Down-regulation of reduced folate carrier may result in folate malabsorption across intestinal brush border membrane during experimental alcoholism Abid Hamid1, Nissar Ahmad Wani1, Satyavati Rana2, Kim Vaiphei3, Akhtar Mahmood4 and Jyotdeep Kaur1 Department Department Department Department of of of of Biochemistry, Postgraduate Institute of Medical Education and Research, Chandigarh, India Gastroenterology, Postgraduate Institute of Medical Education and Research, Chandigarh, India Histopathology, Postgraduate Institute of Medical Education and Research, Chandigarh, India Biochemistry, Panjab University, Chandigarh, India Keywords alcoholism; brush border membrane; crypt– villus axis; methylation; reduced folate carrier Correspondence J Kaur, Department of Biochemistry, Postgraduate Institute of Medical Education and Research, Chandigarh 160 012, India Fax: +91 172 2744401 ⁄ 2745078 Tel: +91 172 2747585 5181 E-mail: jyotdeep2001@yahoo.co.in (Received August 2007, revised October 2007, accepted 17 October 2007) doi:10.1111/j.1742-4658.2007.06150.x Folate plays a critical role in maintaining normal metabolic, energy, differentiation and growth status of all mammalian cells The intestinal folate uptake is tightly and diversely regulated, and disturbances in folate homeostasis are observed in alcoholism, attributable, in part, to intestinal malabsorption of folate The aim of this study was to delineate the regulatory mechanisms of folate transport in intestinal absorptive epithelia in order to obtain insights into folate malabsorption in a rat model of alcoholism The rats were fed gỈkg)1 body weight of ethanol daily for months A reduced uptake of [3H]folic acid in intestinal brush border membrane was observed over the course of ethanol administration for months Folate transport exhibited saturable kinetics and the decreased intestinal brush border membrane folate transport in chronic alcoholism was associated with an increased Km value and a low Vmax value Importantly, the lower intestinal [3H]folic acid uptake in ethanol-fed rats was observed in all cell fractions corresponding to villus tip, mid-villus and crypt base RT-PCR analysis for reduced folate carrier, the major folate transporter, revealed that reduced folate carrier mRNA levels were decreased in jejunal tissue derived from ethanol-fed rats Parallel changes were observed in reduced folate carrier protein levels in brush border membrane along the entire crypt–villus axis In addition, immunohistochemical staining for reduced folate carrier protein showed that, in alcoholic conditions, deranged reduced folate carrier localization was observed along the entire crypt–villus axis, with a more prominent effect in differentiating crypt base stem cells These changes in functional activity of the membrane transport system were not caused by a general loss of intestinal architecture, and hence can be attributed to the specific effect of ethanol ingestion on the folate transport system The low folate uptake activity observed in ethanol-fed rats was found to be associated with decreased serum and red blood cell folate levels, which might explain the observed jejunal genomic hypomethylation These findings offer possible mechanistic insights into folate malabsorption during alcoholism Abbreviations BBM, brush border membrane; BBMV, brush border membrane vesicle; LAP, leucine aminopeptidase; RBC, red blood cell; RFC, reduced folate carrier; SAM, S-adenosyl methionine FEBS Journal 274 (2007) 6317–6328 ª 2007 The Authors Journal compilation ª 2007 FEBS 6317 Intestinal folate malabsorption in alcoholism A Hamid et al The mechanism of folate transport is under extensive investigation because mammals require the ingestion and absorption of preformed folates in order to meet their needs for one-carbon moieties to sustain key biosynthetic reactions [1] In addition, the cellular concentration of folate cofactors, in different oxidative states, governs the intricate network of methylation reactions of DNA, RNA, proteins and phospholipids [2] The most well-characterized folate transporter, the reduced folate carrier (RFC), is an integral membrane protein of  65 kDa that mediates the cellular uptake of reduced folates and antifolates, and is ubiquitously expressed in tissues [3], consistent with its integral role in tissue folate homeostasis [4] Cellular folate concentrations are influenced by folate availability, cellular folate transport efficiency, folate polyglutamylation and turnover, specifically through degradation [1] These processes have been found to provide a potential means of ensuring adequate levels of RFC transcripts and protein in response to tissue requirements for folate cofactors or exogenous tissue or cell-specific signals [5,6] Deficiency of folate is