Adenine, a hairpin ribozyme cofactor – high-pressure and competition studies Myriam Ztouti 1, *, Hussein Kaddour 1, *, Francisco Miralles 1 , Christophe Simian 1 , Jacques Vergne 1 , Guy Herve ´ 2 and Marie-Christine Maurel 1 1 Acides Nucle ´ iques et Biophotonique, FRE 3207 CNRS, Fonctions et Interactions des Acides Nucle ´ iques, UPMC Universite ´ Paris 06, France 2 Laboratoire Prote ´ ines, Biochimie Structurale et Fonctionnelle, FRE 2852 CNRS, UPMC Universite ´ Paris 06, France An important issue in the problem of the origin of life is whether or not an RNA world could have been compatible with extreme primordial conditions. This scenario of evolution postulates that an ancestral molecular world is common to all present forms of life; the functional properties of nucleic acids and proteins as we see them today, especially catalytic properties, would have been carried out by ribonucleic acids [1–6]. Catalytic RNAs, or ribozymes, are found nowadays in the human genome [7], organelles of plants [8] and lower eukaryotes, amphibians, prokaryotes, bacterio- phages, and viroids and satellite viruses that infect plants. A ribozyme also exists in hepatitis delta virus, a serious human pathogen [9]. Additional ribozymes will certainly be found in the future, and it is tempting to look for RNA cofactors such as those found in protein enzymes [10]. Indeed, RNA could increase its range of functionalities by incorporating catalytic building blocks such as imidaz- ole, thiol, and functional amino and carboxylate groups [11–13]. Another way for RNA to increase its chemical diversity would be to bind exogenous mole- cules carrying reactive groups and handle them as catalytic cofactors. We reported the isolation of new RNA aptamers able to bind adenine in a novel mode of purine recognition [14]. Adenine is a probable prebi- otic analog of histidine. Its catalytic capabilities are equivalent to those of histidine, because of the Keywords adenine; catalysis; hairpin ribozyme; high pressure; RNA Correspondence M C. Maurel, Acides Nucle ´ iques et Biophotonique (ANBioPhy), Universite ´ Pierre et Marie Curie, Tour 42–(42–43)–5 e ` me e ´ tage, 4 place Jussieu, 75252 Paris Cedex 05, France Fax: +33 1 44 27 99 16 Tel: +33 1 44 27 40 21 E-mail: marie-christine.maurel@upmc.fr *These authors contributed equally to this work (Received 28 November 2008, revised 29 January 2009, accepted 25 February 2009) doi:10.1111/j.1742-4658.2009.06983.x The RNA world hypothesis assumes that life arose from ancestral RNA molecules, which stored genetic information and catalyzed chemical reac- tions. Although RNA catalysis was believed to be restricted to phosphate chemistry, it is now established that the RNA has much wider catalytic capacities. In this respect, we devised, in a previous study, two hairpin ribozymes (adenine-dependent hairpin ribozyme 1 and adenine-dependent hairpin ribozyme 2) that require adenine as cofactor for their reversible self-cleavage. We have now used high hydrostatic pressure to investigate the role of adenine in the catalytic activity of adenine-dependent hairpin ribozyme 1. High-pressure studies are of interest because they make it pos- sible to determine the volume changes associated with the reactions, which in turn reflect the conformational modifications and changes in hydration involved in the catalytic mechanism. They are also relevant in the context of piezophilic organisms, as well as in relation to the extreme conditions that prevailed at the origin of life. Our results indicate that the catalytic process involves a transition state whose formation is accompanied by a positive activation volume and release of water molecules. In addition, competition experiments with adenine analogs strongly suggest that exo- genous adenine replaces the adenine present at the catalytic site of the wild-type hairpin ribozyme. Abbreviation ADHR1, adenine-dependent hairpin ribozyme 1. 2574 FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS presence of the imidazole moiety [15]. In this respect, we produced two adenine-dependent hairpin ribozymes [adenine-dependent hairpin ribozyme 1 (ADHR1) and adenine-dependent hairpin ribozyme 2] that require adenine as a catalytic cofactor for their reversible self- cleavage [16]. Figure 1 shows the structure of the mod- ified ADHR1 used here. These hairpin ribozymes use different catalytic strategies with respect to wild-type hairpin ribozyme, by using exogenous adenine as a cofactor for catalysis. These hairpin ribozymes are of great interest with respect to the primitive RNA world hypothesis. Adenine is synthesized in significant amounts in experiments aimed at mimicking the prebi- otic conditions [17]. It can be considered as a prebiotic analog of histidine, and could have been used by ribo- zymes of the RNA world in the same way as present- day enzymes use histidine. The hairpin ribozyme is a small RNA molecule