Noninvasive imaging of microRNA124a-mediated repression of the chromosome 14 ORF 24 gene during neurogenesis Hae Young Ko1,2,3, Dong Soo Lee1,4 and Soonhag Kim5 Department of Nuclear Medicine, Seoul National University College of Medicine, Korea Interdisciplinary Course of Radiation Applied Life Science, Seoul National University College of Medicine, Korea Institute of Radiation Medicine, Medical Research Center, Seoul, Korea Department of Molecular Medicine and Biopharmaceutical Science, Seoul National University College of Medicine, Korea Laboratory of Molecular Imaging, CHA Stem Cell Institute, CHA University, Seoul, Korea Keywords c14orf24; imaging; microRNA124a; neurogenesis; target gene Correspondence S Kim, Laboratory of Molecular Imaging, CHA Stem Cell Institute, CHA University, 605-21 Yoeksam 1-dong, Gangnam-gu, Seoul, 135-081, Korea Fax: +82 3468 3373 Tel: +82 3468 2830 E-mail: kimsoonhag@empal.com D S Lee, Department of Nuclear Medicine, Seoul National University, College of Medicine, 28 Yongon-dong, Chongno-gu, Seoul, 110-744, Korea Fax: +82 3668 7090 Tel: +82 2072 2501 E-mail: dsl@plaza.snu.ac.kr (Received 16 April 2009, revised 15 June 2009, accepted 29 June 2009) doi:10.1111/j.1742-4658.2009.07185.x The function of microRNAs (miRNAs) is translational repression or mRNA cleavage of target genes by binding to 3¢-UTRs of target mRNA In this study, we investigated the functions and the target genes of microRNA124a (miR124a), and imaged the miR124a-mediated repression of chromosome 14 open reading frame24 (c14orf24, unknown function) during neurogenesis, using noninvasive luciferase systems The expression and functions of miR124a were investigated in neuronal differentiation of P19 cells (P19 is a mouse embryonic carcinoma cell line) by qRT-PCR and RTPCR The predicted target genes of miR124a were found by searching a bioinformatics database and confirmed by RT-PCR analysis Remarkable repression of c14orf24 by miR124a was detected during neurogenesis, and was imaged using in vitro and in vivo luciferase systems The expression of miR124a was highly upregulated during neuronal differentiation Overexpression of miR124a in P19 cells resulted in a preneuronal gene expression pattern MicroRNA124a-mediated repression of c14orf24 was successfully monitored during neuronal differentiation Also, c14orf24 showed molecular biological characteristics as follows: dominant expression in the cytoplasm; a high level of expression in proliferating cells; and gradually decreased expression during neurogenesis Our noninvasive luciferease system was used for monitoring the functions of miRNAs, to provide imaging information on miRNA-related neurogenesis and the miRNAregulated molecular network in cellular metabolism and diseases Introduction MicroRNAs (miRNAs), a class of small noncoding RNAs, are  22-nucleotide single-strand RNA molecules that are expressed in both plants and animals [1,2] In general, miRNAs are incorporated into the RNA-induced silencing complex, and perfectly or imperfectly bind to the 3¢-UTR of its target mRNA to Abbreviations AA, antibiotic ⁄ antimycotic solution; c14orf24, chromosome 14 ORF 24; CMV, cytomegalovirus; DAPI, 4¢,6-diamidino-2-phenylindole; EdU, 5-ethynyl-2¢-deoxyuridine; Fluc, firefly luciferase; Gluc, Gaussia luciferase; LAMC1, laminin c1; LMNB1, lamin B1; MAP2, microtubuleassociated protein 2; miRNA, microRNA; MSC, mesenchymal stem cell; Oct4, octamer4; PTBP1, polypyrimidine tract-binding protein 1; PTPN12, protein tyrosine phosphatase non-receptor type 12; qRT-PCR, quantitative RT-PCR; RA, retinoic acid; RBMS1, RNA-binding motif single-stranded interacting protein 1; ROI, region of interest; SD, standard deviation; USP48, ubiquitin-specific protease 48 4854 FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS H Y Ko et al showed, by RT-PCR, several genes that were directly regulated by miR124a One of these genes, chromosome 14 ORF 24 (c14orf24), which is of unknown function, was evaluated in our successfully developed luciferase reporter system, both in vitro and in vivo, to determine whether the 3¢-UTR of c14orf24 was directly regulated by miR124a Also, for the first time, the biological functions of c14orf24 were investigated during cell proliferation Results MicroRNA124a is expressed at a high level during neurogenesis MicroRNA124a is a small RNA composed of 22 nucleotides, and is well conserved from humans to aquatic species To determine and quantify the endogenous levels of miR124a during neuronal differentiation of P19 cells, we performed quantitative RT-PCR (qRT-PCR) (Fig 1) cDNA was synthesized from small RNA of neuronal differentiated P19 cells, at 0, 1, 2, 3, 4, and days after retinoic acid (RA) treatment A pair of specific primers for miR124a was used, and the quantities of miR124a for each differentiation day were normalized with U6 small RNA The expression of miR124a gradually increased during neuronal differentiation, and had increased more than three-fold by the fifth day after RA treatment Relative quantity (ΔΔCt) induce either mRNA degradation or translational inhibition [3–5] Recently, in animals, miRNAs have been reported to destabilize the mRNA of their targets by base paring with a continuous six or seven nucleotide sequence in the 3¢-UTR of the target genes known as a seed sequence, seed region, or seed match, in spite of the partial base pairing between miRNAs and targets [6] The first reported miRNA, encoded by the Caenorhabditis elegans gene lin-4, was found to be crucial for the developmental timing and patterning of postembryonic stages [7] Since their identification, miRNAs have been shown to play important roles in diverse biological functions, such as cell differentiation, fat metabolism, cell proliferation, and cell death [8–10] A recent study found that many miRNAs, such as miR9, miR9*, miR124a, miR134, miR23a, miR132, and miR128, are expressed in neurons and regulate neuronal development [11,12] Among them, miR124a is present at undetectable or very low levels in neural progenitors, but is expressed at a high level in differentiating and mature neurons [13] A microarray study of miR124a-treated HeLa cells (human carcinoma cells) revealed 174 downregulated non-neuronal transcripts [14] The endogenous targets directly bound and repressed by miR124a