Transient silencing of Plasmodium falciparum bifunctional glucose-6-phosphate dehydrogenase) 6-phosphogluconolactonase Almudena Crooke 1, *, Amalia Diez 1 , Philip J. Mason 2,† and Jose ´ M. Bautista 1 1 Department of Biochemistry and Molecular Biology IV, Universidad Complutense de Madrid, Facultad de Veterinaria, Madrid, Spain 2 Haematology Department, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London, UK Malaria is a major health hazard in tropical and sub- tropical areas around the world. In Africa alone, every year over a million children under the age of 5 years die of malaria and around 300–500 million people are infected by the parasite [1,2]. Added to this, the appearance of parasites resistant to antimalarial drugs is on the increase and it is not proving easy to develop an efficient vaccine against Plasmodium falciparum. There is thus a need for new therapeutic targets. The sequencing of the P. falciparum genome [3–5] has revealed a large amount of molecular information. This information, coupled to microarray mRNA ana- lysis [6,7] and specific expression proteomic analysis of the parasite’s developmental stages [8], is allowing the molecular exploration of new strategies to fight against malaria. Based on their equivalent functions in other organ- isms, the search for genes thought to be essential for Keywords antisense RNA; dsRNA; gene silencing; glucose-6-phosphate dehydrogenase; malaria; Plasmodium falciparum Correspondence J.M. Bautista, Departamento de Bioquı ´ mica y Biologı ´ a Molecular IV, Universidad Complutense de Madrid, Facultad de Veterinaria, Ciudad Universitaria, 28040 Madrid, Spain Fax: +34 91 3943824 Tel: +34 91 3943823 E-mail: jmbau@vet.ucm.es *Present address Department of Biochemistry and Molecular Biology IV, Universidad Complutense de Madrid, Escuela de O ´ ptica, Madrid, Spain †Present address Division of Hematology, Department of Internal Medicine, Washington University School of Medicine, St Louis, USA (Received 5 August 2005, revised 2 February 2006, accepted 10 February 2006) doi:10.1111/j.1742-4658.2006.05174.x The bifunctional enzyme glucose-6-phosphate dehydrogenase-6-phospho- gluconolactonase (G6PD-6PGL) found in Plasmodium falciparum has unique structural and functional characteristics restricted to this genus. This study was designed to examine the effects of RNA-mediated PfG6PD- 6PGL gene silencing in cultures of P. falciparum on the expression of para- site antioxidant defense genes at the transcription level. The highest degree of G6PD-6PGL silencing achieved was 86% at the mRNA level, with a recovery to almost normal levels within 24 h, indicating only transient diminished expression of the PfG6PD-6PGL gene. PfG6PD-6PGL silencing caused arrest of the trophozoite stage and enhanced gametocyte formation. In addition, an immediate transcriptional response was shown by thiore- doxin reductase suggesting that P. falciparum G6PD-6PGL plays a physio- logical role in the specific response of the parasite to intracellullar oxidative stress. P. falciparum transfection with an empty DNA vector also promoted intracellular stress, as determined by mRNA up-regulation of antioxidant genes. Collectively, our findings point to an important role for this enzyme in the parasite’s infection cycle. The different characteristics of G6PD- 6PGL with respect to its homologue in the host make it an ideal target for therapeutic strategies. Abbreviations C T , cycle threshold; FeSOD, iron superoxide dismutase; G6PD-6PGL, glucose-6-phosphate dehydrogenase-6-phosphogluconolactonase; GPx, glutathione peroxidase; GR, glutathione reductase; PPP, pentose phosphate pathway; TrxR, thioredoxin reductase. FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS 1537 the functions of the malaria parasite and for structural differences with respect to their human homologues, is a research strategy aimed at finding potential specific antimalaria targets [9–12]. P. falciparum G6PD-6PGL is a bifunctional enzyme exclusive to Plasmodium species [13] that probably arose from the fusion of two genes in a common ancestor [14]. The deduced protein has a subunit molecular mass of 107 kDa, in agreement with the tetramer molecular weight calculated by size exclusion chromatography [15]. Its C-terminal half (residues 311–911) is clearly homologous to other described G6PDs (with glucose 6-phosphate dehydrogenase activity), though sequence similarity is interrupted by a 62 amino acid stretch with no similarity found to date. It has been nevertheless experimentally shown that this 62 amino acid insertion is essential for the activity of the bifunctional enzyme [16]. In contrast, the 310 amino acid protein sequence of the N-terminal region clearly differs from most eukaryotic and prokaryotic G6PDs, and shows 6-phosphogluconolactonase activ- ity; thus G6PD-6PGL catalyses the first two steps of the pentose phosphate pathway [13]. The occurrence of large insertion sequences that differ with respect to their homologous proteins in other species has been often observed in many gene products of P. falciparum and other Plasmodium species, but their structural functions and origins are unknown [16,17]. In both the host and parasite, the pentose phosphate pathway (PPP) is essential for neutralizing reactive oxygen species during red blood cell infection with the malaria parasite. Accordingly, PPP activity is greatly increased in infected red blood cells compared to non- infected