that catalyzes the reversible cleavage of a phosphodiester bond [18]. The cleavage reaction proceeds via nucleo- philic attack of a 2¢-OH group on an adjacent phos- phorus atom, resulting in a 2¢,3¢-cyclic phosphate and a5¢-hydroxyl terminus [19]. The catalytic mechanisms of the hairpin ribozyme are not entirely understood. Nevertheless, it has been concluded that an important conformational transition of the molecule is necessary to allow the formation of the active site [20]. The mini- mal catalytic form of the hairpin ribozyme is com- posed of two adjacent helix–loop–helix domains, A and B (Fig. 1). The hairpin ribozyme can form an extended conformation (undocked state) or a bent con- formation (docked state). In the docked state, loops A and B come into close contact, forming the active site [21,22]. Most of the nucleotides in loops A and B are essential for catalysis [23]. Among them, adenine 38 has been identified as a key residue [24–28]. Structural and mechanistic studies have shown that divalent cations stabilize the hairpin ribozyme in its docked conformation, but do not participate directly in cataly- sis [29,30]. Indeed, hairpin ribozymes remain func- tional in reactions without divalent cations [29,31], excluding a catalytic requirement for metal-bound water or direct metal coordination to ribose or phos- phate oxygen atoms, and no metal ions have been found in the active site [25]. In a previous study, the effects of hydrostatic pres- sure on the catalytic activity of the minimal hairpin ribozyme were studied [32]. Several factors led us to use this methodology: First, pressure makes it possible to determine the thermodynamic constants of the reac- tion and the volume changes associated with it, allow- ing evaluation of the conformational modifications involved in the catalytic mechanism. Pressure revers- ibly modifies hydrophobic and ionic interactions, thus altering the solvation of the macromolecules. As a con- sequence, pressure modifies the equilibrium constant of a reaction if it is accompanied by a significant volume change (DV). It can also modify the kinetics of reac- tions that involve a significant activation volume (DV „ ). Therefore, DV and DV „ can be directly esti- mated by analyzing the variation of the reaction equi- librium and rate constants as a function of pressure. Second, the existence of contemporary life in extreme conditions, such as the volcanic deep-sea vents, provid- ing habitats for living cellular and viral species, encouraged us to focus on the activity and persistence of RNA under extreme conditions of hydrostatic pressure, osmotic pressure, and temperature [32,33]. Fig. 1. Wild-type and adenine-dependent hairpin ribozyme struc- tures. (A) Minimal wild-type self-cleaving hairpin ribozyme. (B) ADHR1. Both ribozymes contain four helices and two loops. The cleavage site in each hairpin ribozyme is indicated by an arrow. Nucleotides differing between the two hairpin ribozymes are indi- cated by black dots. 3¢-Extensions and 5¢-extensions added for hybridization with replication primers are shown in light type. M. Ztouti et al. Adenine-dependent ribozyme under pressure FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS 2575 Finally, the study of RNA under high hydrostatic pressure could help in the evaluation of the relevance of the RNA world hypothesis, in particular in the con- text of the extreme conditions of early life. In this regard, it is now proposed that life could have origi- nated around the deep-sea vents [34], although this is still a matter of controversy [35–37]. The high pressure in these environments could have enhanced some prim- itive reactions whose DV and DV „ would have been unfavorable. Compensatory effects between tempera- ture and pressure could have facilitated adaptation to these environments. The rich chemistry, temperature and high pressure prevailing around the deep-sea vents offer a plausible environment for the emergence of life [35]. High hydrostatic pressures (up to 200 MPa) were previously applied to the hairpin ribozyme, with the knowledge that the covalent bonds in nucleic acids are stable up to at least 1200 MPa, and are therefore not affected. The results obtained from experiments using hydrostatic and osmotic pressure showed that the cata- lytic process involves a transition state whose forma- tion is accompanied by a positive DV „ of 34 ± 5 mLÆmol )1 , associated with a release of 78 ± 4 water molecules per RNA molecule [32]. These results agree with the conclusion that the hairpin ribozyme must undergo an important conformational change that brings loops A and B into close contact. In the present work, and in order to obtain more information on the mechanism by which adenine restores the catalytic activity of ADHR1, we examined the influence of hydrostatic pressure (up to 150 MPa) on this hairpin ribozyme (Fig. 1B). Our results indicate that, as