include the genes encoding small C-terminal domain phosphatase [15], polypyrimidine tract-binding protein (PTBP1) (PTB ⁄ hnRNP 1) [16], laminin c1, and integrin b1 [17] Moreover, neurite outgrowth was promoted by overexpression of miR124a during neuronal differentiation [18] It is a great challenge to study the expression and function of endogenous miRNAs without killing the animals The current methods, including northern blot analysis and RT-PCR, used to investigate the molecular regulation of endogenous miRNAs are time-consuming, labor-intensive, nonrepeatable, and not clinically relevant Recently, there have been significant advances in optical imaging techniques using multimodal reporter systems; this technology has been used for noninvasive repeated quantitative imaging of tumor and stem cells in living animals [19–22] Previous articles from our laboratory have reported the expression of miRNA and its target genes in vitro and in vivo, using these luciferase systems [21,23,24] In our study, the function of miR124a in neurogenesis was analyzed using biomarker genes of stem cells and neurons, and the expression level of miR124a investigated by qRT-PCR during the neuronal differentiation of P19 cells A bioinformatics analysis was then performed to predict the targets of miR124a, and Bio-imaging of miR124a-targeted c14orf24 Before day days days days days days Day after RA treatment Fig The expression of miR124a during neuronal differentiation of P19 cells (A) Quantitative RT-PCR analysis of the expression of mature miR124a Endogenous mature miR124a levels were increased during neuronal differentiation Data were normalized to U6 snRNA (DDCT = DCT-before – DCT-day, DCT-before = CT-miRNA ⁄ before – CT-U6RNA ⁄ before, DCT-day = CT-miRNA ⁄ day – CT-U6RNA ⁄ day) Data are expressed as means ± SD in triplicate samples FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS 4855 Bio-imaging of miR124a-targeted c14orf24 H Y Ko et al in the absence of RA The programming process of neuronal differentiation was induced by overexpression of miR124a (Fig 2A) We followed the gradual acquisition of neuronal traits over time after transfection with exogenous miR124a Interestingly, days after transfection, none of the P19 cells treated with miR124a showed neuronal morphology, whereas RA-treated P19 cells had the neuronal phenotype Preneuronal characteristics of P19 cells were induced by overexpression of miR124a To investigate the role of miR124a during neurogenesis, overexpression of miR124a was examined in P19 cells We transfected exogenously derived miR124a, at a concentration of nm, into P19 cells, which are believed not to be induced into neuronal differentiation A B Oct4 days days days Day after transfection with miR124a NeuroD MAP2 β-actin Before day days days days Before day Day after transfection with miR124a days days days days days Day after RA treatment day days days days Day after anti-miR124a and RA treatment days Day after RA treatment C Oct4 ×400 ×400 ×400 ×400 ×400 ×400 ×400 ×400 ×400 ×400 ×400 ×400 ×400 NeuroD MAP2 days days ×400 days ×400 days Before Day after transfection with miR124a Day after RA treatment Fig MicroRNA124a-induced preneurogenesis in P19 cells (A) Neuronal differentiation analysis in miR124a-transfected P19 cells Upper panel: P19 cells were changed to preneurons by overexpression of miR124a Lower panel: neuronal differentiation induced by RA treatment, as a control (B) RT-PCR analysis of P19 cells transfected with miR124a and subjected to RA treatment Oct4, stem cell marker; NeuroD, preneuronal marker; MAP2, neuronal marker b-Actin was used as a control (C) Laser scanning confocal microscopy of immunofluorescence staining using Oct4, NeuroD and MAP2 for P19 cells transfected with miR124a, treated with RA, and treated with both anti-miR124a and RA for days Red fluorescence represents the cytoplasmic expression of Oct4 (top panel), NeuroD (middle panel), and MAP2 (bottom panel), and the blue fluorescence represents DAPI, which stained the nucleus 4856 FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS H Y Ko et al However, thereafter, miR124a-treated P19 cells exhibited a marked change in cell morphology: there was a gradual expansion of dendrites from the cells, even though the rate of dendrite development from miR124a-treated P19 cells was slower than in the positive controls By RT-PCR analysis, it was shown that, in undifferentiated P19 cells, expression of the stem cell marker octamer (Oct4) was upregulated, but the differentiation markers NeuroD and microtubuleassociated protein (MAP2) were not detected, as previously reported [15] (Fig 2B) When P19 cells was treated only with miR124a, the level of Oct4 transcript was gradually decreased until days, whereas RA treatment of P19 cells resulted in the disappearance of Oct4 expression days after the treatment Both miR124a-treated and RA-treated P19 cells showed a significant increase in the expression of the preneuronal marker NeuroD; however, this was less than in P19 cells with RA treatment Interestingly, the neuron marker MAP2 was present at high levels only in RA-treated P19 cells, and was not present at high levels in P19 cells treated with exogenous miR124a Additionally, to inhibit the function of miR124a, we treated P19 cells with both RA and miR124a antagomir (synthetic oligonucleotides that fully complement the miR124a) Oct4 was continuously expressed until days after anti-miR124a and RA treatment, but gradually decreased in level, whereas MAP2 was undetectable Moreover, NeuroD was detected only days after treatment with RA and miR124a antagomir These results showed that miR124a antagomir retarded RA-induced neuronal differentiation of P19 cells by blocking miR124a function To investigate how the protein levels of these markers were affected by miR124a or RA in P19 cells, immunofluorescence staining was performed with each antibody (Fig 2C) The confocal microscope image showed that the fluorescent signals obtained with Oct4 was found in the cytoplasm of undifferentiated P19 cells, gradually decreased with the treatment with miR124a, and was undetectable after RA treatment, owing to the neuronal differentiation of P19 cells Conversely, the cytoplasmic fluorescent activity of P19 cells with NeuroD gradually increased with treatment