10 mm 2-mercaptoethanol as eluent (0.5 mLÆmin )1 flow rate, detection set at 280 nm). Commercial standards (200 lL) dissolved in the eluent at % 1mgÆmL )1 (blue dex- tran, l-tryptophane, b-amylase, BSA, chymotrypsin, alco- hol dehydrogenase, cytochrome c, carbonic anhydrase, standards from Sigma) were separated on the column, and the K av measured for each standard was plotted against the logarithm of their molecular mass [39]. The linear plot thus obtained was used to estimate the native molecular mass of the His 6 -tagged DAPA AT (100 lL of a 0.1 mgÆmL )1 solu- tion was injected several times, and the average K av was used for the determination). Protein assay Protein concentrations were determined using the colori- metric assay described by Bradford [40] and as supplied by Bio-Rad. DAPA AT assays Coupled assay The assay (100-lL final volume) consisted of, unless other- wise stated: 100 mm 4-(2-hydroxyethyl)-1-piperazinepro- panesulfonic acid (EPPS) buffer, pH 8.6, 10 mm ATP, 50 mm NaHCO 3 ,10mm MgCl 2 , dethiobiotin synthase (800 ng), 0.1 mm PLP, 20 lm KAPA, 1 mm AdoMet and DAPA AT (185 ng). The mixture was preincubated for 2 min at 37 °C, and the reaction was then initiated by add- ing the DAPA AT. The reaction was stopped by adding 25 lL 15% (w ⁄ v) trichloroacetic acid, and the dethiobiotin formed was quantified by the standard disc bioassay proce- dure, using E. coli C268 as described [24]. One unit is defined as the amount of enzyme producing 1 lmol product per min in the conditions described above. Direct assay The assay (100 lL final volume) consisted of, unless other- wise stated: 100 mm EPPS buffer, pH 8.6, 0.1 mm PLP, 20 lm KAPA, 1 mm AdoMet and DAPA AT (0.65 lg). The assay was run as described above for the coupled assay. The DAPA formed was quantified by the standard disc bioassay procedure using E. coli MEC1 [13] in a modi- fied Vogel–Bonner minimal medium [24], prepared without casamino acids. A range of authentic DAPA samples from 0.7 to 20 pmol was used as standards. Although the direct assay is more sensitive and simpler (no coupling enzyme) than the coupled assay, we found the former less reliable. Therefore, the coupled assay was used throughout this work except when high sensitivity was M. tuberculosis DAPA aminotransferase S. Mann and O. Ploux 4786 FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS required (inactivation studies and alternate amino donor experiments, see below). pH profile The His 6 -tagged M. tuberculosis DAPA AT enzymatic activity was measured using the coupled assay (as described above) but at various pH values, using the following buffer solutions: 100 mm Hepes from pH 6.8 to pH 8.2, 100 mm EPPS from pH 7.6 to pH 8.6, and 100 mm TAPS (N- [tris(hydroxymethyl)methyl]-3-aminopropanesulfonic acid) from pH 7.7 to pH 9.1. The E. coli DAPA AT was purified as previously described [18] and assayed under the same conditions. Control experiments were run to ensure that the dethiobiotin synthase-catalyzed step was never rate deter- mining in these conditions. The activity versus pH profile data were fitted to Eqn (1), using a nonlinear regression analysis supported by Kaleidagraph software (Synergy Soft- ware, Reading, PA, USA). Amino donor The direct enzymatic assay was carried out as described above, except that AdoMet was replaced by various amines at concentrations up to 5 mm and a higher amount of His 6 - tagged M. tuberculosis DAPA AT was used (1.3 lg). Determination of the kinetic parameters of DAPA AT Kinetic parameters were determined on the His 6 -tagged DAPA AT using the coupled enzymatic assay, as described above, and by varying AdoMet and KAPA concentrations. The inhibition type and the inhibition constant displayed by KAPA were determined using the Hanes–Woolf plot. V m and K mAdoMet were also derived from the Hanes–Woolf plot. K mKAPA was then estimated using the constant ratio method, i.e., the rate of the reaction was measured