ones, and the parasite PPP is responsible for 82% of this activity [13,18]. Plasmodium falciparum G6PD-6PGL could therefore be a potential therapeutic target not only because of its structural characteristics that make it different from its human equivalent, but also because of the import- ance of this enzyme in the parasite’s intraerythrocyte stage [16]. The present paper describes the effects of G6PD-6PGL silencing in P. falciparum, confirming the key role of this enzyme in the intraerythrocyte stage of infection. Results Effects of PfG6PD-6PGL gene silencing on growth and parasite development In a first attempt at silencing the G6PD-6PGL gene, erythrocytes infected with ring-stage P. falciparum 3D7 (pyrimethamine-sensitive clone) were electroporated with pHC1G6 PD-AS (expressing antisense RNA) and the empty vector pHC1 as control. In addition, silen- cing by dsRNA was also attempted by transfecting ring-stage parasites with a dsRNA–G6PD duplex using water and dsRNA–Rab5a as controls. Figure 1 shows the parasite’s morphology in the different transfected cultures. After 24 h, all electroporated P. falciparum cultures (wild-type, pHC1, pHC1G6 PD-AS, dsRNA-G6PD and dsRNA–Rab5a) showed a 77–83% reduction in parasitaemia, in agreement with previously reported data [19]. As shown in Fig. 1A, control cultures elec- troporated with water were apparently normal, with Fig. 1. Effects of PfG6PD-6PGL gene silencing on parasite develop- ment. Parasites from different cultures were stained with Giemsa and examined by light microscopy at the indicated time points. Wild-type 3D7 (WT) parasites transfected with water not subjected (A) or subjected (B) to 72 h of pyrimethamine pressure; parasites transfected with pHC1 (empty vector control) (C) and pHC1G6 PD- AS vectors (D) subjected to 96 h of pyrimethamine pressure; WT parasites transfected with water (E), dsRNA–Rab5a (dsRNA control) (F) and dsRNA-G6PD (G) 24 h post-transfection. Black and red arrows point to pyknotic parasites and gametocytes, respectively. Transient silencing of G6PD-6PGL A. Crooke et al. 1538 FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS no pyknotic parasite forms or gametocytes appearing throughout the entire protocol. This indicates the recovery of the parasites after electroporation, with no loss in their capacity for multiplication, as the three stages of the intraerythrocyte cycle were detected. In control cultures transfected with water but treated with 100 ngÆmL )1 of pyrimethamine, pyknotic forms appeared (Fig. 1B) as a consequence of the complete absence of live parasites after three days of pyrimeth- amine pressure, demonstrating that sensitivity to pyri- methamine in this strain is an adequate selection method of identifying parasites transfected with pHC1. Unlike the case in electroporated control cultures not exposed to pyrimethamine, in which mainly ring- stage forms and few mature or stress forms such as gametocytes were observed, parasites from both the pHC1 and pHC1G6 PD-AS electroporated cultures subjected to pyrimethamine pressure mainly appeared to be at the trophozoite or gametocyte stage (Fig. 1C– D; Table 1). Although this effect is most probably attributable to pyrimethamine acting on the nontrans- fected parasite population [20,21], we cannot preclude the possibility of some abnormal stage forms due to the presence of the vector itself. As shown in Table 2, parasitaemia levels of the pHC1 and pHC1G6 PD-AS parasites exposed to pyri- methamine determined at 48 h, indicated that 23–25% of the parasites had acquired resistance to pyrimeth- amine mediated by the transfected vectors. This resist- ance decreased to 5–6% at 96 h without further reduction. In the P. falciparum cultures electroporated with dsRNA or water (control culture), in the absence of pyrimethamine pressure, similar parasitaemia levels were observed in the course of one complete intra- erythrocyte cycle (Table 3). Alterations to the cycle were not observed in any of the dsRNA electroporated cultures whose growth was synchronized for the entire 24 h (Table 3). In addition, as shown in Fig. 1E–F, no morphological changes were observed in control cul- tures electroporated with water or with the duplex dsRNA–Rab5a. In contrast, the cultures electro- porated with dsRNA-G6PD (Fig. 1G) showed clear morphological changes in about 50% of the parasites, mostly abnormal trophozoites, whereas the morphol- ogy of the remaining 50% trophozoites was apparently normal. Quantification of mRNA expression in pHC1G6 PD-AS and dsRNA-G6PD transfected parasite cultures Under pyrimethamine pressure, expression of the selectable marker and complementary mRNA strand from the G6PD-6PGL gene were determined by RT- Table 1. Effect of pHC1G6 PD-AS on the stage-specific development of P. falciparum. The results of the parasitaemia, ring, trophozoite and gametocyte assays are the means and standard deviations of three independent experiments. Culture Incubation time with pyrimethamine (h) Parasitaemia (%) a Rings (%) Trophozoites (%) Gametocytes (%) Wild-type 48 13.03 ± 0.82 99.05 ± 0.55 0.95 ± 0.55 nd 96 4.54 ± 0.33 90.00 ± 14.14 10 ± 14.14 nd pHC1 48 1.99 ± 0.53 nd 100 nd 96 0.52 ± 0.16 nd 99.0 ± 1.00 0.7 ± 0.10 pHC1G6 PD-AS 48 2.16 ± 0.19 nd 100 nd 96 0.47 ± 0.06 nd 96.7 ± 1.00 3.1 ± 0.16 a To determine parasitaemia, about 10 000 erythrocytes were examined and the number of infected erythrocytes was reported as a percent- age of the