with miR124a or RA by days, with stronger signals being seen in RA-treated P19 cells, whereas no signal was found before the treatments The result of immunofluorescence staining using MAP2 showed a gradual increase of cytoplasmic fluorescence in RA-treated P19 cells for days, but no significant signal either before or after the miR124a treatment in P19 cells This suggests that the sole function of miR124a could be to trigger the initial neurogenesis program and that it is Bio-imaging of miR124a-targeted c14orf24 not additionally involved in fully differentiating P19 cells into mature neurons MicroRNA124a repressed multiple target genes during the neuronal differentiation of P19 cells To find the genes that are directly regulated by miR124a during miR124a-directed neurogenesis and that contain miR124a seed sequences, microarray data from miR124a-treated HeLa cells [14] and bioinformatics data from miR124a-predicted targets from the PicTar database (http://pictar.mdc-berlin.de), an algorithm for the identification of miRNA targets using 3¢-UTR alignments, were compared Comparison of 174 microarray-analyzed genes that are significantly regulated by miR124a in HeLa cells and the PicTar database-predicted 787 genes showed 35 genes with overlapping coding sequences that might be directly regulated by miR124a (Fig 3A, Table S1) For further analysis of miR124a-targeted gene expression by RT-PCR, we randomly selected eight candidates after a review of the literature and determination of the neuronal correlation These included the following: c14orf24, laminin gamma (LAMC1), PTBP1, RNAbinding motif single-stranded interacting protein (RBMS1), hypothetical protein MGC5508 (transmembrane protein 109), lamin B1 (LMNB1), protein tyrosine phosphatase non-receptor type 12 (PTPN12), and ubiquitin-specific protease 48 (USP48) Unlike the gradual increase of miR124a expression during the neuronal differentiation of P19 cells treated with RA, the endogenous gene expression of five of the candidates was gradually decreased over the period of neuronal differentiation (Fig 3B) Unfortunately, three of the eight targets, transmembrane protein 109, Usp48, and RBMS1, could hardly be distinguished, owing to weak expression or technical problems with amplification of their amplicons (data not shown) To determine the direct correlation between the five candidates and miR124a, overexpression analysis of exogenous miR124a was conducted in P19 cells in the absence of RA treatment We could more clearly predict that mRNA transcript levels of the c14orf24, LAMC1, PTBP1, PTPN12 and LMNB1 genes were significantly and directly repressed by miR124a, indicating that mRNA of the five target genes was destabilized by miR124a (Fig 3C) C14orf24 was directly downregulated by miR124a Most of the miRNA target genes predicted in the PicTar database have one to tens of different miRNA seed sequences at the 3¢-UTR of each mRNA This means that multiple miRNAs can regulate a single FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS 4857 Bio-imaging of miR124a-targeted c14orf24 H Y Ko et al A B C C14orf24 C14orf24 LAMC1 LAMC1 PTBP1 a c b 752 genes 35 genes 139 genes PTBP1 LMNB1 LMNB1 PTPN12 PTPN12 β-actin β-actin Before day days days days days days Untreated +miR124a Day after RA treatment Fig The predicted target genes of miR124a in P19 cells (A) Prediction of miR124a target genes using bioinformatics By comparison with 787 genes obtained from the PicTar database (a) and 174 genes significantly downregulated in miR124a-treated HeLa cells (b), 35 genes with overlapping coding sequences (c) were discovered (B) RT-PCR analysis showing the expression of five predicted target genes The levels of c14orf24, LAMC1, PTBP1, PTPN12 and LMNB1 were repressed by increasing amounts of miR124a during the neuronal differentiation of P19 cells (C) The target genes downregulated by overexpression of miR124a The five predicted genes (c14orf24, LAMC1, PTBP1, PTPN12, and LMNB1) were downregulated by miR124a transfection into P19 cells target in a cell or a tissue at the same time Fortunately, the PicTar database showed that the 3¢-UTR of c14orf24 has only two predicted miRNA seed sequences, miR124a and miR128, both of which are known to be expressed during neurogenesis [12] The miRNA-related functions of these are unknown; we sought to determine whether c14orf24 is directly regulated by miR124a or not About 100 bp of the 3¢-UTR of c14orf24 near the miR124a seed sequence was cloned into our established luciferase reporter gene system, CMV ⁄ Gluc ⁄ c14ofr24-3¢UTR, to monitor whether it is directly downregulated by miR124a (Fig 4A,B) CMV ⁄ Gluc ⁄ c14orf24-3¢UTR was first transfected into HeLa cells, where miR124a expression is undetectable The cotransfection with various doses of exogenous miR124a showed a significant repression of Gaussia luciferase (Gluc) activity as compared with the control, CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt construct, which contained a completely mutated miR124 seed sequence of c14orf24 (Fig 4C) To quantify the in vitro luciferase activity, representing the miR124a-directed endogenous expression level of the c14orf24 gene during neurogenesis, CMV ⁄ Gluc ⁄ c14ofr24-3¢UTR was transfected into RA-treated P19 cells The Gluc activity of CMV ⁄ Gluc ⁄ c14ofr243¢UTR slightly decreased to the third day of neuronal differentiation of P19 cells (Fig 4D) The significant decrease in Gluc activity from CMV ⁄ Gluc ⁄ c14ofr243¢UTR was detected days after the neuronal differentiation of P19 cells, as compared with CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt The in vivo imaging of 2.5 · 106 implanted P19 cells bearing CMV ⁄ Gluc ⁄ c14ofr24-3¢UTR or CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt was monitored for days of neuro- 4858 nal differentiation, and then analyzed by a region of interest (ROI) analysis As compared with the control from the left thigh without RA treatment, the Gluc expression of CMV ⁄ Gluc ⁄ c14ofr24-3¢UTR from the RA-treated P19 cells was significantly decreased, and almost disappeared by the second day of neuronal differentiation, due to the increased expression of miR124a (Fig 4E) Similar to what was found in the in vitro luciferase assay of CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt, the Gluc