highly prevalent throughout the world [7] Moreover, alcohol-associated folate deficiency has become a major health problem worldwide [8,9], and can develop because of dietary inadequacy, intestinal malabsorption, altered hepatobiliary metabolism and increased renal excretion [10,11] However, it is a well-established fact that the primary effect of ethanol on folate metabolism is reflected in intestinal malabsorption [12,13] Previous studies have demonstrated that both initial deconjugation and subsequent transport of monoglutamic folate are impaired in alcoholics [14] However, the exact molecular mechanism regulating intestinal folate transport in alcoholism is not yet clear Therefore, the aim of this study was to elucidate the mechanisms of regulation of folate malabsorption during chronic alcoholism Under chronic alcoholic conditions, the kinetic constants of the folate transport process in intestinal brush border membrane (BBM) were calculated, and the mRNA and protein expression of a major folate transporter, RFC, was studied The investigation of the regulation of folate transport via RFC expression in absorptive epithelia may aid in the development of future therapeutic strategies targeting the regulatory protein In addition to alcoholism, folate malabsorption has also been reported to occur in several intestinal diseases, congenital disorders of the folate transport system, drug interactions and intestinal resection, and may involve similar mechanisms 6318 Results There was no significant decrease in body weight of ethanol-fed rats relative to the control group during the course of the experiment At the time of killing, the mean body weights of rats in control and ethanolfed groups were 201 ± and 196 ± g, respectively Estimation of blood alcohol levels In order to establish the suitability of the rat model for studies on experimental alcoholism using our experimental set-up, the blood alcohol level was a prerequisite parameter It was found that the alcohol level was 88% higher (P < 0.001) in the chronic ethanolfed group than in the control group The mean blood alcohol levels were 15.04 ± 1.96 and 1.77 ± 0.34 mgỈdL)1 in the ethanol-fed and control groups, respectively Purity of membrane vesicles The membrane vesicle preparations were evaluated for purity by biochemical, morphological and functional criteria The specific activities of alkaline phosphatase and sodium–potassium adenosine triphosphatase (Na+,K+-ATPase) were studied to check the purity of BBM vesicles (BBMVs) A 12–15-fold increase in alkaline phosphatase activity was observed in isolated BBMVs, with a minimum activity of Na+,K+-ATPase, relative to the respective homogenates Transmission electron micrographs revealed sealed and intact vesicles without contamination of subcellular organelles, and were similar in the two groups of rats with ‘right side out’ orientation (Fig 1A,B) The functional integrity of intestinal BBMVs was checked using [14C]d-glucose uptake, which revealed a transient overshoot of the intravesicular glucose concentration over its equilibrium uptake in the presence of a sodium gradient (data not shown) [3H]Folic acid transport, measured by incubating BBMVs for various time intervals, was found to be at a maximum at 30 s in both control and ethanol-fed groups, as described previously [15] For further experiments, a 30 s time interval was chosen for the determination of the initial uptake Moreover, [3H]folic acid uptake revealed no significant difference between fresh and frozen vesicles In the control group, the uptake was observed to be 36.20 ± 3.20 and 35.29 ± 2.20 pmolỈ(30 s))1Ỉmg)1 protein in fresh and frozen BBMVs, respectively, in comparison with 19.69 ± 1.90 and 19.06 ± 2.81 pmolỈ(30 s))1Ỉmg)1 protein in the ethanol-fed group Therefore, for further studies, frozen reconstituted vesicles were used FEBS Journal 274 (2007) 6317–6328 ª 2007 The Authors Journal compilation ª 2007 FEBS A Hamid et al Intestinal folate malabsorption in alcoholism A B Fig Electron micrographs (· 60 000) of representative BBMVs with uniform shape showing sealed outer surfaces and ‘right side out’ orientation: (A) control group; (B) ethanol-fed group 60 For all the assays, except folic acid transport during the course of the study, BBMVs were isolated at the end of months of treatment Folic acid transport during the course of the study Folic acid uptake into BBMVs from control and ethanol-fed rats was studied at 1.5, and months during the course of chronic ethanol dosing Ethanol-fed rats showed a decrease in [3H]folic acid transport, of the order of 24, 55 and 62%, respectively, relative to the control group (Fig 2) Thus, malabsorption of folate was observed over the entire course of ethanol treatment of months Determination of the kinetic