total. Stage-specific development was assessed by counting the fractions of rings, trophozoites and schizonts (asexual stages). No schizonts were detected at the indicated time points. The fraction of gametocytes (sexual stage) was calculated as the percentage detected in 10 000 erythrocytes. nd, not detected. Table 2. Multiplication rates and efficiency of plasmid segregation in pHC1 and pHC1G6 PD-AS transfected parasites. The results of the parasitaemia assays represent the means and standard deviat- ions of three independent experiments. Culture Incubation time for pyrimethamine (h) Parasitaemia (%) a Segregation (%) b pHC1 0 8.05 ± 0.62 100 ± 7.66 48 1.99 ± 0.53 25 ± 6.00 96 0.52 ± 0.16 6 ± 2.22 pHC1G6 PD-AS 0 9.73 ± 0.54 100 ± 5.59 48 2.16 ± 0.19 23 ± 8.12 96 0.47 ± 0.06 5 ± 1.33 a To determine parasitaemia, about 10 000 erythrocytes were examined and the number of infected erythrocytes was reported as percentage of the total. b The level of parasitaemia after (48 and 96 h) and before (0 h) pyrimethamine pressure was used as a quantitative measure of plasmid segregation (expressed as a per- centage). A. Crooke et al. Transient silencing of G6PD-6PGL FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS 1539 PCR (Fig. 2). Also, the effect of the presence of intra- cellular pHC1G6 PD-AS was analyzed by quantitative mRNA expression analysis of G6PD-6PGL and of several key genes involved in defense against oxidative stress after 48 or 96 h of pyrimethamine pressure: glutathione reductase (GR), iron superoxide dismutase (FeSOD), thioredoxin reductase (TrxR) and glutathi- one peroxidase (GPx). Biochemical characterization of recombinant PfGPx indicates that this enzyme has a strong preference for Trx over GSH, and could be considered a thioredoxin dependent peroxidase [22]. At 48 h, a 60% reduction in G6PD-6PGL gene expression was detected (Fig. 3). This reduction also caused a generalized down-regulation of the expression of the other antioxidant genes analyzed. The expression of TrxR and GR, both NADPH dependent enzymes, was reduced by four- and fivefold, respectively (Fig. 3). FeSOD and GPx, which remove the superoxide anion and hydrogen peroxide, respectively, showed five- and threefold down-regulation. After 96 h of incubation in the presence of pyrimethamine, levels of G6PD-6PGL expression were still reduced by 40%, while expression levels of the other antioxidant response genes were restored, returning to levels close to those recorded in cultures transfected with the control pHC1 vector. However, it should be noted that, at 96 h, parasites transfected with pHC1 showed the up-regulation of most of the antioxidant genes except G6PD-6PGL compared with wild-type transfected parasites (Fig. 4B). Thus, GR levels increased sixfold and TrxR, FeSOD and GPx doubled their wild-type levels. This effect was also apparent for TrxR at 48 h (Fig. 4A). Hence, we must carefully interpret this silencing through antisense RNA produced by pHC1, due to the effect per se that the presence of pHC1 has on the parasite antioxidant response. Table 3. Multiplication rate and stage-specific development of parasites transfected with dsRNA. The results of the parasitaemia, ring and trophozoite assays are expressed as the means and standard deviations of three independent experiments. nd, not detected. Culture Time post-transfection (h) Parasitaemia (%) a Rings (%) Trophozoites (%) b Wild-type 3 2.82 ± 1.36 96.03 ± 5.61 3.97 ± 5.61 24 3.82 ± 0.69 6.63 ± 9.38 93.37 ± 9.38 dsRNA–Rab5a 3 1.64 ± 1.55 98.35 ± 2.33 1.65 ± 2.33 24 2.50 ± 2.11 nd 100 dsRNA-G6PD 3 2.31 ± 2.06 98.54 ± 2.06 1.46 ± 2.06 24 3.34 ± 0.83 3.32 ± 4.69 96.69 ± 4.69 a To determine parasitaemia, about 10 000 erythrocytes were examined and the number of infected erythrocytes was reported as percentage of the total. Stage-specific development was assessed by counting the fractions of rings, trophozoites and schizonts. No schizonts were detected at the indicated time points. b Fifty percent of trophozoites detected in the dsRNA-G6PD cultures were abnormal (but not pyknotic). 200 bp 100 bp 200 bp M AB123 100 bp M 1234 Fig. 2. High intracellular expression capacity of the pHC1G6 PD-AS vector. Total RNA from WT and pHC1G6 PD-AS parasites were RT-PCR amplified and the products examined on ethidium bromide-stained agarose gels. (A) Expression of the PfG6PD-6PGL gene noncoding strand: lane M, 100 basepair ladder molecular weight marker; lane 1, pHC1G6 PD-AS parasites subjected to 48 h of pyrimethamine pressure; lane 2, pHC1G6 PD-AS parasites subjected to 96 h of pyrimethamine pressure; lane 3, pHC1G6 PD-AS vector PCR product (positive control). (B) TgDHFR-TS gene expression: lane M, 100 basepair ladder molecular weight marker; lane 1, pHC1G6 PD-AS parasites subjected to 48 h of pyrimethamine pressure; lane 2, pHC1G6 PD-AS parasites subjected to 96 h of pyrimethamine pressure; lane 3, WT parasites (negative con- trol); lane 4, pHC1G6 PD-AS vector PCR product (positive control). RT-PCR amplification yielded bands of the expected size: 152 basepair (antisense PfG6PD-6PGL mRNA) and 160 basepair (TgDHFR-TS mRNA). Transient silencing of G6PD-6PGL A. Crooke et al. 1540 FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS In preliminary experiments performed on cultures after 24, 48, 72 and 96 h of electroporation with dsRNA, a transient effect was observed lasting not longer than 48 h. Aliquots for qRT-PCR analysis were taken at 3 and 24 h after