activity was slightly, but not significantly, decreased (Fig 4F) The fold ratio from the ROI analysis of CMV ⁄ Gluc ⁄ c14ofr24-3¢UTR showed more dramatically decreased expression of c14orf24 in the RA-treated P19 cells than in the undifferentiated P19 cells (Fig 4G) The c14orf24 gene was expressed in the cytoplasm as a cellular component and functioned biologically in the positive regulation of cell proliferation Unfortunately, any potentially valuable biological functions of c14orf24 have not yet been studied, and even its antibody was not available Therefore, identification of the functions of c14orf24 is a considerable challenge To predict how the protein encoded by the c14orf24 mRNA regulated by miR124a functions in the intact cells, we introduced the coding sequence and the full 3¢-UTR containing miR124a seed sequences of c14orf24 into an expression vector, pcDNA3.1 ⁄ His vector (designated as Xp-c14orf24), that could express c14orf24 at abnormally high levels and represent the miR124a-mediated repression that takes place in cells in the presence of miR124a First, to investigate the FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS H Y Ko et al Bio-imaging of miR124a-targeted c14orf24 A B CMV/Gluc/c14orf24-3′ UTR 2360 c14orf24 mRNA ORF 3′UTR CMV AGTT TA TGTTTATCAATATAGTTATTCACTGTGCCTTAAGTTTATA TACAGTTATTCACTGTGCCTTACATTTTTA 3′ UTR Gluc Human Mouse ATGGGTACTGTT Seed sequence ATTGAGC CMV/Gluc/c14orf24-3′ UTRmt Mutation of seed sequence CMV C * 1.6 D ** * 1.4 * 1.4 * 1.2 Fold decrease 1.2 Fold increase 3′ UTRmt Gluc 1.0 0.8 0.6 0.4 1.0 0.8 0.6 0.4 0.2 0.2 0 nM Before 20 nM 10 nM nM Concentration of miR124a E day days 2.0 CMV/Gluc/C14orf24-3′ UTRmt Fold decrease x106 b F 0h 16 h days day 300 0h 16 h day 1.0 0.5 200 b 1.5 400 x103 500 x106 10 a days CMV/Gluc/C14orf24-3′ UTR a days G 10 days Day after RA treatment 0h day 16 h days 100 Time days Fig C14orf24 regulation by miR124a targeting (A) The genomic locus of the c14orf24 3¢-UTR containing the seed sequence that needs to be recognized by miR124a The mutation of the seed sequence was designed to interrupt the binding of miR124a into the 3¢-UTR (B) Schematic diagram of CMV ⁄ Gluc ⁄ c14orf24-3¢UTR constructs The Gluc activity of CMV ⁄ Gluc ⁄ c14orf24-3¢UTR was downregulated when miR124a bound to the c14orf24 3¢-UTR However, the Gluc activity of the CMV ⁄ Gluc ⁄ c14orf24-3¢UTR mutant was not regulated by miR124a, because miR124a did not bind to the c14orf24 3¢-UTR mutant (C) Luciferase analysis to confirm whether the c14orf24 3¢-UTR was bound by exogenous miR124a in HeLa cells The Gluc activity of CMV ⁄ Gluc ⁄ c14orf24-3¢UTR (black bar) was significantly decreased as the concentration of miR124a increased CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt (gray bar) was used as a negative control Luciferase activity was normalized to the CMV ⁄ Gluc vector Data are expressed as means ± SD in triplicate samples *P < 0.05; **P < 0.005 (D) Luciferase analysis showing that endogenous miR124a binds to the c14orf24 3¢-UTR in P19 cells after RA treatment The Gluc activity of CMV ⁄ Gluc ⁄ c14orf24-3¢UTR (black bar) was decreased during neuronal differentiation The Gluc activity of CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt (gray bar), as a negative control, was not regulated Data are expressed as means ± SD in triplicate samples *P < 0.05 (E) Bioluminescence image showing that c14orf24 is the target gene of miR124a P19 cells (2.5 · 106) transfected with CMV ⁄ Gluc ⁄ c14orf24-3¢UTR were subcutaneously grafted onto the left side (a) and right side (b) of the nude mice On the right side, neuronal differentiation was induced by RA treatment Bioluminescence of grafted P19 cells on the right side was decreased in comparison with those on the left side (three mice) (F) Bioluminescence image showing that CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt, as a negative control, was not regulated by RT-induced neuronal differentiation We used the same method as that used to obtain the previous bioluminescence image (three mice) (G) ROI analysis of the bioluminescence image The ratio differentiated ⁄ undifferentiated ratio reduced as time passed However, in the case of injected P19 cells transfected with CMV ⁄ Gluc ⁄ c14orf24-3¢UTR, the ratio remained unchanged FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS 4859 Bio-imaging of miR124a-targeted c14orf24 H Y Ko et al Fig The biological and cellular functions of the c14orf24 gene in cells (A) Immunocytostaining analysis of c14orf24 by laser scanning confocal microscopy (red, c14orf24; blue, DAPI) The pcDNA3.1 ⁄ His_c14orf24 containing Xpress epitope was transfected into P19 cells and treated with RA, miR124a or nothing for days The fluorescence image detected by Xpress antibody showed that c14orf24 proteins were predominantly present in the cytoplasm of P19 cells before the treatments, and that they disappeared during the neuronal differentiation of P19 cells induced by RA or after miR124a treatment Magnification: upper panel, · 400; lower panel, · 1000 (B) Cellular morphology characteristics of P19 cells affected by the c14orf24 gene Cell morphology was acquired days after no treatment and treatment with either or both of RA or pcDNA3.1 ⁄ His_c14orf24 of P19 cells (C) RT-PCR analysis of P19 cells transfected with the c14orf24 gene Total RNA was extracted from P19 cells days after no treatment and and treatment with either or both of RA or pcDNA3.1 ⁄ His_c14orf24 of P19 cells RT-PCR was conducted for MAP2, NeuroD, Oct4 and c14orf24 using a pair of primers listed in Tables S2 and S4 b-Actin was used as a control (D) EdU-incorporated flow cytometry analysis of P19 cells affected by the c14orf24 gene EdU-labeled cells were measured days after no treatment and after treatment with either or both of RA or pcDNA3.1 ⁄ His_c14orf24 of P19 cells The y-axis indicates the percentage of EdU-labeled P19 cells Data are expressed as means ± SD in triplicate samples *P < 0.05; **P < 0.005 (E) RT-PCR analysis of c14orf24 expression in various cell lines: HT-ori3 cells (normal thyroid cell line), L132 cells (lung normal cell line), C6 cells (glioma cell line), CT-26 cells (colon carcinoma cell line), MSCs, and G2 cells (neural stem cell line) b-Actin was used as a control localization of expression of c14orf24 