in the case of the wild-type hairpin ribozyme, the catalytic process involves a transition state whose formation is accompanied by an apparent positive DV „ and a release of water molecules. Unexpectedly, this apparent DV „ is not significantly reduced when ADHR1 is preincubated in the presence of Mg 2+ .In addition, competition experiments strongly suggest that adenine binds to ADHR1 at the site where the adenine of the wild-type ribozyme is present in the docked conformation. Results Self-cleavage activity of ADHR1 requires both adenine and Mg 2+ ADHR1 was obtained using the in vitro systematic evolution of ligands by exponential enrichment proce- dure, as described previously and summarized in Experimental procedures. Its self-cleavage activity is strictly dependent on adenine. However, its catalytic activity also requires Mg 2+ , as does that of the wild- type hairpin ribozyme. The respective roles of adenine and Mg 2+ remain to be elucidated. Figure 2 shows that a 10 min preincubation of ADHR1 with either adenine or MgCl 2 before the addition of the comple- mentary cofactor to the reaction mixture had no signif- icant effect on the kinetics of the self-cleavage reaction, although a very small increase in the reaction rate was observed when the two cofactors were added together. This indicates that both adenine and Mg 2+ must be present for the reaction to occur, and that the order of addition of the two cofactors does not signifi- cantly influence the reaction rate. Lack of influence of ADHR1 concentration on the rate of the ADHR1 cleavage reaction Before analyzing the effects of pressure on the self- cleavage reaction of ADHR1, it was verified that the kinetics of this reaction are independent of hairpin ribozyme concentration, as expected from a unimo- lecular intramolecular reaction without trans-reaction between two hairpin ribozyme molecules. For this purpose, the kinetics of the self-cleavage reaction 0 10 20 30 40 50 60 70 80 0 50 100 150 200 Cleavage (%) Time (min) Fig. 2. The self-cleavage kinetics of ADHR1 are independent of the order of addition of the cofactors adenine and Mg 2+ . The kinetics of self-cleavage of ADHR1 were analyzed after 10 min of preincu- bation with either adenine (d) or MgCl 2 (h) before starting the reaction by adding the complementary cofactor. These kinetics are not significantly different from those obtained when the two cofactors are added simultaneously (e). The curves were obtained by fitting the results to the expected exponential kinetics (Experimental procedures). Adenine-dependent ribozyme under pressure M. Ztouti et al. 2576 FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS were determined at atmospheric pressure with hairpin ribozyme concentrations from 0.5 to 1.5 lm. The results obtained (Fig. 3) indicated that the cleavage rate of ADHR1 was indeed independent of its con- centration over the range analyzed, as expected for an exponential equilibration. The following experi- ments were performed using 0.5 lm hairpin ribozyme. Effects of hydrostatic pressure on the rate of the ADHR1 self-cleavage reaction To determine whether the self-cleavage activity of ADHR1 is altered by pressure, as is the case for the wild-type hairpin ribozyme [32], the amounts of ADHR1 cleaved after 1 h of incubation in the pres- ence of 6 mm Mg 2+ and 6 mm adenine at various pressures up to 150 MPa were determined. Figure 4 shows that the amounts decreased regularly, indicating that pressure had an important negative effect on the rate of the reaction. This effect could result from a modification of the catalytic constant of the reaction, or of its equilibrium constant, or both. To distinguish between these possibilities, the kinetics of the reaction were followed at pressures ranging from 0.1 to 200 MPa over 6 h. The percentages of cleavage were determined (see Experimental procedures), and each curve was fitted to an exponential so as to extract the values of the rate constant and of the apparent equilib- rium. However, it is well established that Mg 2+ induces the docking of loops A and B for the struc- tural organization of the catalytic site, and in the case of the wild-type hairpin ribozyme, it was hypothesized that the apparent DV „ measured corresponds to both the volume change associated with the docking process and the strict DV „ of activation related to the forma- tion of the transition state. Upon addition of Mg 2+ alone, ADHR1 might condense into the closed confor- mation, even in the absence of adenine, which is then required for the reaction to occur. To answer this question, two different sets of experiments were con- ducted. In the first, ADHR1 was preincubated for 10 min with MgCl 2 before addition of adenine and application of pressure. In the second, ADHR1 was preincubated with adenine for 10 min before addition of MgCl 2 and application of pressure. The results obtained are shown