electroporating with dsRNA- G6PD. Three hours after electroporation, G6PD- 6PGL silencing at the mRNA level was 86%, while FeSOD and GPx expression levels were normal (Fig. 5). Nevertheless, this diminished G6PD-6PGL expression effect was accompanied by a sevenfold up- regulation of TrxR and a threefold down-regulation of GR (Fig. 5). After 24 h, normal G6PD-6PGL expres- sion levels were restored. In parallel, the expression levels of the other antioxidant genes, stabilized at sim- ilar levels to those observed in electroporated cultures without dsRNA (Fig. 5). To test this G6PD-6PGL specific knockdown by dsRNA-G6PD, we then determined G6PD-6PGL transcript levels in cultures transfected with dsRNA– Rab5a. Our results indicated no appreciable differences in G6PD-6PGL expression between dsRNA–Rab5a or wild-type parasites, thus confirming the specificity of dsRNA-G6PD (data not shown). Discussion To assess the capacity of a gene or its product to act as an antimalaria target, its role in the biology of the parasite needs to be well established. For this purpose, several systems for the functional analysis of P. falci- parum genes have been developed including gene silen- cing by antisense RNA [23], or more recently, by Fig. 3. Effect of pHC1G6 PD-AS on parasite mRNA. Quantifying G6PD-6PGL, GR, TrxR, FeSOD and GPx mRNA levels by qRT-PCR in parasites, transfected with pHC1 and pHC1G6 PD-AS vectors, obtained at the indicated time points during the course of pyrimeth- amine pressure. Expression level data for each gene obtained from parasites transfected with the pHC1G6 PD-AS vector were normal- ized to the 18S rRNA signal (internal control) and the normalized values of control parasites (transfected with pHC1) were set at 1. Error bars represent the standard deviations of the means obtained in three replicate assays. A B Fig. 4. Oxidative stress gene up-regulation by the presence of pHC1 derived vectors. Gene expression analysis by real-time RT- PCR of G6PD-6PGL, GR, TrxR, FeSOD and GPx from pHC1 and WT water electroporated parasites at 48 and 96 h (pyrimethamine pressure was only applied to pHC1 transfected parasites). The norm- alized number of genome equivalents was determined using the 18 s rRNA gene as internal control. In this experiment, a control culture under pyrimethamine pressure was included in parallel, with no significant mRNA expression signal detected at 48 and 96 h. Error bars represent the standard deviations of the means obtained in three replicate assays. Fig. 5. Effect of the dsRNA-G6PD duplex on parasite mRNA. (A) Quantifying G6PD-6PGL, GR, TrxR, FeSOD and GPx mRNA levels by qRT-PCR in parasites transfected with dsRNA-G6PD, 3 h and 24 h after electroporation. Expression level data for each gene obtained from parasites transfected with dsRNA-G6PD were nor- malized to the 18S rRNA signal (internal control) and the normalized values of control parasites (transfected with water) were set at 1. Error bars represent the standard deviations of the means obtained in three replicate assays. A. Crooke et al. Transient silencing of G6PD-6PGL FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS 1541 RNA interference [24,25]. Antisense RNA has been found in humans, mice, plants and protozoan parasites such as P. falciparum [26]. The fact that endogenous antisense RNAs are widespread in P. falciparum, sug- gests that they could be a natural gene expression reg- ulatory mechanism [26,27]. Recent studies suggest that in P. falciparum antisense RNA is synthesized by RNA polymerase II [26]. In our model, P. falciparum G6PD-6PGL was silenced in vivo through antisense RNA by construct- ing the vector pHC1G6 PD-AS according to a previ- ously established strategy [23]. This vector comprises two expression cassettes, one to drive the expression of a selectable marker, which in this case was the Toxo- plasma gondii dihydropholate reductase thymidylate synthase gene, and the other to allow expression of the PfG6PD-6PGL gene noncoding strand (antisense RNA). This noncoding strand transcription strategy to produce antisense RNA has been recently successfully used in other protozoan and mammalian cells [28–30]. In P. falciparum, antisense RNA has also been success- fully applied to silencing the PfCLAG9 gene [23], inhibiting PfCLAG9 mRNA translation and diminish- ing cytoadherence of the protein to melanoma cells (a function associated with this protein). Since our con- struct expresses high levels of the selection marker and the antisense RNA strand, the in vivo activity of both promoters (P. falciparum calmodulin and Plasmodium chabaudi dihydropholate reductase) and the stability of their mRNAs was observed under our experimental conditions. Parasites transfected with the antisense RNA-G6PD- 6PGL vector showed reduced mRNA-G6PD-6PGL expression at 48 h and there was a simultaneous reduc- tion in TrxR, GR, GPx and FeSOD transcripts. After 96 h, G6PD-6PGL silencing persisted at a slightly higher level, but the expression of the other four anti- oxidant genes was restored. This could be the combined outcome of two effects: a loss or diminished number of copies of the vector in some parasites due to low segre- gation competence [31,32], and stress to the parasite caused by the vector itself. This last effect is suggested by the up-regulation of these genes observed at 96 h in control transfections with pHC1 (lacking an insert), as indicated by reduced parasitaemia levels and