MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-jB1 Li-Min Guo*, Yong Pu*, Zhe Han*, Tao Liu, Yi-Xuan Li, Min Liu, Xin Li and Hua Tang Tianjin Life Science Research Center and Basic Medical School, Tianjin Medical University, China Introduction Ovarian cancer remains a leading cause of morbidity and mortality, with little change in survival rates over the past 30 years. Previous studies have revealed sev- eral genes related to human ovarian cancer [1], but the common molecular mechanisms of ovarian cancer remain to be elucidated. Although focusing on known genes has already yielded new information, previously unknown noncoding RNAs, such as microRNAs (miRNAs), may also lend insight into the biology of ovarian cancer. Since their discovery [2–5], miRNAs have emerged as integrated and important post-tran- scriptional regulators of gene expression in animals and plants [6,7]. MicroRNAs are 21-23-nucleotide regulatory RNAs processed from 70–100-nucleotide hairpin pre-miRNAs. Their 5¢-end binds to a target complementary sequence in the 3¢-UTR of mRNA and, given the degree of complementarity, miRNA binding appears to result in translational repression, or in some cases, cleavage of cognate mRNAs, caus- ing partial or full silencing of the respective protein coding genes. As a new layer of gene-regulation mechanism, miRNAs have diverse functions, includ- ing the regulation of cellular differentiation, prolifera- tion and apoptosis, as well as cancer initiation and progression [8,9]. Indeed, a number of studies have reported differentially regulated miRNAs in diverse cancer types such as breast cancer [10], lung cancer [11], chronic lymphocytic leukemia [12], colon cancer Keywords cell growth; miR-9; NF-jB1; ovarian cancer; target gene Correspondence H. Tang, Tianjin Life Science Research Center and Basic Medical School, Tianjin Medical University, Tianjin 300070, China Fax: +86 22 2354 2503 Tel: +86 22 2354 2503 E-mail: htang2002@yahoo.com *These authors contributed equally to this work (Received 21 January 2009, revised 18 July 2009, accepted 24 July 2009) doi:10.1111/j.1742-4658.2009.07237.x MicroRNAs are emerging as important regulators of cancer-related pro- cesses. Our studies show that microRNA-9 (miR-9) is downregulated in human ovarian cancer relative to normal ovary, and overexpression of miR-9 suppresses cell growth in vitro. Furthermore, the 3¢-UTR of NF-jB1 mRNA is found to be regulated directly by miR-9, demonstrating that NF-jB1 is a functionally important target of miR-9 in ovarian cancer cells. When miR-9 is overexpressed in ovarian cancer cells, the mRNA and protein levels of NF-jB1 are both suppressed, whereas inhibition of miR-9 results in an increase in the NF-jB1 expression level. Ovarian cancer tissues display significantly low expression of miR-9 and a high level of NF-jB1 compared with normal tissues, indicating that regulation of NF-jB1 by miR-9 is an important mechanism for miR-9 to inhibit ovarian cancer proliferation. Abbreviations ASO, antisense oligonucleotide; EGFP, enhanced green fluorescence protein; miR-9, microRNA-9; miRNA, microRNA; MTT, 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; NF-jB, nuclear factor of kappaB. FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS 5537 [13], thyroid carcinoma [14] and pancreatic cancer [15]. During tumorigenesis and development, overexpres- sed miRNAs may potentially target tumor suppressor genes, whereas downregulated miRNAs would theoret- ically regulate oncogenes. For example, the let-7 miR- NAs, which have low expression in lung cancer, can negatively regulate the oncogenes RAS [16] and HMGA2 [17], resulting in the upregulation of these oncogenes. Conversely, miR-27a, which is highly expressed in gastric adenocarcinoma and breast cancer, acts as an oncogene by downregulating tumor suppres- sor genes [18,19]. These facts indicate that miRNAs may play a critical role in cancer-related processes. Here, we elucidate a general reduction in miR-9 level in ovarian cancer tissues compared with normal tis- sues. In ovarian cancer cell line ES-2, overexpression of miR-9 could suppress cell growth, which showed a dose-dependent effect. Subsequent experiments con- firmed that nuclear factor jB1 (NF-jB1) was a target of miR-9 and was downregulated by miR-9 at both the transcriptional level and the translational level. These results suggest that regulation of NF-jB1 by miR-9 is a mechanism by which miR-9 may inhibit ovarian cancer proliferation. Results miR-9 is downregulated in ovarian cancer cells Currently, almost all of the miRNA-related studies on cancers are based on the different expression profile of miRNAs in cancer cells versus normal cells. Thus, methods used to detect mRNA expression can also be used in studies on the potential roles of miRNAs in cancers [20] and a recent study reported that miR-9 may be of potential importance as biomarker in recur- rent ovarian