in Figs 5 and 6. The fit of the kinetic data to the exponential equa- tion (Figs 5A and 6A) made it possible to estimate the rate (k obs ) at each pressure analyzed. This rate con- stant clearly decreased with increasing hydrostatic pressure, and the logarithm of this constant was then plotted as a function of pressure. For both sets of experiments, a linear decrease of the logarithm of the k obs with increasing pressure was observed (Figs 5B 0 10 20 30 40 50 60 70 80 0 50 100 150 200 250 300 350 400 Cleavage (%) Time (min) Fig. 3. Effect of the concentration of ADHR1 on the kinetics of the self-cleavage reaction. Kinetics of the ADHR1 self-cleavage reaction at atmospheric pressure and ribozyme concentrations of: d, 0.5 l M;+,1lM; e, 1.5 lM. 0 5 10 15 20 25 30 35 0 255075100125150 Cleavage (%) Pressure (MPa) Fig. 4. Effect of hydrostatic pressure on the self-cleavage activity. The fraction of cleaved ADHR1 after 1 h of incubation under increasing pressure (up to 150 MPa) is shown as function of the pressure applied. ADHR1 (0.5 l M) was incubated in the presence of 6 m M Mg 2+ and 6 mM adenine, as described in Experimental procedures. M. Ztouti et al. Adenine-dependent ribozyme under pressure FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS 2577 and 6B). Such a variation is characteristic of reactions involving a positive apparent DV „ that can be calcu- lated from the slope of the graphs. This gives activa- tion volumes of 26 ± 1.7 mLÆmol )1 for the first set of experiments (ADHR1 preincubated with MgCl 2 ) and 23±2mLÆmol )1 for the second set of experiments (ADHR1 preincubated with adenine). These values were very close to and slightly lower than that obtained in the case of the wild-type hairpin ribozyme (34 ± 5 mLÆmol )1 ). The values of the equilibrium constant K eq provided by the fit of the experimental data to an exponential process also showed a linear decrease in the logarithm of K eq with increasing pressure (Figs 5C and 6C). From the slope of these graphs, DV values of 16 ± 1.8 mLÆmol )1 and 14 ± 1 mLÆmol )1 were calcu- lated for the first and second set of experiments, respectively. These values were not significantly differ- ent from that obtained in the case of the wild-type hairpin ribozyme (17 ± 4.5 mLÆmol )1 ). Reversibility of the effects of hydrostatic pressure The decrease in the equilibrium constant reported above could result from some irreversible alterations of the RNA molecule. To check this possibility, we investigated the reversibility of the decrease of hairpin ribozyme activity observed at 150 MPa. The reaction was followed at this pressure for 3 h, the reaction mix- ture was then instantly brought back to atmospheric pressure, and the reaction was allowed to proceed for a further 3 h. The percentage of cleaved hairpin ribo- zyme was then plotted as a function of time. Figure 7 shows that, as soon as the reaction mixture was returned to atmospheric pressure, the reaction reached the rate observed at atmospheric pressure. Thus, the negative effects of pressures up to 150 MPa on the hairpin ribozyme activity were fully reversible. How- ever, the reaction rate appeared to be slightly higher than that of the control at atmospheric pressure, sug- gesting that preincubation at elevated pressure had a small favorable effect on the rate of the reaction. In 0 10 20 30 40 50 60 70 80 0 50 100 150 200 250 300 350 400 –6.5 –6 –5.5 –5 –4.5 0 20406080100120140160 ΔV # = 26 ± 1 mL·mol –1 –2 –1.5 –1 –0.5 0 0 20 40 60 80 100 120 140 160 ΔV = 16 ± 1 mL·mol –1 Time (min) Pressure (MPa) Pressure (MPa) Cleavage (%) In k obs In K eq A B C Fig. 5. Cleavage kinetics at various hydrostatic pressures of ADHR1 preincubated with MgCl 2 . (A) Cleavage kinetics are shown for the reaction conducted at atmospheric pressure (d), 25 MPa (h), 50 MPa (e), 75 MPa (·), 100 MPa (+), and 125 MPa (D). In these experiments, ADHR1 was brought to the indicated pressures after 10 min of preincubation with Mg 2+ , followed by the addition of adenine. (B) Logarithm of the observed cleavage rate (k obs )asa function of pressure. (C) Logarithm of the calculated equilibrium constant (K eq ) as a function of pressure. K eq was obtained from the exponential fit of the results (Experimental procedures) and corre- sponds to the cleaved ⁄ uncleaved RNA concentration ratio. Adenine-dependent ribozyme under pressure M. Ztouti et al. 2578 FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS any case, the negative effects of high pressures (up to 150 MPa) on the hairpin ribozyme activity were fully reversible. Change in equilibrium upon pressure variation The kinetics of the self-cleavage reaction under pres- sure reported above show a decrease of the apparent equilibrium constant of this reaction, corresponding to a positive DV. This variation of the apparent equilib- rium constant could result either from inactivation of the hairpin ribozyme under