protein, Xpc14orf24 was transfected into P19 cells, and double analysis was performed with the Anti-Xpress antibody and 4¢,6-diamidino-2-phenylindole (DAPI), which stains the nucleus As shown in Fig 5A, c14orf24 protein was well expressed in the undifferentiated P19 cells for days, and showed even localization in the cytoplasm However, it was observed that the expression of c14orf24 protein in the cytoplasm was almost completely lost days after treatment with either RA or miR124a of P19 cells These results implied that the expression of c14orf24 protein is dominantly localized in the cytoplasm and repressed directly by miR124a during neuronal differentiation Next, we investigated how the overexpression of c14orf24 affects the proliferation and neuronal differentiation of P19 cells Following Xp-c14orf24 transfection, P19 cells displayed more rapidly achieved and higher cell densities than the cells grown under normal control conditions (Fig 5B) Additionally, the cellular morphology demonstrated that treatment with both RA and Xp-c14orf24 of P19 cells simultaneously repressed the morphological changes of neuronal differentiation, leading to less retraction of cytoplasm towards the nucleus and a less spherical appearance of cell bodies, whereas after a single treatment with RA of P19 cells, the cells increasingly showed the neuronal traits of a pyramidal and perikaryal appearance To determine the effect of c14orf24 on P19 cells at the molecular level, RT-PCR analysis was conducted with total RNA from P19 cells days after no treatment, treatment with either RA or Xp-c14orf24, or both treatments Transfection of Xp-c14orf24 into P19 cells led to overexpression c14orf24 transcript (Fig 5C) Similar to the results shown in Fig 4B, RA treatment of P19 cells resulted in neuronal characteristics of P19 cells, which showed increased gene expression of the neuron markers MAP2 and NeuroD, and a significant decrease in that of the stem cell marker Oct4 4860 However, additional treatment of RA-treated P19 cells with Xp-c14orf24 inhibited neuronal differentiation, resulting in lower levels of MAP2 and NeuroD transcript, and higher levels of Oct4 transcript, than in P19 cells treated only with RA To further verify the effect of c14orf24 on cell proliferation and neuronal differentiation of P19 cells, flow cytometry assay was performed with the mitotic marker, 5-ethynyl-2¢-deoxyuridine (EdU) EdU is incorporated into replicating DNA similarly to 5-bromo-2¢deoxyuridine (BrdU), and its terminal alkyne group reacts with fluorescent azide [25] The incorporation of the nucleoside analog EdU into cellular DNA of P19 cells was quantified, and demonstrated that the number of EdU-labeled P19 cells with the overexpression of c14orf24 revealed about 2.5-times higher than that without treatment (Fig 5D) The number of EdU-labeled P19 cells treated with both Xp-c14orf24 and RA showed 1.7-times higher than that of only RA-treated P19 cells These results indicated a higher rate of DNA synthesis in P19 cells with c14orf24 overexpression To extend our understanding of the involvement of c14orf24 in cellular proliferation and neuronal differentiation, the expression of the c14orf24 gene was investigated in various cells, including normal, cancer and neuronal precursor cell lines RT-PCR was conducted using total RNA from HT-ori3 cells (normal thyroid cells), L132 cells (lung normal cells), C6 cells (glioma cells), CT-26 cells (colon carcinoma cells), mesenchymal stem cells (MSCs), and G2 cells (neural stem cells) In normal cells, HT-ori3 cells, and L132 cells, the c14orf24 gene was expressed at a relatively low level, whereas a higher amount of the c14orf24 amplicon was expressed in highly proliferating cells, C6 cells, and CT-26 cells (Fig 5E) Also, the c14orf24 gene was highly expressed in both MSCs and G2 Interestingly, when G2 cells were induced to undergo neuronal differentiation by the deletion of doxycycline from the growth medium, the transcript level of the c14orf24 FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS H Y Ko et al Bio-imaging of miR124a-targeted c14orf24 A x400 x400 x1000 x1000 days x400 x1000 days days Day after non treatment B x400 x400 x400 x1000 x1000 days x1000 days days Day after RA treatment Day after transfection with miR124a – – + + – + – + C RA – – + + D 70 c14orf24 – + – + EdU-labeled cell (%) RA c14orf24 MAP2 NeuroD Oct4 c14orf24 60 50 40 30 20 10 RA – – + + c14orf24 – + – + β-actin HT-ori3 E L132 C6 CT26 MSC G2-un G2-4d G2-6d c14orf24 β-actin gene was dramatically decreased, and the transcript had almost disappeared on the fourth day of neuronal differentiation This result showed that the c14orf24 gene must be positive regulator of cellular proliferation and be downregulated during neurogenesis Discussion Hundreds of well-conserved miRNAs have been reported to be evolutionarily well conserved over species and related to cellular metabolism and various diseases, including cancer, cardiovascular disease, and neurological disease [26] In particular, neuronalspecific miRNAs such as miR124a, miR9, miR128, miR131, miR178 and miR125b have been directly and indirectly shown to have relatively high expression levels during brain development, and are expected to regulate the various genes related to neuronal differentiation Complicated intracellular and extracellular communication could possibly be involved in the differentiation of stem cells into mature neurons of the eukaryotic sys- FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS 4861 Bio-imaging of miR124a-targeted c14orf24 H Y Ko et al tem In general, a single miRNA is believed to directly target hundreds of genes, which may indirectly regulate thousands of coding genes [14] Overexpression of miR1, which is specifically expressed in cardiac and skeletal muscle, induced the differentiation of C2C12 myoblasts into myotubes [27] Transfection of exogenously derived miR124a into P19 cells in the absence of RA resulted in guidance of the neuronal program, partly explaining why miR124a is specifically neuronally expressed Unlike miR1, the solo miR124a could not sufficiently induce P19 cells to fully differentiate into neurons, but could induce only the preneuronal characteristics It is possible that other, more complex, mechanisms are required to complete the neuronal