cancer. Results show that miR-9 was downregulated in recurrent cancers [21]. We were therefore led to ask whether miR-9 was downregulated in ovarian cancer relative to normal ovary. Using real- time RT-PCR, we compared miR-9 expression profiles between four pairs of ovarian cancers and normal ovarial tissues. As a result, miR-9 showed on average 0.3-fold lower expression in ovarian cancer tissues than in normal ovarial tissues (Fig. 1), suggesting that miR-9 was downregulated in ovarian cancers. Overexpression of miR-9 suppresses cell growth in vitro Previous studies have indicated that miR-9 is seen to be markedly downregulated in ovarian cancers, and may function as a tumor suppressor gene. Thus, we tested whether overexpression of miR-9 in ES-2 cells could affect cell growth. In a 3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay, cells transfected with miR-9 expression vector pcDNA3B ⁄ pri-iR-9 were found to grow more slowly than the control group, with an inhibition of  30% (Fig. 2A). Moreover, as the concentration of pcDNA3B ⁄ pri-miR-9 increased in transfection, cell proliferation activity showed a gradual decrease, indi- cating the dose-dependent effect of miR-9 on the inhi- bition of cell proliferation (Fig. 2B). We also found that overexpression of miR-9 suppressed cell growth in a time-dependent manner. Although there was no dif- ference between control and pcDNA3B ⁄ pri-miR-9 groups during the first 2 days after transfection, exoge- nously expressed miR-9 in ES-2 cells caused a 20% reduction in cell proliferation at 72 h after transfection (Fig. 2C). These results indicated that the expression level of miR-9 had an influence on cell growth. To fur- ther validate the antiproliferative effect of miR-9 on the growth of ES-2 cells, a colony formation assay was performed. It was shown that the colony number of ES-2 cells transfected with pcDNA3B ⁄ pri-miR-9 was significantly lower than those transfected with control vector (Fig. 2D). The dramatic contrast in colony formation activity indicated that overexpression of miR-9 could suppress the colony formation activity of ES-2 cells. These results were consistent with the MTT assay and further suggested that overexpression of miR-9 suppresses cell growth in vitro. Fig. 1. Dysregulation of miR-9 in ovarian cancer tissues. The miR-9 expression level of four pairs of human ovarian cancer tissue sam- ples (Ca) and four matched normal ovarial tissue samples (N) was detected by real-time RT-PCR. The relative expression of miR-9 was defined as: quantity of miR-9 ⁄ quantity of U6 in the same sam- ple. The expression of normal ovarian samples was regarded as the normalizer and the relative miR-9 quantity (mean ± SD) are shown (*P < 0.05). MiR-9 inhibits ovarian cancer cell growth L M. Guo et al. 5538 FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS NF-jB1 is a candidate target of miR-9 According to the above data, we hypothesized that miR-9 might inhibit the malignant phenotype of ovar- ian cancer cells by regulating oncogenes and ⁄ or genes that control cell proliferation or apoptosis [20]. Thus, to investigate how miR-9 operates during the progres- sion of ovarian cancer, we tried to search for the target genes of miR-9. The gene that was predicted by all the three algorithm programs (pictar, targetscan and mirbase targets) was chosen as the candidate target of miR-9. Among these genes, NF-jB1, a transcription regulator that is involved in a wide variety of biologi- cal functions, was found to have a putative miR-9 binding site within its 3¢-UTR. We therefore chose it for further research. NF-jB1 gene 3¢-UTR carries a putative miR-9 binding site and is negatively regulated by miR-9 It is well known that miRNAs cause mRNA cleavage or translational repression by forming imperfect base pairing with the 3¢-UTR of target genes. Further- more, the 2–8 nucleotides of miRNA, known as the ‘seed region’, are suggested to be the most important factor for target recognition [22]. Therefore, we pre- dicted that NF-jB1 mRNA 3¢-UTR might contain a miR-9 binding site, which was reversed complemen- tary with the miR-9 ‘seed region’. With the help of the TargetScan database, we found a binding site for miR-9 in NF-jB1 mRNA 3¢-UTR (Fig. 3A). To con- firm that miR-9 can bind to this region and cause translational repression, we constructed an enhanced green fluorescence protein (EGFP) reporter vector. ES-2 cells were transfected with the reporter vector along with pcDNA3B ⁄ pri-miR-9 or control vector. As a result, the intensity of EGFP fluorescence in pcDNA3B ⁄ pri-miR-9-treated cells is significantly lower than that in the control vector group (Fig. 3B). Similarly, we constructed another EGFP reporter vec- tor containing the mutational NF-jB1 3¢-UTR (Fig. 3A). It was shown that overexpression of miR-9 could not affect the intensity of EGFP fluorescence in this 3¢-UTR mutant vector (Fig. 3C). These facts