pressure (something that is unlikely on the basis of the results presented in the preceding section) or from re-equilibration of the reac- tion on the basis of the DV, the pressure increasing the rate of the ligation reaction. To test these possibilities, the cleavage reaction was followed at atmospheric pressure for 3 h, the pressure was then raised to 0 10 20 30 40 50 60 70 80 0 50 100 150 200 250 300 350 400 –6.5 –6 –5.5 –5 –4.5 0 20 40 60 80 100 120 140 160 –2 –1.5 –1 –0.5 0 0 20 40 60 80 100 120 140 160 Time (min) Pressure (MPa) Cleavage (%) In k obs In K eq ΔV ≠ = 23 ± 2 mL·mol –1 ΔV = 14 ± 1mL·mol –1 Pressure (MPa) A B C Fig. 6. Cleavage kinetics at various hydrostatic pressures of ADHR1 preincubated with adenine. (A) Cleavage kinetics are shown for the reaction conducted at atmospheric pressure (d), 25 MPa (h), 50 MPa (e), 75 MPa (·), 100 MPa (+), 125 MPa (D), and 150 MPa (r). In these experiments, ADHR1 was brought to the indicated pressures after 10 min of preincubation with adenine, fol- lowed by the addition of Mg 2+ . (B) Logarithm of the observed cleavage rate (k obs ) as a function of pressure. (C) Logarithm of the calculated equilibrium constant (K eq ) as a function of pressure. K eq was obtained from the exponential fit of the results (Experimental procedures), and corresponds to the cleaved ⁄ uncleaved RNA concentration ratio. 0 10 20 30 40 50 60 70 80 0 50 100 150 200 250 300 350 400 Cleavage (%) Time (min) Fig. 7. Reversibility of the effects of hydrostatic pressure on the catalytic activity of ADHR1. Cleavage kinetics are shown for the reaction at atmospheric pressure (d) and at 150 MPa (h). After 3 h of reaction under pressure, the reaction mixture was quickly brought to atmospheric pressure, and the reaction was followed for a further 3 h (e). M. Ztouti et al. Adenine-dependent ribozyme under pressure FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS 2579 150 MPa, and the reaction was followed for another 3 h (data not shown). A decrease in the equilibrium was observed, indicating that the ligation reaction pro- ceeded under pressure for the system to reach a new value of the equilibrium constant dictated by the DV of the reaction. However, the low extent of this pro- cess (about 20%), the existence of unexplained small oscillations upon application of the pressure and the rapid hydrolysis of the cyclic phosphate at the 2¢–3¢- end of the cleaved hairpin ribozyme [38] precluded study of the DV values associated with the ligation reaction. Influence of hydrostatic pressure on the Mg 2+ dependence of the ADHR1 self-cleavage reaction The catalytic activity of ADHR1 is Mg 2+ -dependent. Thus, the decrease in the rate constant of the self- cleavage reaction under pressure could result from a conformational change affecting the affinity of the hairpin ribozyme for Mg 2+ . To test this possibility, the Mg 2+ saturation curves of ADHR1 were deter- mined at atmospheric pressure (Fig. 8A) and at 75 MPa (Fig. 8B), in the presence of Mg 2+ concentra- tions ranging from 1 to 20 mm. It appears that these saturation curves are sigmoidal-like in the case of the wild-type hairpin ribozyme (Fig. 8C). Consequently, the curves were fitted to the Hill equation. This yielded Mg 2+ half-saturation concentrations of 10.7 ± 2 and 12.6 ± 2 mm, respectively, for the self-cleavage reaction at atmospheric pressure and at 75 MPa. The corresponding Hill coefficients were 1.8 ± 0.3 and 1.9 ± 0.4 respectively. These results indicate that the binding of the Mg 2+ was not significantly altered by pressure, either qualitatively or quantitatively. Influence of hydrostatic pressure on the adenine dependence of the ADHR1 self-cleavage reaction As described above, ADHR1 was selected on the basis of the strict dependence of its self-cleavage activity on 0 10 20 30 40 50 60 70 80 0 20 40 60 80 100 0 10 20 30 40 50 60 70 80 0 20 40 60 80 100 Atmospheric pressure 75 MPa pressure 0 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4 0 10152025 V i (picomole·min –1 ) Time (min) Cleavage (%) Time (min) Cleavage (%) Mgcl 2 (m M) 5 A B C Fig. 8. Influence of Mg 2+ concentration on the cleavage kinetics of ADHR1 under pressure. (A, B) The cleavage kinetics of ADHR1 were analyzed in the presence of increasing concentrations of MgCl 2 at atmospheric pressure (A) and at 75 MPa (B) in the pres- ence of 6 m M adenine. The MgCl 2 concentrations were: 3 mM (·), 6m M (h), 9 mM (s), 12 mM (n), 16 mM (+), and 20 mM (r). (C) The graphically determined initial rates of these reactions [atmo- spheric pressure (d ) and 75 MPa (h)] were plotted as a function of MgCl 2 concentration. The data were fitted to the Hill equation to determine the Mg 2+ half-saturation concentration and to evaluate the cooperativity of the binding of Mg 2+ to ADHR1. Adenine-dependent ribozyme under pressure M. Ztouti et al. 2580 FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS adenine. Therefore, the decrease in the reaction rate observed under pressure could result from a decrease in the affinity of ADHR1 for adenine. To examine this possibility, the adenine saturation curve was determined at atmospheric pressure and at 75 MPa. Figure 9A shows the variation of the reaction rate as a function of adenine concentration under these two conditions. The double reciprocal plots of these results (Fig. 9B) show that, although the reaction rate was nearly sixfold lower at 75 MPa than at atmospheric pressure, there was no significant difference in the affinity of the hairpin ribozyme for adenine between these two experimental conditions (3.8 ± 1 and 5.6 ± 2 mm respectively). Similar results were obtained when these experiments were conducted at higher pressures (data not shown). Thus, the decrease in the rate constant observed under pressure did not result from a decrease in the affinity of the hairpin ribozyme for adenine. Influence of osmotic pressure on the ADHR1 self-cleavage reaction The positive apparent activation volume detected in the hydrostatic pressure experiments indicates that the self-cleavage reaction involves a compaction, which should be accompanied by a decrease in the solvation of the molecule. To investigate this prediction, the effect of osmotic pressure on the kinetics of the self- cleavage reaction was examined. The ADHR1 cleavage rate was measured in the presence of increasing con- centrations of poly(ethylene glycol) 400, the agent used to increase the osmotic pressure in the solvent phase of the incubation mixture [39]. The results presented in Fig. 10A show that increasing concentrations of poly(ethylene glycol) 400 up to 10% increased the ADHR1 cleavage rate, confirming the release of water molecules during the reaction. From the variation of the reaction rate as a function of osmotic pressure (Fig. 10B), it can be calculated [39] that the formation of the transition state (probably including the domain closure) involved the release of 100 ± 18 water mole- cules per hairpin ribozyme molecule. Competition experiments Previous work showed that the specificity of adenine in restoring the catalytic activity of ADHR1 is rather loose [16], and that some adenine analogs, such as 6-methyladenine, purine, and even imidazole, can also confer activity to this modified hairpin ribozyme, although with slightly lower efficiency. Similarly, it was shown that 2,6-diaminopurine, isocytosine and 3-methyladenine could restore the activity of an inac- tive form of the hairpin ribozyme in which the essen- tial adenine 38 was deleted or replaced by an abasic analog [27]. It was observed that 2,6-diaminopurine was significantly more efficient than adenine in restor- ing the catalytic activity. In an attempt to obtain addi- tional information about the binding of adenine and some of its analogs to ADHR1, competition experi- ments were performed. ADHR1 was incubated in the presence of 6 mm Mg 2+ and in the presence of adenine or one of its analogs, either alone or in combination in I/V i (picomole·min –1 ) A B Fig. 9. Influence of adenine concentration on the cleavage kinetics of ADHR1 under pressure. The effect of adenine concentrations on the rate of the self-cleavage reaction of ADHR1 was analyzed at atmospheric pressure (d ) and under a pressure of 75 MPa (h)in the presence of 6 m M Mg 2+ . (A) The rates are shown here as a function of adenine concentration. (B) The Lineweaver–Burke plot was used to estimate the apparent K d values of adenine in the reaction at atmospheric pressure and at 75 MPa. These are, respectively. 3.8 ± 1 and 5.6 ± 2 m M. M. Ztouti et al. Adenine-dependent ribozyme under pressure FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS 2581 various proportions. It appeared that isocytosine did not reactivate ADHR1 (Fig. 11A), although it effi- ciently inhibited the cleavage reaction promoted by adenine. The Dixon plot obtained with the use of three adenine concentrations yielded a value of 38 ± 5 mm for the dissociation constant (K i ) of isocytosine (Fig. 11B). 3-Methyladenine did not either restore the activity of ADHR1 (Fig. 11C), but it also inhibited the adenine-dependent reaction, with a K i of 5±2mm (Fig. 11D). The Dixon plots also show the competitive nature of the inhibition by these two nucleobases (Fig. 11B,D). Regarding 2,6-diaminopurine, Fig. 12 shows that this adenine analog was about 30% more efficient than adenine in restoring the activity of ADHR1, and that the reactivation by these two com- pounds was not additive. When these two activators are added together in various proportions, the rate of the reaction lies between those observed in the pres- ence of either adenine or 2,6-diaminopurine alone, as predicted for a mechanism in which two activators bind competitively at the same site [40]. Taken together, these results indicate that adenine and its analogs bind competitively to