increased levels of mRNA for the antioxidant genes in the pHC1 transfected cultures at 96 h. The discordant effects detected at 96 h in cultures transfected with vectors containing or lacking an insert indicate that after 48 h, other interacting factors could modify the molecular phenotypic effect of using this vector. This is the first report of the detection at the molecular level of the toxic effect of a DNA vector in P. falciparum. Although mechanisms of RNAi silencing in many species are not well understood, this technique has been used to study gene function in a great variety of organisms including Trypanosoma brucei, Drosophila melanogaster and a limited number of vertebrates [33– 35]. Despite the fact that, so far, the genes encoding the required RNAi machinery have not been detected in any of the currently available Plasmodium databases [36], RNAi silencing has been achieved in P. falcipa- rum [24,25]. Thus, it could be that the data reported for Plasmodium, as well as our results using dsRNA- G6PD, are the consequence of an antisense RNA rather than a direct RNAi effect. However, it is also true that, to date, 60% of the genes predicted for P. falciparum have no known homologs, and we have no clues as to their function [5]. Transfection of P. falciparum with dsRNA-G6PD seems to be a gentle procedure in that no growth changes were observed in the cultures, allowing obser- vation of the molecular phenotypic effects of transfec- tion. Besides the water-transfected parasite control, dsRNA–Rab5a was used as a second control, since the silencing target Rab5a belongs to a P. falciparum multigene family [37] with overlapping functions, as occurs in other organisms [38,39]. Accordingly, no morphological changes were observed in either type of control cultures, while the cultures transfected with dsRNA-G6PD showed morphological alterations in about 50% of the trophozoites, suggesting that what we are looking at is a genuine effect of inhibited G6PD-6PGL expression causing cell stress. Moreover, this effect is appreciable at the stage of highest meta- bolic activity, the trophozoite stage. In the early stages (3 h), dsRNA-G6PD was highly effective at silencing, decreasing mRNA levels by up to 86%. Nevertheless, this silencing was transient, since after 24 h, mRNA levels had almost recovered. It should be noted that the G6PD-6PGL silencing experiment- ally produced at the ring stage corresponds in clinical isolates to the time at which the highest amounts of G6PD-6PGL transcripts are shown [42]. Silencing of parasite G6PD-6PGL in rings caused cell stress, indu- cing the up-regulation of TrxR by sevenfold. This induction of the thioredoxin system against oxidative stress has been previously described in Streptomyces coelicolor and Bacillus subtilus subjected to oxidative stress [43,44]. An important role of thioredoxin is to reduce ribonucleotide reductase. P. falciparum TrxR is able to reduce thioredoxin, which together with per- oxyredoxins, transforms peroxides and also helps to reduce oxidized glutathione [9]. If the lack of G6PD- 6PGL produces lower reduction equivalents, increas- ing TrxR to counteract this effect would require Transient silencing of G6PD-6PGL A. Crooke et al. 1542 FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS NADPH from alternative sources, as has been sugges- ted by other authors [45,46]. Also it seems that at this early developmental stage in which high mRNA- G6PD-6PGL levels are normally expressed [46], the G6PD-6PGL silencing consequence of a threefold decrease in GR expression would modify the equilib- rium of the oxidative stress cascade, by strongly indu- cing TrxR. Thus, TrxR induction would render reduced thioredoxin, the ribonucleotide reductase sub- strate, producing deoxynucleotides for normal parasite replication [9,10,47], and de novo G6PD-6PGL tran- scription would reestablish expression levels after 24 h. Experimental procedures Vector construction and dsRNA design The oligonucleotides 5¢xg6pd (5¢-CACTGATAAAATATT A CTCGAGAAACCATTTGG-3¢) and 3¢xg6pd (5¢-GAC TTGTTTTTC CTCGAGTTCCTTAAGTAAAGG-3¢) con- taining XhoI sites (underlined) were used to PCR amplify a 960 basepair G6PD-6PGL fragment from P. falciparum 3D7 (corresponding to GenBankÔ nt 1803–2763, accession number X74988). The resultant PCR fragment was excised with XhoI and ligated into the XhoI site of plasmid pHC1 [48] to produce pHC1G6 PD-AS. Parental pHC1 consists of a dual cassette in which the mutated T. gondii dihydro- pholate reductase thymidilate synthase gene, conferring resistance to pyrimethamine, is flanked by the P. chabaudi dihydrofolate reductase promoter and P. falciparum histi- dine-rich protein 2 terminator sequence. The second cas- sette expresses the inserted antisense mRNA driven by the P. falciparum calmodulin promoter and terminated by the 3¢-untraslated region of P. falciparum heat shock protein 86 [48]. The antisense direction of the G6PD-6PGL fragment inserted with respect to the calmodulin promoter, was con- firmed by plasmid DNA NdeI digestion. Parental plasmid pHC1, lacking the G6PD-6PGL fragment was used as a transfection control. Plasmid DNAs were purified (Plasmid Maxi Kit, Qiagen, Chatsworth, CA, USA) from overnight Escherichia coli cultures. A 21 basepair dsRNA (sense: UACAUCAUGCACCAA CGAAdTdT; antisense: UUCGUUGGUGCAUGAUGUA dTdT) was designed for the target sequence (UACAUCA UGCACCAACGAA) of the G6PD-6PGL gene, follow- ing Dharmacon siDESIGN