sug- gested that miR-9 may bind directly to the 3¢-UTR of NF-jB1 mRNA and repress gene expression. These data highlight the prediction that NF-jB1 is a direct target for miR-9. Fig. 2. Overexpression of miR-9 suppresses cell growth in vitro. (A) Cell growth was measured using the 3-(4,5-dimethylthiazol-2- yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay. ES-2 cells were transfected with pcDNA3B ⁄ pri-miR-9 (Pri-miR-9) or control vector (Ctrl) and at 72 h post transfection the MTT assay was performed. The histo- gram shows mean (± SD) of A n from three independent experiments (*P < 0.05). (B) A gradually increased concentration of pcDNA3B ⁄ pri-miR-9 (pri-miR-9) from 0 to 15 ngÆlL )1 was transfected into ES-2 cells and the dose-dependent anti-proliferative effects were detected using the MTT assay. (C) ES-2 cells were transfected with pcDNA3B ⁄ pri-miR-9 and he MTT assay was used to determine relative cell growth activ- ity at 24, 48 and 72 h. (D) The effect of miR-9 on cell proliferation was evaluated using a colony formation assay. ES-2 cells were transfected with pcDNA3B ⁄ pri-miR-9 (Pri-miR-9) or control vector (Ctrl) at a final concentration of 10 ngÆlL )1 and then seeded in 12-well plates. The number of colonies was counted at the sixth day after seeding and the colony formation rate was calculated (*P < 0.05). L M. Guo et al. MiR-9 inhibits ovarian cancer cell growth FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS 5539 MiR-9 regulates NF-jB1 mRNA and protein expression in ES-2 cells miRNAs may suppress the expression of target genes through translational repression or degradation of a target’s transcript. To assess whether miR-9 had a functional role in the downregulation of endogenous NF-jB1 expression, ES-2 cells were transfected with the miR-9 blockage, known as miR-9 antisense oligonucleo- tide (ASO) or pcDNA3B ⁄ pri-miR-9 to alter the miR-9 expression level; the NF-jB1 mRNA level was measured by real-time RT-PCR. As a result, when miR-9 was blocked, NF-j B1 mRNA was elevated compared with the control group, with an 80% increase (Fig. 4A). Conversely, when miR-9 was enhanced, NF-jB1 mRNA showed a 30% decrease compared with the control group (Fig. 4B), indicating that miR-9 could downregulate the endogenous NF-jB1 mRNA level. Furthermore, the effects of miR-9 on NF-jB1 protein expression in ES-2 cells were examined using a western blot assay. It was shown that knockdown of miR-9 enhanced NF-jB1 protein expression, including its cytoplamsic precursor p105 and corresponding process- ing product p50 (Fig. 4C). By contrast, overexpression of miR-9 reduced the NF-jB1 protein level (Fig. 4D). These results demonstrated that miR-9 regulates endog- enous NF-jB1 expression through both the mRNA degradation and translational repression pathways. To confirm the validity of miR-9 blocking or over- expression, we checked the expression level of miR-9 using real-time RT-PCR, and found that when ES-2 cells were transfected with miR-9 ASO, the miR-9 level was decreased 60% (Fig. 4E). Conversely, the miR-9 level in pcDNA3B ⁄ pri-miR-9 transfected ES-2 cells was enhanced 5.05-fold in contrast to the control group (Fig. 4F). These data indicated that miR-9 was indeed altered by the blockage or the expression vector. NF-jB1 is overexpressed in ovarian cancer tissues Given that miR-9 is downregulated in ovarian cancer and that NF-jB1 is a target of miR-9, we hypothesized that NF-jB1 might be overexpressed in ovarian cancer tissues relative to normal tissues. A real-time RT-PCR assay was used to detect the NF-jB1 profile in four pairs of ovarian cancer tissue samples and normal ovarian tissue samples. As a result, NF-jB1 mRNA had on average 1.96-fold higher expression in ovarian cancer tissues than in normal ovarial tissues (Fig. 5), which is consistent with the dysregulation of miR-9 in ovarian cancer. Fig. 3. Validation of NF-jB1 as the target of miR-9 by fluorescent reporter assay. (A) As predicted in the TargetScan database, the NF-jB1 3¢-UTR carries a miR-9 binding site. The NF-jB1 3¢-UTR mutation containing a mutated miR-9 ‘‘seed region’ binding site is shown. Arrows indicate the mutated nucleotides. (B) ES-2 cells were transfected with the pcDNA3 ⁄ EGFP-NF-jB1 3¢-UTR reporter vector (EGFP-NF-jB1 3¢-UTR) and pcDNA3B ⁄ pri-miR-9 (Pri-miR-9) or control vector. Cells were lysed at 72 h after transfection and the intensity of EGFP fluores- cence was detected. The RFP expression vector pDsRed2-N1 was spiked in and used for normalization (*P < 0.05). (C) ES-2 cells were transfected with the pcDNA3 ⁄ EGFP-NF-jB1 3¢-UTR mutation reporter vector (EGFP-NF-jB1 3¢-UTR mutant) as well as pcDNA3B ⁄ pri-miR-9 (Pri-miR-9) or control vector and the fluorescent intensity was detected (**P > 0.05). MiR-9 inhibits ovarian cancer cell growth L M. Guo et al. 5540 FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS Knockdown of NF-jB1 inhibits ES-2 cells