the same site(s). The lin- earity of the Dixon plots suggests, in addition, that this site is unique. Discussion ADHR1 was obtained by a selection procedure aimed at identifying hairpin ribozymes whose catalytic activ- ity depends on exogenous adenine. In the present work, hydrostatic and osmotic pressures were used to analyze the catalytic mechanism of ADHR1 and com- pare it with that of the minimal wild-type hairpin ribo- zyme from which it was produced, in an attempt to obtain some information about the mechanism of reac- tivation of this modified hairpin ribozyme by adenine. This methodology allowed us previously to show that the reaction of the wild-type hairpin ribozyme involves an apparent DV „ of 34 ± 5 mLÆmol )1 , which was interpreted as resulting from both the docking of loops A and B and the formation of the transition state [32]. Consistent with this interpretation, osmotic pressure experiments showed that this process is accompanied by the release of 78 ± 4 water molecules per mole of RNA. Apparent volume of activation (DV „ ) To investigate the self-cleavage mechanism of ADHR1, two sets of experiments were conducted under hydro- static pressure. In the first set, ADHR1 was preincu- bated with MgCl 2 before addition of adenine and the application of pressure. In the second set, ADHR1 was preincubated with adenine, before addition of MgCl 2 and the application of pressure. In both cases, the analysis of the kinetics of the self-cleavage reaction indicates that, as in the case of the wild-type hairpin ribozyme, the reaction involves an apparent positive DV „ . Hence, the order of addition of adenine and MgCl 2 has no apparent effect on the docking of the modified hairpin ribozyme. Indeed, the DV „ values 0 5 10 15 20 25 30 35 40 0 10152025303540 1.5 × 10 –14 2 × 10 –14 2.5 × 10 –14 3 × 10 –14 3.5 × 10 –14 4 × 10 –14 13579 KT ln (k II /k o ) (dyne.cm) Slope = Δ V w Time (min) Cleavage (%) Posm (× 10 6 ) (dynes·cm –2 ) 5 2468 A B Fig. 10. Effect of osmotic pressure on the self-cleavage reaction. (A) Cleavage kinetics are shown for increasing concentrations of poly(ethylene glycol) 400 (v ⁄ v): 0% (d ), 2.5% (h), 5% (e), 7.5% (·), and 10% (+). (B) The number of water molecules released dur- ing the self-cleavage reaction was calculated from the slope of the variation of KT ln (k P ⁄ k O ) as a function of osmotic pressure. k P and k O are, respectively, the observed rate constants of the reaction under osmotic stress and standard conditions, K the Boltzmann constant, and T the absolute temperature [39]. Adenine-dependent ribozyme under pressure M. Ztouti et al. 2582 FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS calculated from these kinetic experiments are very similar (DV „ =26±2mLÆmol )1 and DV „ =23± 2mLÆmol )1 for the first and second sets of experi- ments, respectively). The fact that preincubation of ADHR1 with Mg 2+ does not decrease the apparent DV „ of the reaction was rather unexpected. As, in the case of the wild-type hairpin ribozyme, this DV „ was interpreted as corre- sponding to both the docking process and the forma- tion of the transition state, one could expect that preincubation of ADHR1 with Mg 2+ would have pro- moted docking and that, consequently, the reaction then initiated by the addition of adenine would have presented a significantly lower DV „ . Such is not the case, and several explanations can be proposed. In spite of its rather high value, the DV „ might corre- spond only to the formation of the transition state of the cleavage reaction. This would imply that, in the experiments performed with the wild-type ribozyme and ADHR1, this domain closure would be completed during the 1 min lag-time between the addition of MgCl 2 and the application of pressure. Alternatively, the docking process in ADHR1 could require the 0 2 4 6 8 10 –60 –40 –20 20 40 60 0 5 10 15 20 25 30 35 40 0 10203040506070 0 5 10 15 20 25 30 0 5 10 15 20 25 30 35 40 0 –60 –40 –20 20 40 600 0 10203040506070 Time (min) Time (min) Isocytosine (m M) 3-methyladenine (m M) Cleavage (%)Cleavage (%) I/V i (picomole·min) –1 I/V i (picomole·min) –1 A B C D Fig. 11. Competition experiments with the adenine analogs isocytosine and 3-methylad- enine. (A) The kinetics of the self-cleavage of ADHR1 were determined in the presence of increasing concentrations of isocytosine [0 m M (d), 1 mM (s), 5 mM (e), 20 mM (·), 50 m M (h)], in the presence of 6 mM ade- nine. A control experiment was performed in the presence of isocytosine alone ( ). (C) Identical experiments for 3-methyladenine, with control in the presence of 6 m M 3-methyladenine alone ( ). (B, D) Dixon plots of the competition experiments between adenine and isocytosine or 3-methyladenine: d,3m M adenine; r, 6m M adenine; s,10mM adenine. 