Center criteria (http://design. dharmacon.com/). In addition, a dsRNA corresponding to the PfRab5a gene (GenBankÔ accession number AE001399) (target sequence: UAUGCAAGUAUUGUCCCAC; sense: UAUGCAAGUAUUGUCCCACdTdT; antisense: GUGG GACAAUACUUGCAUAdTdT) was also designed to use as control. All dsRNAs were obtained from Dharmacon Research (Lafayette, CO, USA) in annealed and lyophilized forms and were suspended in RNase-Dnase-free water before use. Parasite cultures and electroporation P. falciparum 3D7 (pyrimethamine-sensitive strain) was grown and double synchronized using standard procedures [49,50]. Parasites (ring stage 8–10% parasitaemia) were transfected by electroporation with 100–150 lg of purified plasmid DNA or 40 lg of dsRNA as described [19]. The parasites transfected with pHC1 or pHC1G6 PD-AS were subsequently cultured for 48 h in 75 cm 2 flasks, after which they were subjected to a selection pressure of 100 ngÆmL )1 pyrimethamine for a further 96 h. The level of parasitaemia after and before pyrimethamine pressure was used as a quantitative measure of plasmid segregation (expressed as a percentage). The growth and development of each transfec- tion was monitored daily by Giemsa staining blood films. Parasites transfected with dsRNA-G6PD or dsRNA– Rab5a were kept for 24 h in 75 cm 2 flasks with no selection pressure. Isolation of total RNA. RT-PCR and quantitative RT-PCR Total RNA was isolated from infected red blood cell cul- tures using the ABI Prism Ò 6100 Nucleic Acid Prepstation (Applied Biosystems, Foster City, CA, USA). Isolated RNA was reverse transcribed to cDNA using the High- CapacityÔcDNA Archive Kit (Applied Biosystems) as des- cribed by the manufacturer using specific reverse primers. To confirm expression of the T. gondii DHFR-TS gene (selectable marker) and antisense G6PD-6PGL mRNA syn- thesis from plasmid pHC1G6 PD-AS, cDNA was obtained using reverse primers (3¢Tgdhfr-ts,5¢-TGTAGACATGC GTGTTCCCC-3¢;3¢Pfg6pd,5¢-GGTTGTGAAGAAAT GGAAGAAGTAC-3¢) for further PCR amplification by adding forward primers (5¢Tgdhfr-ts,5¢-GAAGGAGCTG TCGTGCATCAT-3¢;5¢Pfg6pd,5¢-GATTCATACAATT CCTCGTCTGAG-3¢). For real-time transcript quantifica- tion by molecular beacons, cDNA was obtained using spe- cific reverse primers and qRT-PCR was performed in an ABI Prism 7000 Sequence Detector (Applied Biosystems). Sequence design of molecular beacons and primers for G6PD-6PGL, Fe-SOD, GR, TrXR, GPx and 18S-rRNA quantitative transcription analysis was performed according to a previously published procedure [51]; these designs are provided in Table 4. The qRT-PCR involved 1 cycle each of 50 °C ⁄ 2 min and 95 °C ⁄ 10 min, followed by 45 cycles of 57 °C ⁄ 1 min, 95 °C ⁄ 30 s, and 45 °C ⁄ 29 s. All analyses were run in triplicate. An 18S-rRNA signal was used as endo- genous control to normalize mRNA relative expression [42,51–54]. Cycle threshold (C T ) was defined as the frac- tional PCR cycle number at which the fluorescent signal is A. Crooke et al. Transient silencing of G6PD-6PGL FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS 1543 greater than the minimal detection level. Standard curves were prepared for all targets and endogenous references, using genomic DNA concentrations and their correspond- ing C T . For each experimental sample, the amounts of target and 18S-rRNA were calculated from the standard curves. Then the target amount was divided by the endo- genous reference amount to obtain a normalized target value. To generate the relative expression levels, each normalized target value of interest was divided by the calibrator normalized target from the nontreated sample. Statistical analysis Results are expressed as mean ± SD. All the experiments were repeated on at least three different cultures. Statistical analysis was performed using graphpad software (Prism 4.0) at P < 0.05. The standard deviation of the C t s values among triplicates was always < 0.30 C T . Acknowledgements We are indebted to Nuria Trinidad for her excellent technical assistance with the parasite cultures and to Alan Cowman for his generous gift of the pHC1. Thanks are also due to two anonymous reviewers for their useful comments. A.C. was awarded a predoctor- al fellowship by the Comunidad de Madrid. This research was funded by grants PM1999-0049-CO2-01 and BIO2003-07179 from the Spanish MCYT. References 1 Sachs J & Malaney P (2002) The economic and social burden of malaria. Nature 415, 680–685. 2 Weatherall DJ, Miller LH, Baruch DI, Marsh K, Doumbo OK, Casals-Pascual C & Roberts DJ (2002) Malaria and the red cell. Hematology (Am Soc Hematol Educ Program) 35–57. 3 Bowman S, Lawson D, Basham D, Brown D, Chilling- worth T, Churcher CM, Craig A, Davies RM, Devlin K, Feltwell T et al. (1999) The complete nucleotide sequence of chromosome 3 of Plasmodium falciparum. Nature 400, 532–538. 4 Gardner MJ, Tettelin H, Carucci DJ, Cummings LM, Aravind L, Koonin EV, Shallom S, Mason T, Yu K, Fujii C et al. (1998) Chromosome 2 sequence of the human malaria parasite Plasmodium falciparum. Science 282, 1126–1132. 5 Gardner MJ, Hall N, Fung E, White O, Berriman M, Hyman RW, Carlton JM, Pain A, Nelson KE, Bowman S et al. (2002) Genome sequence of the human malaria parasite Plasmodium falciparum. Nature 419, 498–511. 