growth in vitro An abundance of data indicates that the IjB kinase and NF-jB subunits can act to promote tumorigenesis, and NF-jB functions as a tumor promoter [23]. Hence, we tested whether knockdown of NF-jB1 affects cell growth. The siRNA expression vector pSilencer ⁄ si-NF- jB1 was constructed, and by transfection with pSilencer ⁄ si-NF-jB1, the endogenous NF-jB1 expression was effectively suppressed, with a 50% decrease for P105 and a 40% decrease for P50 (Fig. 6A) Next, pSilencer⁄ si-NF- jB1 was transiently transfected into ES-2 cells and cell growth activity was detected using a MTT assay. It was indicated that knockdown of NF-jB1 suppressed cell growth in a time-dependent manner. A significant reduc- tion in cell proliferation was found at 72 h post transfec- tion, with  20% inhibition (Fig. 6B), similar to the effect of pri-miR-9 on ovarian cell growth (Fig. 2C). These results are consistent with the finding that overex- pression of miR-9 suppresses cell growth in vitro, provid- ing further evidence that NF-jB1 is involved in miR-9- mediated suppression of ovarian cancer. Accordingly, identification of NF-jB1 as a miR-9 target gene may explain, at least in part, why overexpression of miR-9 suppresses cell growth. Fig. 4. MiR-9 regulates NF-jB1 at transcrip- tional and translational level. (A,B) Large RNA was extracted from ES-2 cells trans- fected with miR-9 ASO [anti-(miR-9)] or control oligonucleotides (Ctrl); pcDNA3B ⁄ pri-miR-9 (Pri-miR-9) or control vector (Ctrl), and the NF-jB1 mRNA level was measured by real-time RT-PCR. b-actin mRNA was regarded as the endogenous normalizer. The relative NF-jB1 expression level (mean ± SD) is shown (*P < 0.05). (C,D) Protein was extracted from ES-2 cells trans- fected with miR-9 ASO [anti-(miR-9)] or control oligonucleotides (Ctrl); pcDNA3B ⁄ pri-miR-9 (Pri-miR-9) or control vector (Ctrl), and the NF-jB1 protein level was measured by western blotting. GAPDH protein was regarded as the endogenous normalizer and the relative NF-jB1 protein level is shown (*P < 0.05). (E,F) Small RNA was extracted from ES-2 cells transfected with miR-9 ASO [anti-(miR-9)] or control oligonucleotides (Ctrl); pcDNA3B ⁄ pri-miR-9 (Pri-miR-9) or con- trol vector (Ctrl), and the expression of miR-9 was measured by real-time RT-PCR. U6 snRNA was regarded as the endogenous normalizer and the relative miR-9 expression level (mean ± SD) is shown (*P < 0.05). L M. Guo et al. MiR-9 inhibits ovarian cancer cell growth FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS 5541 Discussion miRNA expression correlates with various cancers, and miRNAs are thought to function as either tumor suppressors or oncogenes. A recent study reported that miR-9 may be of potential importance as a biomarker in recurrent ovarian cancer. Expression of 180 miR- NAs was detected in primary and recurrent serous papillary adenocarcinomas, and the result showed that miR-9 was downregulated in recurrent cancers [21]. In early breast cancer development, miR-9 was also trans- criptionally downregulated in a methylation-dependent way [24]. Previous studies led us to ask whether miR-9 was dysregulated in ovarian cancer compared with normal ovary [25]. Given that miR-9 has a lower expression level in cancer cells, we used a gain-of-function approach by transfecting the ovarian cancer cell line ES-2 with miR-9 expression vector pcDNA3B ⁄ pri- miR-9. In the MTT assay, overexpression of miR-9 resulted in cell growth arrest, which showed dose- dependent and time-dependent effects. In addition, col- ony formation is typical of malignant transformed cells, and is inconspicuous in normal cells. Using a colony formation assay, we found that the colony for- mation activity of ES-2 cells transfected with pcDNA3B ⁄ pri-miR-9 was significantly suppressed. Also, we tend to believe that miR-9 affects ovarian cell growth activity over the long term, because the inhibi- tion rate of pri-miR-9 in the MTT assay was not as significant as in the colony formation assay. These experiments indicated that miR-9 overexpressed ovar- ian cancer cells showed a suppression of malignant phenotypes, suggesting the role of miR-9 in the growth inhibition of malignant cells. The fundamental function of miRNA is to regulate their targets by direct cleavage of the mRNA or by inhibition of protein synthesis, according to the degree of complementarity with their target 3¢-UTRs. Identifi- cation of miRNA target genes has been a great Fig. 5. Dysregulation of NF-jB1 in ovarian cancer tissue samples. The NF-jB1 expression level in the four pairs of human ovarian can- cer tissue samples (Ca) and matched four normal ovarial tissue samples (N) was detected by real-time RT-PCR. b-actin mRNA was regarded as the endogenous normalizer and the relative NF-jB1 expression level (mean ± SD) is shown (*P < 0.05). Fig. 6. Knockdown of NF-jB1 inhibits growth of ES-2 cells in vitro. (A) The validity of pSilencer ⁄ si-NF-jB1 (si-NF-jB1) was examined in ES-2 cells by western blotting with anti-(NF-jB1) serum and the relative protein level is shown (*P < 0.05). (B) Knockdown of NF-jB1 suppresses cell growth in a time-dependent manner. Growth of ES-2 cells transfected with pSilencer ⁄ si-NF-jB1 (si-NF-jB1) showed a 20% reduction at 72 h post-transfection. Values are means ± SD of three independent experiments and the relative cell growth activity is shown (*P < 0.05). MiR-9 inhibits ovarian cancer cell growth L M. Guo et al. 5542 FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS challenge. Computational algorithms have been the major driving force in predicting miRNA targets, which are based mainly on base pairing of miRNA and target gene 3¢-UTR [26–28]. According to the pre- diction result, NF-jB1 is found to have a putative miR-9 binding site within its 3¢-UTR; we therefore chose it for further research. An effective method to identify the direct targets of miRNAs is the fluorescent reporter assay. We used an EGFP-NF-jB1 3¢-UTR reporter vector in the fluores- cent report assay and found a decrease in EGFP inten- sity following overexpresstion of miR-9. Furthermore, when another reporter vector containing a mutational miR-9 ‘seed region’ binding site was used in the fluorescent reporter assay, overexpresstion of the miR-9-mediated fluorescent decrease could no longer be detected. These results suggested that miR-9 can bind directly to the NF-jB1 3¢-UTR and negatively regulate NF-jB1 gene expression. In addition, using quantitative RT-PCR and western blotting, we con- firmed that overexpression of miR-9 could cause the decrease in NF-jB1 mRNA and protein levels, whereas inhibition of miR-9 results in an increase in NF-jB1 expression levels. Furthermore, NF-jB1 displayed a higher expression level in ovarian cancer tissues com- pared with normal ovary, which is consistent with the dysregulation of miR-9 in ovarian cancer. These data indicated that NF-jB1 is a direct target of miR-9. According to existing research, NF-jB transcription factors can both induce and repress gene expression by binding to discrete DNA sequences, known as jB ele- ments, in promoters and enhancers. In mammalian cells, there are five NF-jB family members, RelA (p65), RelB, c-Rel, p50 ⁄ p105 (NF-jB1) and p52 ⁄ p100 (NF-jB2), and different NF-jB complexes are formed from their homodimers and heterodimers. In most cell types, NF-jB complexes are retained in the cytoplasm by a family of inhibitory proteins known as inhibitors of NF-jB(IjB). Activation of NF-jB typically involves the phosphorylation of IjBbyIjB kinase complex, which results in IjB degradation. This releases NF-jB and allows it to translocate freely to the nucleus [29]. An abundance of data indicates that the IjB kinases and NF-jB subunits can act to promote tumorigenesis, and this subject has been extensively reviewed else- where [30]. Briefly, the pro-oncogenic effect of NF-jB can be thought of as arising from the overproduction of its normal target genes as a consequence of its chronic activation and nuclear localization in tumor cells. For example, NF-jB can stimulate tumor cell survival through the continual induction of anti-apop- totic genes such as Bcl-xL, X-IAP, cIAP1 and cIAP2, and A20[31]. Through this antiapoptotic activity, NF-jB can also reduce the effectiveness of many common cancer therapies, which themselves activate NF-kB. By regulating gene expression, NF-jB can also promote other oncogenic processes including tumor cell proliferation through its ability to induce proto- oncogenes such as cyclin D1 and c-Myc, metastasis through its ability to induce the expression of cellular adhesion molecules and matrix metalloproteinases, angiogenesis through the regulation of vascular endo- thelial growth factor and cell immortality through reg- ulating telomerase. Finally, in some model systems, NF-jB provides the critical link between tumor devel- opment and chronic inflammation, a process thought to be the basis of up to 20% of human cancers. It is not difficult to see that any pathway affecting the expression level or transcriptional activity of NF-jB can also alter the oncogenic activity of NF-jB. Our research validated the upregulation of NF-jB in ovar- ian cancer by quantitative RT-PCR, which may pro- mote the oncogenic activity of NF-jB and contribute to tumorigenesis. Because NF-jB1 is a target gene of miR-9, suppression of miR-9 may account for the overexpression of NF-jB1 in ovarian cancer, although other mechanisms cannot be excluded. In conclusion, miR-9 displays a low level in ovarian cancer tissues compared with normal ovarian tissues, and overexpression of miR-9 represses cell growth. A new target gene of miR-9, NF-jB1, was found to be upregulated in ovarian cancer tissues. These findings indicate that inhibition of miR-9 in ovarian cancer may contribute to the malignant phenotype by main- taining a high