while keeping the substrate concentrations at a constant ratio. [AdoMet] ⁄ [KAPA]ratio was set at 125, 250 and 375, and [AdoMet] was varied from 0.25 mm to 4 mm. It was experi- mentally difficult to obtain good quality data using lower or higher molar ratios, because increasing the KAPA concen- tration led to strong inhibition and increasing the AdoMet concentration above 4 mm also led to a slight inhibition. See the Supplementary material for detailed analysis. Kinetics of DAPA-AT inactivation by amiclenomycin and compound 1 A solution (35 lL) of His 6 -tagged DAPA AT (8.9 lg) in 50 mm Tris ⁄ HCl buffer, pH 8.0, containing 10 mm 2-mercaptoethanol and amiclenomycin or compound 1 at various concentrations (for amiclenomycin: 5.7, 11.4, 17.1, 25.7 lm, and 9.8, 22.0, 24.6, 34.4, 30.0, 40.0, 50.0 lm for compound 1) was incubated at 37 °C. The residual activity was measured at different time points by withdrawing 3.5- lL samples of the preincubation mixture and adding them to the coupled assay mixture. The dethiobiotin formed was then quantified by the standard disc bioassay, as described above. Plotting the logarithm of the residual activity against time gave straight lines, the slope of which gave the apparent inactivation rate constant, k obs . Replotting k obs against inhibitor concentration in a double-reciprocal plot allowed the estimation of K i and k inact . Inactivation experi- ments using d-cycloserine or l-cycloserine (1.3 mm)or gabaculine (1.3 mm) were run under the same conditions. Titration of DAPA AT by amiclenomycin His 6 -tagged DAPA AT (8.9 lg, 5.7 lm active sites, based on a molecular mass of 45 kDa per monomer) was incubated in 50 mm Tris ⁄ HCl buffer, pH 8.0, containing 10 mm 2-merca- ptoethanol and amiclenomycin or compound 1 (from 1.7 to 5.7 lm). After 45 min of incubation at 37 °C, samples were withdrawn (3.5 lL, corresponding to 0.89 lg DAPA AT), and the residual enzymatic activity was measured using the coupled assay, as described above. Plotting the residual activity against the molar ratio of inactivator over that of DAPA AT active sites gave a straight line that extrapolated to 1.1 for amiclenomycin and to 1.0 for compound 1. Irreversibility of the inactivation by amiclenomycin His 6 -tagged DAPA-AT (4.3 lg) was incubated in 50 mm Tris ⁄ HCl buffer, pH 8.0, containing 10 mm 2-mercaptoeth- anol and amiclenomycin (34 lm) for 34 min at 37 °Cina final volume of 17.5 lL. A 3.5-lL sample was withdrawn, and the residual activity was measured using the direct en- zymatic assay, as described above. At the same time, the remaining mixture was diluted to a final volume of 100 lL with 50 mm Tris ⁄ HCl buffer (pH 8.0) ⁄ 10 mm 2-mercapto- ethanol ⁄ 0.1 mm PLP to stop the inactivation process. The resulting solution was dialyzed against 0.25 L 50 mm Tris ⁄ HCl buffer (pH 8.0) ⁄ 10 mm 2-mercaptoethanol ⁄ 0.1 mm PLP for 15 h at 10 °C. The residual activity of the enzyme solution was then measured, taking into account the dilution factor due to the dialysis step. A blank contain- ing all components but without the inhibitor was carried out in parallel and treated in the same way. Effect of compound 1 on E. coli C268/pUC18- MTHis 6 bioA and M. smegmatis growth A culture of E. coli C268 ⁄ pUC18-MTHis 6 bioA cells in Luria–Bertani medium containing 100 lgÆmL )1 ampicillin was grown until A 600 reached a value of 0.9. The cells were S. Mann and O. Ploux M. tuberculosis DAPA aminotransferase FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS 4787 [...]