differentiation program Surprisingly, some experiments in our laboratory showed that transfection of single, dual or multiple neuronal-specific miRNAs into P19 cells induced a more neuronally differentiated status than single transfection with miR124a, and that a cancer-related miRNA delayed the neuronal differentiation of RA-treated P19 cells (data not shown) These results mean that miRNAs play an important role in maintaining the stem cells and inducing neuronal differentiation As miRNAs have been shown to be correlated with various diseases, many efforts in both experimental and in silico studies have been focused on their gene targets, in order to develop our understanding from the simple concept of miRNA expression to the more complicated regulatory interactions between miRNA and target genes, which can decide cellular fate or disease progression [28,29] RT-PCR of genes selected by the analysis from the comparison of microarray data of miR124a-treated HeLa cells with miR124a-predicted targets through the PicTar database showed that the c14orf24, LAMC1, LMNB1, PTBP1 and PTPN12 genes had gradually decreased endogenous gene expression during the neuronal differentiation of P19 cells when endogenous levels of miR124a were gradually increased Additionally, excessive amounts of exogenous miR124a in P19 cells resulted in significantly direct regulation of these candidates PTPB1, which is expressed at a high level in non-neuronal cells, binds to pyrimidine-rich sequences in pre-mRNA and inhibits the splicing of nearby neuron-specific alternative exons, but is known to be repressed in the nervous system by miR124a, to allow the inclusion of neuronspecific exons in mature mRNA [16] LAMC1, which is one of the components of a heterodimeric molecule, laminin-1, comprising laminin a1, laminin b1, and laminin c1 subunits, has also been reported to be an endogenous target of miR124a [17] Our experiment using the established luciferase system containing the putative bp seed sequence matched 4862 between the 5¢-end of miR124a and the 3¢-UTR of the c14orf24 gene showed a strong evidence of miR124amediated repression of c14orf24 during neurogenesis The coding region of c14orf24 (NM_173607), the function of which is not known, possesses 213 amino acids and has a molecular mass of 23 kDa Our findings from PCR and in vitro ⁄ in vivo luciferase assays show that c14orf24 is expressed before and after neuronal differentiation of P19 cells, but its expression is significantly decreased on the day when the endogenous level of miR124a is at its peak Also, the strong suppression of c14orf24 transcript was caused by the exogenous miR124a, through direct binding of miR124a to the miR124a seed sequence of c14orf24 Unfortunately, the in vivo Gluc expression of transiently transfected luciferase systems was almost gone after days of neuronal differentiation For long-term noninvasive imaging, stable cell lines or viral vectors such as lentiviral or adenoviral vector will be helpful to image the dynamic changes of miR124a-regulated neurogenesis Additional biological and cellular studies of the c14orf24 gene by immunocytostaining, flow cytometry and RT-PCR analysis showed that c14orf24 was dominantly expressed in the cytoplasm and highly expressed in proliferating cells, but was repressed during neuronal differentiation In this study, for the first time, we showed that c14orf24 might function in maintaining cell proliferation, at least in P19 cells, and be involved in the initial program of neurogenesis via the negative interaction with miR124a Our noninvasive luciferase imaging systems for monitoring the repression of the novel targets of miR124a will be a useful tool for the study of the molecular regulation of miRNAs related to cellular proliferation, differentiation, apoptosis, and various diseases In particular, our ongoing development of a dual luciferase reporter gene system to simultaneously monitor ectopically expressed miRNAs and their targets will provide bidirectional information for cellular therapy and disease diagnosis Experimental procedures Quantitative RT-PCR of miR124a With the mirVana miRNA isolation kit (Ambion, Austin, TX, USA), small RNA was isolated during the neuronal differentiation of P19 cells qRT-PCR was performed using the mirVana qRT-PCR primer Set (Ambion) and mirVana qRT-PCR miRNA detection kits (Ambion), according to the manufacturer’s instructions The PCRs were performed in triplicate using iCycer (Bio-Rad, Hercules, CA, USA) with SYBR Premix Ex Taq (2 ·) (Takara, Shiga, Japan) as follows: 95 °C for min; and 40 cycles of 95 °C for 15 s FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS H Y Ko et al and 60 °C for 30 s) To normalize the experimental samples for RNA content, the U6 snRNA primer set (Ambion) was used as a control Culture of HeLa cells and P19 cells HeLa cells (cervical carcinoma cell line) were cultured routinely in RPMI (Jeil Biotechservices Inc., Daegu, Korea) containing 10% fetal bovine serum (Cellgro, Herndon, VA, USA) and 1% antibiotics ⁄ antimycotic solution (AA) (Cellgro) at 37 °C P19 cells were obtained from the ATCC In brief, undifferentiated P19 cells were grown at 37 °C in a-MEM (Gibco, Grand Island, NY, USA) supplemented with 2.5% fetal bovine serum (Cellgro), 7.5% bovine calf serum (Gibco) and 1% AA (Cellgro) in a 5% CO2 humidified chamber For induction of neuronal differentiation using the monoculture differentiation method [21], P19 cells were plated on gelatin-coated culture plates at a density of · 103 cellsỈcm)2 in growth medium prior to growth factor removal After 24 h, P19 cells were cultured under serum-free conditions in DMEM ⁄ 12 (1 : 1) medium (Gibco) supplemented with 1% insulin–transferrin–selenium (Gibco) and 1% antibiotics, and treated with · 10)7 m all-trans-RA (Sigma, St Louis, MO, USA) After days, the RA was removed from the medium, and the cells were cultured further under serum-free conditions RT-PCR Using Trisol reagent (Invitrogen, Grand Island, NY, USA), total RNA was isolated from P19 cells as during the day after RA treatment Reverse transcription, for synthesis of the first-strand cDNA, was carried out using random-hexamer and SuperScript II reverse transcriptase (Invitrogen), according to the manufacturer’s instructions, and this cDNA was then used