level of NF-jB1. Thus, the identification of miR-9 and its target gene, NF-jB1, in ovarian can- cer may help us to understand the potential molecular mechanism of tumorigenesis, and may have diagnostic and therapeutic value in the future. Materials and methods Materials Four pairs of ovarian tissues, including four human ovarian cancer tissues and the matched normal ovarial tissues from the same patient, were used in this study. The normal ovar- ian tissues were the distal end of the operative excisions far away from the tumors. The samples were received from the Tumor Bank Facility of Tianjin Medical University Cancer Institute and Hospital and National Foundation of Cancer Research. All of the samples were obtained with patients’ informed consent and were confirmed by the pathologic analysis. Large and small RNA of tissue samples was extracted and purified using mirVanaÔ miRNA Isolation L M. Guo et al. MiR-9 inhibits ovarian cancer cell growth FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS 5543 Kit (Ambion, Austin, TX, USA) according to manufac- turer’s instructions. Cell culture Human ovarian cancer cell line ES-2 was grown in RPMI 1640 (GIBCO BRL, Grand Island, NY, USA) supple- mented with 10% fetal bovine serum, 100 UÆmL )1 penicillin and 100 lgÆmL )1 streptomycin, and incubated at 37 °Cina humidified chamber supplemented with 5% CO 2 . Construction of expression vectors To construct the miR-9 expression vector pcDNA3B ⁄ pri- miR-9, we first modified pcDNA3 by mutating the BglII site outside the mutiple cloning site, then amplified a 386 bp DNA fragment carrying pri-miR-9 from genomic DNA using PCR primers miR-9-sense, 5¢-CGG AGAT CTTTTCTCTCTTCACCCTC-3¢, and miR-9-antisense, 5¢- CAA GAATTCGCCCGAACCAGTGAG-3¢. The amplified fragment was cloned into modified pcDNA3 at BamHI and EcoRI sites. To construct the siRNA expression vector pSi- lencer ⁄ si-NF-jB1, an  70 bp double-stranded si-NF-jB1 was obtained by annealing using two single-strands NF- jB1-Top, 5¢-GATCCCGCCTGAACAAATGTTTCATTTG GTCAAGAGCCAAATGAAACATTTGTTCAGGCTTTG GAAA-3¢; and NF-jB1-Bot, 5¢-AGCTTTTCCAAAAAA GCCTGAACAAATGTTTCATTTGGCTCTTGACCAAA TGAAACATTTGTTCAGGCGG-3¢, and then cloned into pSilencer 2.1 neo vector (Ambion). Annealing was per- formed as: 95 °C for 5 min and room temperature for 2 h. Transfection Transfection was performed with Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. Briefly, cells were seeded in plates the day before transfection to ensure a suitable cell conflu- ent on the day of transfection. pcDNA3B ⁄ pri-miR-9 or pSilencer ⁄ si-NF-jB1 and respective control vectors were used at 5 ngÆlL )1 , and miR-9 ASO (5¢-TCATAC AGCTAGATAACCAAAGA-3¢) or control oligonucleo- tides (5¢-GTGGATATTGTTGCCATCA-3¢) were used at 200 nm for each transfection in antibiotic-free Opti-MEM medium (Invitrogen). Transfection efficiency was monitored by Cy5-oligonucleotide and spiking RFP-expressing vector when necessary. Cell proliferation assay Cells were seeded in 96-well plate at 4000 cells per well the day before transfection and then transfected with pcDNA3B ⁄ pri-miR-9 or control vector as mentioned above. Furthermore, to detect the dose-dependent effect, we gradually increased quantity of pcDNA3B ⁄ pri-miR-9 from 0 to 15 ngÆlL )1 . And to examine the time-dependent effect of pSilencer ⁄ NF-jB1 on ES-2 cells, we detected via- ble proliferation cells 24, 48 and 72 h after transfection respectively. MTT assay was used to detect viable prolifera- tion cells. The absorbance at 570 nm (A 570 ) was detected using lQuant Universal Microplate Spectrophotometer (Bio-tek Instruments, Winooski, VT, USA). Colony formation assay After transfection, cells were counted and seeded in 12-well plates in triplicate at 100 cellsÆwell )1 . Fresh culture medium was replaced every 3 days. The colony was counted only if it contained > 50 cells, and the number of colonies was counted from the sixth day after seeding. The rate of col- ony formation was calculated with the equation: colony formation rate = (number of colonies ⁄ number of seeded cells) · 100%. Bioinformatics method The miRNA targets predicted by computer-aided algorithms were obtained from pictar (http://pictar.mdc-berlin.de/cgi- bin/new_PicTar_vertebrate.cgi), targetscan (http://www. targetscan.org) and mirbase targets (http://microrna. sanger.ac.uk/cgi-bin/targets/v5/search.pl). Fluorescent report assay The EGFP expression vector pcDNA3 ⁄ EGFP was con- structed as previously described [18]. The 3¢-untranslated mRNA sequences of NF-jB1 containing the miR-9 binding site were amplified by PCR using the following primers: NF- jB1 sense, 5¢-CCG GGATCCGCAAACTCAGCTTTAC-3¢; and NF-jB1 antisense, 5¢-CG GAATTCGTGGCGACCGT GATACC-3¢. PCR products were cloned into pcDNA3 ⁄ EGFP at BamHI and EcoRI sites. Moreover, the fragment of NF-jB1 3¢-UTR mutant, which contained a mutational miR-9 binding site, was amplified using PCR site-directed mutagenesis