... d-Cycloserine inactivation of d-amino acid aminotransferase leads to a stable noncovalent protein complex with an aromatic cycloserinePLP derivative J Am Chem Soc 120, 2268–2274 M tuberculosis DAPA aminotransferase 34 Fenn TD, Stamper GF, Morollo AA & Ringe D (2003) A side reaction of alanine racemase: transamination of cycloserine Biochemistry 42, 5775–5783 35 Cleary PP, Campbell A & Chang R (1972) Location of... gamma-aminobutyric acid- alpha-ketoglutaric acid transaminase by the neutrotoxin gabaculine Biochemistry 16, 4605–4610 Olson GT, Fu M, Lau S, Rinehart KL & Silverman RB (1998) An aromatization mechanism of inactivation of c-aminobutyric acid aminotransferase for the antibiotic l-cycloserine J Am Chem Soc 120, 2256–2267 Peisach D, Chipman DM, Van Ophem PW, Manning JM & Ringe D (1998) d-Cycloserine inactivation... Inhibition of diamino pelargonic acid aminotransferase, an enzyme of the biotin biosynthetic pathway, by amiclenomycin: a mechanistic study Helv Chim Acta 86, 3836–3850 Mann S, Marquet A & Ploux O (2005) Inhibition of 7,8-diaminopelargonic acid aminotransferase by amiclenomycin and analogues Biochem Soc Trans 33, 802– 805 Metzler CM & Metzler DE (1987) Quantitative description of absorption spectra... the bioA gene References 1 Dye C (2006) Global epidemiology of tuberculosis Lancet 367, 938–940 2 Marquet A, Bui BT & Florentin D (2001) Biosynthesis of biotin and lipoic acid Vitam Horm 61, 51–101 3 Eisenberg MA & Hsiung SC (1982) Mode of action of the biotin antimetabolites actithiazic acid and alphamethyldethiobiotin Antimicrob Agents Chemother 21, 5–10 4 Okami Y, Kitahara T, Hamada M, Naganawa H &... Sandmark J, Eliot AC, Famm K, Schneider G & Kirsch JF (2004) Conserved and nonconserved residues in the substrate binding site of 7,8-diaminopelargonic acid synthase from Escherichia coli are essential for catalysis Biochemistry 43, 1213–1222 18 Kack H, Gibson KJ, Gatenby AA, Schnieder G & Lindquvist Y (1998) Purification and preliminary X-ray crystallographic studies of recombinant 7,8-diaminopelargonic... smegmatis impaired in stationary-phase survival Microbiology 146, 2209– 2217 10 Camus JC, Pryor MJ, Medigue C & Cole ST (2002) Re-annotation of the genome sequence of Mycobacterium tuberculosis H37Rv Microbiology 148, 2967–2973 4788 11 Rodionov DA, Mironov AA & Gelfand MS (2002) Conservation of the biotin regulon and the BirA regulatory signal in Eubacteria and Archaea Genome Res 12, 1507–1516 12 Hayakawa... Hayakawa K & Oizumi J (1987) Determination of free biotin in plasma by liquid chromatography with fluorimetric detection J Chromatogr 413, 247– 250 13 Stoner GL & Eisenberg MA (1975) Purification and properties of 7,8-diaminopelargonic acid aminotransferase J Biol Chem 250, 4029–4036 14 Stoner GL & Eisenberg MA (1975) Biosynthesis of 7,8diaminopelargonic acid from 7-keto-8-aminopelargonic acid and S-adenosyl-l-methionine... Biochem 236, 301–308 38 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: a Laboratory Manual, 2nd edn Cold Spring Harbor Laboratory Press, Plainview 39 Granath KA & Kvist BE (1967) Molecular weight distribution analysis by gel chromatography on Sephadex J Chromatogr 28, 69–81 40 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing... spectra of a pyridoxal phosphatedependent enzyme using lognormal distribution curves Anal Biochem 166, 313–327 Fersht A (1998) Structure and Mechanism in Protein Science: a Guide to Enzyme Catalysis and Protein Folding, 3rd edn W.H Freeman, New York Izumi Y, Sato K, Tani Y & Ogata K (1975) 7,8-Diaminopelargonic Acid aminotransferase, an enzyme involved in biotin biosynthesis by microorganisms Agric Biol... (1974) Studies on a new amino acid antibiotic, amiclenomycin J Antibiot (Tokyo) 27, 656–664 5 Kitahara T, Hotta K, Yoshida M & Okami Y (1975) Biological studies of amiclenomycin J Antibiot (Tokyo) 28, 215–221 6 Hotta K, Kitahara T & Okami Y (1975) Studies of the mode of action of amiclenomycin J Antibiot (Tokyo) 28, 222–228 7 Poetsch M, Zahner H, Werner RG, Kern A & Jung G (1985) Metabolic products from . 7,8-Diaminoperlargonic acid aminotransferase from Mycobacterium tuberculosis, a potential therapeutic target Characterization and inhibition studies Ste ´ phane. tuberculosis DAPA AT; lane 12, molecular mass standards (66 kDa, 45 kDa, 36 kDa, 29 kDa, 24 kDa, 20 kDa). M. tuberculosis DAPA aminotransferase S. Mann and O.