0 10 20 30 40 50 60 02010 30 40 50 60 70 Time (min) Cleavage (%) Fig. 12. Competition experiments between adenine and 2,6-diamin- opurine. The kinetics of self-cleavage of ADHR1 were determined in the presence of increasing concentrations of 2,6-diaminopurine: 0m M (d), 1 mM (s), and 5 mM (e). The adenine concentration was kept at 6 m M. The kinetics of self-cleavage of ADHR1 were also determined at 6 m M 2,6-diaminopurine in the absence of adenine ( ). M. Ztouti et al. Adenine-dependent ribozyme under pressure FEBS Journal 276 (2009) 2574–2588 ª 2009 The Authors Journal compilation ª 2009 FEBS 2583 [...]... 2,6diaminopurine, which share the amidine group of adenine, restore the activity to abasic ribozyme variants lacking A3 8 Detailed analysis of the pH dependence of hairpin ribozymes variants with covalent substitutions indicates that the optimal cleavage and ligation reactions depend on the protonation state of A3 8 [27] Moreover, a recent study has analyzed the crystallographic structure of several hairpin. .. Experimental procedures Materials DNA primers were provided by Proligo (Evry, France) Taq DNA polymerase and PCR buffer were obtained from Invitrogen (Carlsbad, CA, USA), and dNTPs from Promega (Madison, WI, USA) T7 RNA polymerase, rNTPs and transcription buffer were obtained from Fermentas (St Leon-Rot, Germany) RNA preparation The sequence of primer P1 (promoter primer) is 5¢-TAATA CGACTCACTATAGGGTACGCTGAAACAGA-3¢,... self-cleavage catalytic activity of the hairpin ribozyme The selection procedure was designed to identify inactive hairpin ribozymes whose catalytic activity could be rescued by free exogenous adenine Its entire sequence is 5¢-CCTCCGAAACAGGACTGTCAGGGGG TACCAGGTAATGCATCACAACGTTTTCACGGTTGA TTCTCTGTTTCAGCGTACCC-3¢ The two primer binding regions are located in the 5¢-terminus and 3¢-terminus A 4 mL PCR reaction... hairpin ribozyme is formed by the interaction of loops A and B Three active site nucleobases located near the reactive phosphodiester, G8, A9 , and A3 8, appear to be directly involved in the catalytic chemistry In particular, structural analysis has shown that A3 8 contributes to the architecture of the active site through an array of stacking and hydrogen-bonding interactions [25,26,45,46] Functional... that this site is unique Similarly, it has been shown that some inactive forms of the hairpin ribozyme in which A3 8 was either deleted or replaced by abasic nucleotides can be reactivated by adenine analogs such as isocytosine, 3-methyladenine and 2,6-diaminopurine when these analogs are either added to the cleavage incubation medium or covalently incorporated in the modified hairpin ribozyme in place... to the 2586 exponential equation x ¼ xeq ð1 À eÀkobs t Þ, where xeq is the fraction of cleaved RNA at equilibrium, x the fraction of cleaved RNA at time t, and kobs the observed cleavage rate constant Keq was taken as the cleaved ⁄ uncleaved RNA concentration ratio The error bars applied to the rate constant values were calculated on the basis of three quantitative scans made on each of three independent... removed at various times ( 0–3 60 min), quenched, ice-stored, and analyzed as described below For technical reasons, it takes 1–2 min to fill the incubation chamber and apply the desired pressure Consequently, for the determination of the rate constants, the fraction of hairpin ribozyme cleaved before applying pressure was subtracted from all cleavage values so as to visualize only the catalytic activity... to ADHR1 was investigated by analyzing the self-cleavage reaction of the hairpin ribozyme at several concentrations of adenine and MgCl2, either at atmospheric pressure or under a hydrostatic pressure of 75 MPa The percentage of cleavage for each experimental condition was then plotted as a function of time, and the kinetics were fitted to the exponential equation described above, allowing the estimation... nucleobase variations at key active site residue Ade38 in the hairpin ribozyme RNA 14, 160 0–1 616 48 Nam K, Gao J & York DM (2008) Electrostatic interactions in the hairpin ribozyme account for the majority of the rate acceleration without chemical participation by nucleobases RNA 14, 150 1–1 507 49 Walter NG (2007) Ribozyme catalysis revisited: is water involved? Mol Cell 28, 92 3–9 29 ´ 50 Hui Bon Hoa GH, Hamel... circularization of ‘minimonomer’ RNAs derived from the complementary strand of tobacco ringspot virus satellite RNA Nucleic Acids Res 21, 199 1–1 998 22 Komatsu Y, Kanzaki I, Koizumi M & Ohtsuka E (1995) Construction of new hairpin ribozymes with replaced domains Nucleic Acids Symp Ser 34, 22 3–2 24 23 Siwkowski A, Shippy R & Hampel A (1997) Analysis of hairpin ribozyme base mutations in loops 2 and 4 and . 5¢-TAATA CGACTCACTATAGGGTACGCTGAAACAGA-3¢, and that of primer P2 (reverse primer) is 5¢-CCTCCGAA ACAGGACTGTCAGGGGGTACCAG-3¢. The 85-nucleo- tide template. rescued by free exogenous adenine. Its entire sequence is 5¢-CCTCCGAAACAGGACTGTCAGGGGG TACCAGGTAATGCATCACAACGTTTTCACGGTTGA TTCTCTGTTTCAGCGTACCC-3¢. The two primer