as a template for PCR amplification: 94 °C for min, with 30 amplification cycles [94 °C for 30 s each Tm for 30 s (Tables S2 and S4), 72 °C for 30 s], and 72 °C for The sequences of the primers used for PCR amplification are listed in Table S2 and Table S4 Development of vectors monitoring the miR124a-directed repression of c14orf24 We constructed a Gluc reporter vector bearing a cytomegalovirus (CMV) promoter, and 99 nucleotides from the 3¢-UTR of the c14orf24 gene, containing an miR124a seed sequence, identified through the PicTar database, were used for imaging of miR124a-regulated repression They were constructed by incubation with a pair of primers, sense and antisense primers of the c14orf24 3¢-UTR, in annealing buffer (· TE buffer + 50mm NaCl) for 10 at 60 °C, cloned into CMV ⁄ Gluc at the site between XhoI and XbaI, and cloned into the CMV ⁄ Gluc vector labeled Bio-imaging of miR124a-targeted c14orf24 CMV ⁄ Gluc ⁄ c14orf24-3¢UTR (Table S3) As a negative control, CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt was constructed by complete mutation of the miR124a seed sequences in the 3¢-UTR of c14orf24, and annealing the oligonucleotides and sense and antisense primers of c14orf24-3¢UTRmt (Fig 4A,B) Transfection and luciferase assay Transient transfection of various vectors of interest into undifferentiated ⁄ differentiated P19 cells was performed by using 0.6 lg of DNA, lL of Plus reagent (Invitrogen), and 1.5 lL of Lipofectamine (Invitrogen) per well After h, the transfection medium was replaced with undifferentiated medium (a-MEM; 2.5% fetal bovine serum, 7.5% bovine calf serum, and 1% AA) from undifferentiated P19 cells and differentiated media (DMEM ⁄ 12; 1% insulin– transferrin–selenium and 1% AA) from RA-treated P19 cells Gluc expression was analyzed days after transfection All transfections were carried out in triplicate The cells were washed with NaCl ⁄ Pi and lysed with 200 lL per well of passive lysis buffer (Promega, Madison, WI, USA) Next, 100 lL of cell lysate from each well was used to measure luciferase activity with the Gaussia luciferase assay kit (Targetingsystems, San Diego, CA, USA), according to the manufacturer’s instructions, and measured on a Wallac1420 VICTOR3V (PerkinElmer Life and Analytical Sciences, Waltham, MA, USA) The data are presented as means ± standard deviation (SD) calculated from triplicate wells Grafting of the cells with reporter gene constructs and in vivo visualization of miR124a and c14orf24 in nude mice All experimental animals were housed under specific pathogen-free conditions and handled in accordance with the guidelines issued by the Institutional Animal Care and Use Committee of Seoul National University Hospital We performed transient transfection of P19 cells with CMV ⁄ Gluc ⁄ c14orf24-3¢UTR and CMV ⁄ Gluc ⁄ c14orf243¢UTRmt After 48 h of transfection, the cells were counted and resuspended in 100 lL of NaCl ⁄ Pi (2.5 · 106 cells per 100 lL of NaCl ⁄ Pi) These cells were implanted subcutaneously into male Balb ⁄ c nude mice (6 weeks old, weighing 25–27 g) The cells containing CMV ⁄ Gluc ⁄ c14orf24-3¢UTR or CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt were implanted in both thighs; the left thigh, without the RA treatment, was used as a control, and the right thigh was treated with RA coincidently with cell injection Three mice in each group were subsequently anesthetized with 2.5% isofluorane, and transferred into the chamber of an IVIS 100 imager (Xenogen, Alameda, CA, USA) To acquire images of Gluc, the mice were directly injected with lg of coelenterazine The Gluc FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS 4863 Bio-imaging of miR124a-targeted c14orf24 H Y Ko et al images were acquired with of exposure time Then, to acquire images of firefly luciferase (Fluc), 10 after Gluc imaging, mg (150 mgỈkg)1 body weight) of d-luciferine was injected intraperitoneally, and Fluc images were acquired 10 later The whole body images for Fluc activity were acquired for Imaging signals from all the mice were quantitatively analyzed by ROI For each EdU experiment, three random fields were imaged at · 100 magnification, and the numbers of EdUpositive cells were counted EdU-positive cells were expressed as a percentage of the total number of cells in each field, analyzed using FACSCalibur Each experiment was performed in triplicate, and the results are presented as mean ± standard error of the mean Development of vectors monitoring the expression of c14orf24 protein Statistical analysis Because the antibody for detecting c14orf24 protein was not available, we designed Xp-c14orf24 for adding the Xpress epitope tag to c14orf24 protein A c14orf24 cDNA clone was purchased at Gene Bank (KRIBB, Daejeon, Korea), and we subcloned it into pcDNA3.1 ⁄ His vector (Invitrogen), with cutting by KpnI and BamHI Xpresstagged c14orf14 proteins were confirmed by western blot (data not shown) Data are displayed as means ± standard error of the mean, and were calculated using Student’s t-test Statistical significance was accepted at P-values of < 0.05 Acknowledgements This work was supported by the Nano Bio Regenomics Project (2005-00113) and by the National R&D Program for Cancer Control of the Ministry of Health & Welfare (0820320) Immunocytochemistry using Xpress antibody P19 cells were fixed with 4% formaldehyde for 20 min, and then washed with NaCl ⁄ Pi three times for 10 each; gentle shaking was provided during incubation The blocking and permeabilization procedures were performed simultaneously with a 20% normal goat serum reaction mixture, and 0.2% Triton X-100 was added to the cells for h The Xpress-tagged c14orf14 proteins was detected by : 5000 dilution of anti-Xpress antibody (Invitrogen) and incubated overnight at °C After three washes for 10 each, Alexa Fluor 594 (Invitrogen) secondary antibody conjugates were added and incubated for 90 at room temperature The P19 cells were placed on a coverslip and mounted with aqueous mounting solution containing DAPI (Vector Laboratories, Inc., Burlingame, CA, USA) Fluorescence signal was detected by confocal laser scanning microscopy (Carl Zeiss LSM 510, Carl Zeiss, Jena, Germany) EdU assay The cells were passaged using trypsin (Invitrogen), and seeded in standard medium onto 10 cm dishes (Nunc) at a