6 Bozdech Z, Zhu J, Joachimiak MP, Cohen FE, Pulliam B & DeRisi JL (2003) Expression profiling of the schizont Table 4. Primers and molecular beacon probe sequences for real-time RT-PCR. All probes were labelled at the 5¢ end with 6-carboxy-fluorescein (FAM). TAMRA was used as the 3¢ quencher. RT-PCR, reverse transcription PCR. Gene GenBank Ò accession No. Forward Primer (5¢-to3¢) Reverse Primer (5¢-to3¢) Molecular Beacon (5¢-to3¢) Pf18srRNA (M19172) TGACTACGTCCCTGCCCTT ACAATTCATCATATCTTTCAATCGG GGGGGACACCGCCCGTCGCTCCCCC PfGR (NC_004317) AGTGGAGGAATGGCTGCAG CCTAAACGGGATTTTTCGACA CGGGCAGCAAGGCATAACGCAAGCCCG PfTrxR (AL929357) TTGTACTAATATTCCTTCAATATTTGCTG GCCACGGGCGCTAATT CCGGGCTGTAGGAGACGTAGCTGAAAATGTCCCGG PfSOD (PF08–0071) CAACGCTGCTCAAATATGGA CATGAGGCTCACCACCACA CGCGCCTACTTTTTACTGGGATTCTATGGGACCTGGCGCG PfG6PD-6PGL (X74988) GAACTCCAGGAAAAACAAGTCAAG TTTTGACAAGTCCAAATACCTCTTT CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCG PfGPx (PFL0595C) AATTGTGATTCGATGCATGATG TTTATCGACGAGAAATTTTCCAA CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCG Transient silencing of G6PD-6PGL A. Crooke et al. 1544 FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS and trophozoite stages of Plasmodium falciparum with a long-oligonucleotide microarray. Genome Biol 4, R9. 7 Le Roch KG, Zhou Y, Blair PL, Grainger M, Moch JK, Haynes JD, De La Vega P, Holder AA, Batalov S, Carucci DJ et al. (2003) Discovery of gene function by expression profiling of the malaria parasite life cycle. Science 301, 1503–1508. 8 Lasonder E, Ishihama Y, Andersen JS, Vermunt AM, Pain A, Sauerwein RW, Eling WM, Hall N, Waters AP, Stunnenberg HG et al. (2002) Analysis of the Plasmo- dium falciparum proteome by high-accuracy mass spectrometry. Nature 419, 537–542. 9 Kanzok SM, Schirmer RH, Turbachova I, Iozef R & Becker K (2000) The thioredoxin system of the malaria parasite Plasmodium falciparum. Glutathione reduction revisited. J Biol Chem 275, 40180–40186. 10 Becker K, Gromer S, Schirmer RH & Muller S (2000) Thioredoxin reductase as a pathophysiological factor and drug target. Eur J Biochem 267, 6118–6125. 11 Krnajski Z, Gilberger TW, Walter RD, Cowman AF & Muller S (2002) Thioredoxin reductase is essential for the survival of Plasmodium falciparum erythrocytic stages. J Biol Chem 277, 25970–25975. 12 Akerman SE & Muller S (2003) 2-Cys peroxiredoxin PfTrx-Px1 is involved in the antioxidant defence of Plasmodium falciparum. Mol Biochem Parasitol 130, 75–81. 13 Clarke JL, Scopes DA, Sodeinde O & Mason PJ (2001) Glucose-6-phosphate dehydrogenase-6-phosphoglucono- lactonase: A novel bifunctional enzyme in malaria para- sites. Eur J Biochem 268, 2013–2019. 14 Scopes DA, Bautista JM, Vulliamy TJ & Mason PJ (1997) Plasmodium falciparum glucose-6-phosphate dehydrogenase (G6PD) – the N-terminal portion is homologous to a predicted protein encoded near to G6PD in Haemophilus influenzae. Mol Microbiol 23, 847–848. 15 Kurdi-Haidar B & Luzzatto L (1990) Expression and characterization of glucose-6-phosphate dehydrogenase of Plasmodium falciparum. Mol Biochem Parasitol 41, 83–91. 16 Clarke JL, Sodeinde O & Mason PJ (2003) A unique insertion in Plasmodium berghei glucose-6-phosphate dehydrogenase-6-phosphogluconolactonase: evolutionary and functional studies. Mol Biochem Parasitol 127 , 1–8. 17 Pizzi E & Frontali C (2001) Low-complexity regions in Plasmodium falciparum proteins. Genome Res 11, 218– 229. 18 Atamna H, Pascarmona G & Ginsburg H (1994) Hex- ose-monophosphate shunt activity in intact Plasmodium falciparum-infected erythrocytes and in free parasites. Mol Biochem Parasitol 67, 79–89. 19 Wu Y, Sifri CD, Lei HH, Su XZ & Wellems TE (1995) Transfection of Plasmodium falciparum within human red blood cells. Proc Natl Acad Sci USA 92, 973–977. 20 Waterkeyn JG, Crabb BS & Cowman AF (1999) Trans- fection of the human malaria parasite Plasmodium falci- parum. Int J Parasitol 29, 945–955. 21 O’Donnell RA, Freitas-Junior LH, Preiser PR, William- son DH, Duraisingh M, McElwain TF, Scherf A, Cowman AF & Crabb BS (2002) A genetic screen for improved plasmid segregation reveals a role for Rep20 in the interaction of Plasmodium falciparum chromo- somes. EMBO J 21, 1231–1239. 22 Sztajer H, Gamain B, Aumann KD, Slomianny C, Becker K, Brigelius-Flohe R & Flohe L (2001) The putative glutathione peroxidase gene of Plasmodium fal- ciparum codes for a thioredoxin peroxidase. J Biol Chem 276, 7397–7403. 23 Gardiner DL, Holt DC, Thomas EA, Kemp DJ & Trenholme KR (2000) Inhibition of Plasmodium falci- parum clag9 gene function by antisense RNA. Mol Biochem Parasitol 110, 33–41. 24 McRobert L & McConkey GA (2002) RNA interference (RNAi) inhibits growth of Plasmodium falciparum. Mol Biochem Parasitol 119, 273–278. 25 Kumar R, Adams B, Oldenburg A, Musiyenko A & Barik S (2002) Characterisation and expression of a PP1 serine ⁄ threonine protein phosphatase (PfPP1) from the malaria parasite, Plasmodium falciparum: demonstration of its essential role using RNA interference. Malar J 1,5. 26 Militello KT, Patel V, Chessler AD, Fisher JK, Kasper JM, Gunasekera A & Wirth DF (2005) RNA polymer- ase II synthesizes antisense RNA in Plasmodium falci- parum. RNA 11, 365–370. 27 Gunasekera AM, Patankar S, Schug J, Eisen G, Kis- singer J, Roos D & Wirth DF (2004) Widespread distri- bution of antisense transcripts in the Plasmodium falciparum genome. Mol Biochem Parasitol 136, 35–42. 28 Bracha R, Nuchamowitz Y & Mirelman D (2000) Inhibition of gene expression in Entamoeba by the tran- scription of antisense RNA: effect of 5¢- and 3¢-regula- tory elements. Mol Biochem Parasitol 107, 81–90. 