and cloned into pcDNA3 ⁄ EGFP at the same sites. The two more primers carrying the mutated NF-jB1 3¢-UTR fragment were used in the mutagenesis: NF-jB1 MS, 5¢-CACCGTGTAAAGCATACCCCTAAAATTC-3¢; and NF-jB1 MA, 5¢-GAATTTTAGGGGTATGCTTTA CACGGTG-3¢. ES-2 cells were transfected with pcDNA3B ⁄ pri-miR-9 or control vector, miR-9 ASO or control oligonucleotides at 24-well plate, and then with the reporter vector pcDNA3 ⁄ EGFP-NF-jB1 3¢-UTR or pcDNA3 ⁄ EGFP-NF- jB1 3¢-UTR mutant on the next day. The RFP expression vector pDsRed2-N1 (Clontech, Mountain View, CA, USA) was spiked in and used for normalization. The cells were lysed with radioimmunoprecipitation assay lysis buffer MiR-9 inhibits ovarian cancer cell growth L M. Guo et al. 5544 FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS (150 mm NaCl, 50 mm Tris ⁄ HCl, pH 7.2, 1% Triton X-100, 0.1% SDS) 72 h later and the proteins were har- vested. The intensities of EGFP and RFP fluorescence were detected with Fluorescence Spectrophotometer F-4500 (HITACHI, Tokyo, Japan). Real-time RT-PCR Small RNA (5 lg) was reverse transcribed to cDNA using M-MLV reverse transcriptase (Promega, Madison, WI, USA) with primers miR-9-RT or U6-RT respectively. RT primers were as follows: miR-9-RT, 5¢-TCGTATCCAG TGCAGGGTCCGAG GTGCA CTG GATAC GACTCA TA CAG-3¢; and U6-RT, 5¢-GTCGTATCCAGTGCAGGGT CCGAGGTATTCGCACTGGATACGACAAAATATGG AAC-3¢, which can fold to stem–loop structures. The cDNA was used to amplify mature miR-9 and an endoge- nous control U6 snRNA, respectively, through PCR. PCR primers were: miR-9-Fwd, 5¢-GCCCGCTCTTTGGTTAT CTAG-3¢; and U6-Fwd, 5¢-TGCGGGTGCTCGCTTCGG CAGC-3¢, which could ensure the specificity of the PCR products, and reverse, 5¢-CCAGTGCAGGGTCCGAGGT-3¢, which was universal. All the primers were purchased from Invitrogen. PCR cycles were as follows: 94 °C for 5 min, fol- lowed by 40 cycles of 94 °C for 30 s, 50 °C for 30 s and 72 ° C for 40 s. Real-time PCR was performed using SYBR Premix Ex TaqÔ (TaKaRa, Otsu, Shiga, Japan) on a 7300 Real-Time PCR system (ABI, Foster City, CA, USA). The relative expression of miR-9 was defined as follows: quantity of miR-9 ⁄ quantity of U6 in the same sample. To detect the relative level of NF-jB1 transcription, real- time RT-PCR was performed. Briefly, a cDNA library was generated through reverse transcription using M-MLV reverse transcriptase (Promega) with 5 l g of the large RNA. The cDNA was used to amplify the NF-jB1 gene and b-actin gene as an endogenous control through PCR. PCR primers were as follows: NF-jB1 sense and NF-jB1 antisense were as above; b-actin sense, 5¢-CGTGAC ATTAAGGAGAAGCTG-3¢; and b-actin antisense, 5¢-CTAGAAGCATTTGCGGTGGAC-3¢. PCR cycles were as follows: 94 °C for 5 min, followed by 40 cycles of 94 °C for 1 min, 56 °C for 1 min and 72 °C for 1 min. Real-time PCR was performed as described above, and the relative NF-jB1 expression level was defined as follows: quantity of NF-jB1 ⁄ quantity of b-actin in the same sample. Western blot ES-2 cells were transfected with pri-miR-9 or control vec- tor, miR-9 ASO or control oligonucleotides. Forty-eight hours later the cells were lysed with RIPA lysis buffer and proteins were harvested. All proteins were resolved on 10% SDS denatured polyacrylamide gel and then transferred onto a nitrocellulose membrane. Membranes with anti- (NF-jB1) serum or anti-GAPDH serum were incubated with blotting overnight at 4 ° C Membranes were then washed and incubated with horseradish peroxidase-conju- gated secondary antibody. Protein expression was assessed by enhanced chemiluminescence and exposure to chemilu- minescent film. Lab WorksÔ Image Acquisition and Ana- lysis Software (UVP, Upland, CA, USA) were used to quantify band intensities. Antibodies were purchased from Saier Inc (Tianjin, China) or Sigma-Aldrich (St Louis, MO, USA). Statistical analysis Statistical analysis utilized two-tailed Student’s t-test. Statis- tical significance was set as P < 0.05. Acknowledgements We thank the Tumor Bank Facility of Tianjin Medical University Cancer Institute and Hospital and National Foundation of Cancer Research for providing human ovarian cancer samples. We also thank the College of Public Health of Tianjin Medical University for the technical assistance in fluorescent detection. This work was supported by the National Natural Science Foundation of China (NO: 30873017) and the Natural Science Foundation of Tianjin (NO: 08JCZDJC23300 and 09JCZDJC17500). References 1 Corney DC & Nikitin AY (2008) MicroRNA and ovarian cancer. Histol Histopathol 23, 1161–1169. 2 Lee RC, Feinbaum RL & Ambros V (1993) The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, 843–854. 3 Lee RC & Ambros V (2001) An extensive class of small RNAs in Caenorhabditis elegans. Science 294, 862–864. 4 Lau NC, Lim LP, Weinstein EG & Bartel DP (2001) An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294, 858–862. 