concentration of 10 000 cellsỈcm)2 The cells were grown overnight in medium in a humidified incubator at 37 °C with 5% CO2 The cells were then grown for 24 h in medium containing 10 lm EdU Cells were fixed in 4% paraformaldehyde in NaCl ⁄ Pi (pH 7.4) The EdU-positive cells were labeled with the fluorescent azide probe, and this was followed by immunofluorescence labeling Samples were blocked and permeabilized for 30 at room temperature with 2% BSA in saponin-based permeabilization reagent (Invitrogen) 4864 References Lee Y, Jeon K, Lee JT, Kim S & Kim VN (2002) MicroRNA maturation: stepwise processing and subcellular localization EMBO J 21, 4663–4670 Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, ˚ Provost P, Radmark O, Kim S et al (2003) The nuclear RNase III Drosha initiates microRNA processing Nature 425, 415–419 Hutvagner G & Zamore PD (2002) A microRNA in a multiple-turnover RNAi enzyme complex Science 297, 2056–2060 Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function Cell 116, 281–297 Ambros V (2004) The functions of animal microRNAs Nature 431, 350–355 Lewis BP, Burge CB & Bartel DP (2005) Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets Cell 120, 15–20 Chalfie M, Horvitz HR & Sulston JE (1981) Mutations that lead to reiteration in the cell lineages of C elegans Cell 24, 59–69 Dostie J, Mourelatos Z, Yang M, Sharma A & Dreyfuss G (2003) Numerous microRNPs in neuronal cells containing novel miRNAs RNA 9, 180–186 Xu P, Vernooy SY, Guo M & Hay BA (2003) The Drosophila microRNA Mir-14 supresses cell death and is required for normal fat metabolism Curr Biol 13, 790–795 10 Brennecke J, Hipfinder DR, Strark A, Russell RB & Cohen SM (2003) Bantan encodes a developmentally regulated microRNA that controls cell proliferation and FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS H Y Ko et al 11 12 13 14 15 16 17 18 19 20 21 22 regulates the proapototic gene hid in Drosophila Cell 113, 25–36 Smirnova L, Grafe A, Seiler A, Schumacher S, Nitsch R & Wulczyn FG (2005) Regulation of miRNA expression during neural cell specification Eur J Neurosci 21, 1469–1477 Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM & Ruvkun G (2004) Identification of many microRNAs that copurify with polyribosomes in mammalian neurons Proc Natl Acad Sci USA 101, 360–365 Deo M, Yu JY, Chung KH, Tippens M & Turner DL (2006) Detection of mammalian microRNA expression by in situ hybridization with RNA oligonucleotides Dev Dyn 235, 2538–2548 Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS & Johnson JM (2005) Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs Nature 433, 769–773 Visvanathan J, Lee S, Lee B, Lee JW & Lee SK (2007) The microRNA miR-124 antagonizes the anti-neural REST ⁄ SCP1 pathway during embryonic CNS development Genes Dev 21, 744–749 Makeyev EV, Zhang J, Carrasco MA & Maniatis T (2007) The microRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing Mol Cell 27, 435–448 Cao X, Pfaff SL & Gage FH (2007) A functional study of miR-124 in developing neural tube Genes Dev 21, 531–536 Yu JY, Chung KH, Deo M, Thompson RC & Turner DL (2008) MicroRNA miR-124 regulates neurite outgrowth during neuronal differentiation Exp Cell Res 14, 2618–2633 Ottobrini L, Ciana P, Biserni A, Lucignani G & Maggi A (2006) Molecular imaging: a new way to study molecular processes in vivo Mol Cell Endocrinol 246, 69–75 Doubrovin M, Serganova I, Mayer-Kuckuk P, Ponomarev V & Blasberg RG (2004) Multimodality in vivo molecular-genetic imaging Bioconjug Chem 15, 1376–1388 Lee JY, Kim S, Hwang DW, Jeong JM, Chung JK, Lee MC & Lee DS (2007) Development of dual-luciferase reporter system for in vivo visualization of microRNA biogenesis and post-transcriptional regulation J Nucl Med 49, 285–294 Tannous BA, Kim DE, Fernandez JL, Weissleder R & Breakefield XO (2005) Codon-optimized Gaussia luciferase cDNA for mammalian gene expression in culture and in vivo Mol Ther 11, 435–443 Bio-imaging of miR124a-targeted c14orf24 23 Ko MH, Kim S, Hwang DW, Ko HY, Kim YH & Lee DS (2008) Bioimaging of the unbalanced expression of microRNA9 and microRNA9* during the neuronal differentiation of P19 cells FEBS J 275, 2605–2616 24 Kim HJ, Kim YH, Lee DS, Chung JK & Kim S (2008) In vivo imaging of functional targeting of miR-221 in papillary thyroid carcinoma J Nucl Med 49, 1686– 1693 25 Salic A & Mitchison TJ (2008) A chemical method for fast sensitive detection of DNA synthesis in vivo Proc Natl Acad Sci USA 105, 2415–2420 26 Soken T, Yasushi O & Gozoh T (2006) MicroRNA: Biogenetic and functional mechanisms and involvements in cell differentiation and cancer J Pharmacol Sci 101, 267–270 27 Norio N, Tomosaburo T, Ryoji K, Isodono K, Asada S, Ueyama T, Matsubara H & Oh H (2006) MicroRNA-1 facilitates skeletal myogenic differentiation without affecting osteoblastic and adipogenic differentiation Biochem Biophys Res Commun 350, 1006–1012 28 Zhu S, Si ML, Wu H & Mo YY (2007) MicroRNA-21 targets the tumor suppressor gene tropomyosin (TPM1) J Biol Chem 82, 14328–14336 29 Baroukh N, Ravier MA, Loder MK, Hill EV, Bounacer A, Scharfmann R, Rutter GA & Van Obberghen E (2007) MicroRNA-124a regulates Foxa2 expression and intracellular signaling in pancreatic beta-cell lines J Biol Chem 282, 19575–19588 Supporting information The following supplementary material is available: Table S1 The list of miR124a-predicted targets obtained through bioinformatics analysis Table S2 A list of RT-PCR primers Table S3 A list of primer pairs for monitoring miR124a and c14orf24 Table S4 A list of RT-PCR primers for predicting miR124a targets This supplementary material can be found in the online article Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS 4865 ... mutated miR 124 seed sequence of c1 4orf2 4 (Fig 4C) To quantify the in vitro luciferase activity, representing the miR124a-directed endogenous expression level of the c1 4orf2 4 gene during neurogenesis, ... FEBS 4859 Bio -imaging of miR124a-targeted c1 4orf2 4 H Y Ko et al Fig The biological and cellular functions of the c1 4orf2 4 gene in cells (A) Immunocytostaining analysis of c1 4orf2 4 by laser scanning... miR124a bound to the c1 4orf2 4 3¢-UTR However, the Gluc activity of the CMV ⁄ Gluc ⁄ c1 4orf2 4-3¢UTR mutant was not regulated by miR124a, because miR124a did not bind to the c1 4orf2 4 3¢-UTR mutant