29 Chen DQ, Kolli BK, Yadava N, Lu HG, Gilman-Sachs A, Peterson DA & Chang KP (2000) Episomal expres- sion of specific sense and antisense mRNAs in Leishma- nia amazonensis: modulation of gp63 level in promastigotes and their infection of macrophages in vitro. Infect Immun 68, 80–86. 30 Zhang X, Chen Z, Chen Y & Tong T (2003) Delivering antisense telomerase RNA by a hybrid adenovirus ⁄ ade- no-associated virus significantly suppresses the malig- nant phenotype and enhances cell apoptosis of human breast cancer cells. Oncogene 22 , 2405–2416. 31 van Dijk MR, Waters AP & Janse CJ (1995) Stable transfection of malaria parasite blood stages. Science 268, 1358–1362. 32 O’Donnell R, Preiser PR, Williamson DH, Moore PW, Cowman AF & Crabb BS (2001) An alteration in con- catameric structure is associated with efficient segrega- A. Crooke et al. Transient silencing of G6PD-6PGL FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS 1545 tion of plasmids in transfected Plasmodium falciparum parasites. Nucleic Acids Res 29, 716–724. 33 Ngo H, Tschudi C, Gull K & Ullu E (1998) Double- stranded RNA induces mRNA degradation in Trypano- soma brucei. Proc Natl Acad Sci USA 95, 14687–14692. 34 Misquitta L & Paterson BM (1999) Targeted disrup- tion of gene function in Drosophila by RNA interfer- ence (RNA-i): a role for nautilus in embryonic somatic muscle formation. Proc Natl Acad Sci USA 96, 1451–1456. 35 Wargelius A, Ellingsen S & Fjose A (1999) Double- stranded RNA induces specific developmental defects in zebrafish embryos. Biochem Biophys Res Commun 263, 156–161. 36 Ullu E, Tschudi C & Chakraborty T (2004) RNA inter- ference in protozoan parasites. Cell Microbiol 6, 509– 519. 37 Quevillon E, Spielmann T, Brahimi K, Chattopadhyay D, Yeramian E & Langsley G (2003) The Plasmodium falciparum family of Rab GTPases. Gene 306, 13–25. 38 Lazar T, Gotte M & Gallwitz D (1997) Vesicular trans- port: how many Ypt ⁄ Rab-GTPases make a eukaryotic cell? Trends Biochem Sci 22, 468–472. 39 Stenmark H & Olkkonen VM (2001) The Rab GTPase family. Genome Biol 2, reviews 3007.1–3007.7, doi: 10.1186/gb-2001-2-5-reviews3007. 40 Mohmmed A, Dasaradhi PV, Bhatnagar RK, Chauhan VS & Malhotra P (2003) In vivo gene silencing in Plas- modium berghei – a mouse malaria model. Biochem Biophys Res Commun 309, 506–511. 41 Mundodi V, Kucknoor AS & Gedamu L (2005) Role of Leishmania (Leishmania) chagasi amastigote cysteine protease in intracellular parasite survival: studies by gene disruption and antisense mRNA inhibition. BMC Mol Biol 6,3. 42 Sodeinde O, Clarke JL, Vulliamy TJ, Luzzatto L & Mason PJ (2003) Expression of Plasmodium falciparum G6PD-6PGL in laboratory parasites and in patient iso- lates in G6PD-deficient and normal Nigerian children. Br J Haematol 122, 662–668. 43 Paget MS, Kang JG, Roe JH & Buttner MJ (1998) Sig- maR, an RNA polymerase sigma factor that modulates expression of the thioredoxin system in response to oxi- dative stress in Streptomyces coelicolor A3 (2). EMBO J 17, 5776–5782. 44 Nakano S, Kuster-Schock E, Grossman AD & Zuber P (2003) Spx-dependent global transcriptional control is induced by thiol-specific oxidative stress in Bacillus sub- tilis. Proc Natl Acad Sci USA 100, 13603–13608. 45 Werner C, Stubbs MT, Krauth-Siegel RL & Klebe G (2005) The crystal structure of Plasmodium falciparum glutamate dehydrogenase, a putative target for novel antimalarial drugs. J Mol Biol 349, 597–607. 46 Bozdech Z & Ginsburg H (2005) Data mining of the transcriptome of Plasmodium falciparum: the pentose phosphate pathway and ancillary processes. Malar J 4, 17. 47 Campanale N, Nickel C, Daubenberger CA, Wehlan DA, Gorman JJ, Klonis N, Becker K & Tilley L (2003) Identification and characterization of heme-interacting proteins in the malaria parasite, Plasmodium falciparum. J Biol Chem 278, 27354–27361. 48 Crabb BS, Triglia T, Waterkeyn JG & Cowman AF (1997) Stable transgene expression in Plasmodium falci- parum. Mol Biochem Parasitol 90, 131–144. 49 Trager W & Jensen JB (1976) Human malaria parasites in continuous culture. Science 193, 673–675. 50 Lambros C & Vanderberg JP (1979) Synchronization of Plasmodium falciparum erythrocytic stages in culture. J Parasitol 65, 418–420. 51 Bustamante LY, Crooke A, Martinez J, Diez A & Bau- tista JM (2004) Dual-function stem molecular beacons to assess mRNA expression in AT-rich transcripts of Plasmodium falciparum. Biotechniques 36, 488–494. 52 Hermsen CC, Telgt DS, Linders EH, van de Locht LA, Eling WM, Mensink EJ & Sauerwein RW (2001) Detec- tion of Plasmodium falciparum malaria parasites in vivo by real-time quantitative PCR. Mol Biochem Parasitol 118, 247–251. 53 Witney AA, Doolan DL, Anthony RM, Weiss WR, Hoffman SL & Carucci DJ (2001) Determining liver stage parasite burden by real time quantitative PCR as a method for evaluating pre-erythrocytic malaria vac- cine efficacy. Mol Biochem Parasitol 118, 233–245. 54 Blair PL, Witney A, Haynes JD, Moch JK, Carucci DJ & Adams JH (2002) Transcripts of developmentally regulated Plasmodium falciparum genes quantified by real-time RT-PCR. Nucleic Acids Res 30, 2224–2231. Transient silencing of G6PD-6PGL A. Crooke et al. 1546 FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS . Transient silencing of Plasmodium falciparum bifunctional glucose-6-phosphate dehydrogenase) 6-phosphogluconolactonase Almudena. Transcripts of developmentally regulated Plasmodium falciparum genes quantified by real-time RT-PCR. Nucleic Acids Res 30, 2224–2231. Transient silencing of G6PD-6PGL