5 Lagos-Quintana M, Rauhut R, Lendeckel W & Tuschl T (2001) Identification of novel genes coding for small expressed RNAs. Science 294, 853–858. 6 Pillai RS, Bhattacharyya SN & Filipowicz W (2007) Repression of protein synthesis by miRNAs: how many mechanisms? Trends Cell Biol 17, 118–126. 7 Nilsen TW (2007) Mechanisms of microRNA-mediated gene regulation in animal cells. Trends Genet 23, 243–249. 8 Croce CM & Calin GA (2005) miRNAs, cancer, and stem cell division. Cell 122, 6–7. 9 Chen CZ, Li L, Lodish HF & Bartel DP (2004) MicroRNAs modulate hematopoietic lineage differ- entiation. Science 303 , 83–86. L M. Guo et al. MiR-9 inhibits ovarian cancer cell growth FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS 5545 10 Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E, Pedriali M, Fabbri M, Campiglio M et al. (2005) MicroRNA gene expression deregula- tion in human breast cancer. Cancer Res 65, 7065–7070. 11 Yanaihara N, Caplen N, Bowman E, Seike M, Kumam- oto K, Yi M, Stephens RM, Okamoto A, Yokota J, Tanaka T et al. (2006) Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 9, 189–198. 12 Calin GA, Liu CG, Ferracin M, Hyslop T, Spizzo R, Sevignani C, Fabbri M, Cimmino A, Lee EJ, Wojcik SE et al. (2007) Ultraconserved regions encoding ncR- NAs are altered in human leukemias and carcinomas. Cancer Cell 12, 215–229. 13 Akao Y, Nakagawa Y & Naoe T (2007) MicroRNA- 143 and -145 in colon cancer. DNA Cell Biol 26, 311–320. 14 Visone R, Pallante P, Vecchione A, Cirombella R, Ferracin M, Ferraro A, Volinia S, Coluzzi S, Leone V, Borbone E et al. (2007) Specific microRNAs are down- regulated in human thyroid anaplastic carcinomas. Oncogene 26, 7590–7595. 15 Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder H, Hagan JP, Liu CG, Bhatt D, Taccioli C & Croce CM (2007) MicroRNA expression patterns to differentiate pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis. JAMA 297, 1901–1908. 16 Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, Labourier E, Reinert KL, Brown D & Slack FJ (2005) RAS is regulated by the let-7 micro- RNA family. Cell 120, 635–647. 17 Mayr C, Hemann MT & Bartel DP (2007) Disrupting the pairing between let-7 and Hmga2 enhances onco- genic transformation. Science 315, 1576–1579. 18 Liu T, Tang H, Lang Y, Liu M & Li X (2009) MicroRNA-27a functions as an oncogene in gastric adenocarcinoma by targeting prohibitin. Cancer Lett 273, 233–242. 19 Mertens-Talcott SU, Chintharlapalli S, Li X & Safe S (2007) The oncogenic microRNA-27a targets genes that regulate specificity protein transcription factors and the G2–M checkpoint in MDA-MB-231 breast cancer cells. Cancer Res 67, 11001–11011. 20 Zhang B, Pan X, Cobb GP & Anderson TA (2007) microRNAs as oncogenes and tumor suppressors. Dev Biol 302, 1–12. 21 Laios A, O’Toole S, Flavin R, Martin C, Kelly L, Ring M, Finn SP, Barrett C, Loda M, Gleeson N et al. (2008) Potential role of miR-9 and miR-223 in recurrent ovarian cancer. Mol Cancer 7, 35, doi:10.1186/1476-4598-7-35. 22 Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP & Bartel DP (2007) MicroRNA targeting speci- ficity in mammals: determinants beyond seed pairing. Mol Cell 27, 91–105. 23 Perkins ND (2004) NF-kappaB: tumor promoter or suppressor? Trends Cell Biol 14, 64–69. 24 Lehmann U, Hasemeier B, Christgen M, Muller M, Romermann D, Langer F & Kreipe H (2008) Epigenetic inactivation of microRNA gene hsa-mir-9-1 in human breast cancer. J Pathol 214, 17–24. 25 Zhang L, Huang J, Yang N, Greshock J, Megraw MS, Giannakakis A, Liang S, Naylor TL, Barchetti A, Ward MR et al. (2006) microRNAs exhibit high frequency genomic alterations in human cancer. Proc Natl Acad Sci USA 103, 9136–9141. 26 Stark A, Brennecke J, Russell RB & Cohen SM (2003) Identification of Drosophila microRNA targets. PLoS Biol 1, E60. 27 Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP & Burge CB (2003) Prediction of mammalian microRNA targets. Cell 115, 787–798. 28 Kiriakidou M, Nelson PT, Kouranov A, Fitziev P, Bouyioukos C, Mourelatos Z & Hatzigeorgiou A (2004) A combined computational–experimental approach pre- dicts human microRNA targets. Genes Dev 18, 1165– 1178. 29 Hayden MS & Ghosh S (2004) Signaling to NF-kappaB. Genes Dev 18, 2195–2224. 30 Luo JL, Kamata H & Karin M (2005) IKK ⁄ NF- kappaB signaling: balancing life and death – a new approach to cancer therapy. J Clin Invest 115, 2625– 2632. 31 Kucharczak J, Simmons MJ, Fan Y & Gelinas C (2003) To be, or not to be: NF-kappaB is the answer – role of Rel ⁄ NF-kappaB in the regulation of apoptosis. Onco- gene 22, 8961–8982. MiR-9 inhibits ovarian cancer cell growth L M. Guo et al. 5546 FEBS Journal 276 (2009) 5537–5546 ª 2009 The Authors Journal compilation ª 2009 FEBS . MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-jB1 Li-Min Guo*, Yong Pu*, Zhe Han*, Tao. of miR-9 suppresses cell growth in vitro. Fig. 1. Dysregulation of miR-9 in ovarian cancer tissues. The miR-9 expression level of four pairs of human ovarian