constants of [3H]folic acid uptake in BBMVs V(pmol/30 sec/mg protein) The effect of substrate concentration on [3H]folic acid transport in BBMVs from control and ethanol-fed rats after months of treatment was determined by varying the [3H]folic acid concentration from 0.125 to 1.50 lm 40 30 20 Control Ethanol *** *** 10 *** months months 1.5 months Fig [3H]Folic acid transport in intestinal BBMVs at different intervals during the course of ethanol administration An incubation buffer of pH 5.5 and a [3H]folic acid concentration of 0.5 lM were used for uptake measurements Each data point is the mean ± standard deviation of eight separate uptake determinations carried out in triplicate ***P < 0.001 versus control V(pmol/30 sec/mg protein) [3H]Folic acid uptake Control Ethanol 50 ** 40 *** *** 30 20 ** 10 *** 0.5 [S] (µM) 1.5 Fig [3H]Folic acid uptake in intestinal BBMVs as a function of substrate concentration (inset Lineweaver–Burk plot) Uptake was measured by varying the [3H]folic acid concentration from 0.125 to 1.50 lM in an incubation medium of pH 5.5 after incubating BBMVs for 30 s Each data point is the mean ± standard deviation of eight separate uptake determinations carried out in triplicate **P < 0.01, ***P < 0.001 versus control (i.e within the physiological range) When transport was plotted versus substrate concentration (Fig 3), the curve showed a plateau at about 1.00 lm in both groups From 0.125 to 1.0 lm of folic acid, the uptake was 21–39% less in the ethanol-fed group (P < 0.01, P < 0.001) From the data, the kinetic constants Km and Vmax for folic acid transport were determined from the Lineweaver–Burk plot (Fig 3, inset) The Km values for control and ethanol-fed groups were found to be 0.90 ± 0.08 and 1.53 ± 0.09 lm (P < 0.01), respectively The Vmax values for control and ethanolfed groups were found to be 100 ± 5.60 and protein (P < 0.05), 83 ± 3.65 pmolỈ(30 s))1Ỉmg)1 respectively Folate transport across the crypt–villus axis of the intestine The cell fractions (F1–F9) were isolated from the small intestine of both groups of rats at the end of FEBS Journal 274 (2007) 6317–6328 ª 2007 The Authors Journal compilation ª 2007 FEBS 6319 Intestinal folate malabsorption in alcoholism A Hamid et al Expression of mRNA corresponding to RFC in the intestine The finding that the folic acid uptake process has an apparent Km value in the micromolar range [17] strongly suggests that the process is carrier mediated In order to elucidate the mechanism of reduced folate transport in chronic alcoholism, transcriptional and translational regulation of RFC was studied For mRNA expression, total RNA was isolated from the upper cm of jejunal tissue from both groups of rats RT-PCR analysis was performed with the use of genespecific primers corresponding to a sequence in the open reading frame of rat RFC and b-actin (as an internal control); products of 489 and 588 bp for RFC and b-actin, respectively, were obtained on electrophoresis using a 1.2% agarose gel From densitometric analysis, it was deduced that the expression of mRNA coding for RFC was three-fold lower during chronic ethanol feeding (Fig 4A,B) Thus, ethanol imparts its effect through transcriptional regulation of RFC at the primary absorptive site of folic acid, i.e the small intestine Expression of the RFC protein in BBM of the intestine The effect of chronic alcoholism on the level of expression of the RFC protein at the BBM surface was studied by western blot analysis Analysis of purified 6320 A 588 489 B Mean relative RFC levels (RFC/β-actin) months of treatment, and were characterized by an approximate eight-fold decrease in specific activity of the villus cell marker enzyme alkaline phosphatase from F1 (villus tip) to F9 (crypt base) (data not shown) In addition, isolated epithelial cells were characterized by measuring the DNA content and [3H]thymidine incorporation into DNA of various cell fractions, as described previously [16] On the basis of the distribution patterns of the cell markers, the nine cell fractions were grouped as villus tip (F1–F3), mid-villus (F4–F6) and crypt (F7–F9) cells, representing differentiated, differentiating and proliferating enterocytes, respectively Folate transport from the respective BBMVs was studied It was observed to be 24% higher at the villus tip than at the crypt base (P < 0.01) in the control group; this increase was found to be 33% in the ethanol-fed group (P < 0.001) Ethanol feeding resulted in a significant decrease in folate transport along the entire crypt–villus axis, the decrease being at a maximum (50%) at the crypt base (data not shown) 0.6 0.4 0.2 *** Control Ethanol Fig RT-PCR analysis of RFC and b-actin (internal control) in jejunal tissues: (A) resolved on 1.2% agarose gel electrophoresis; (B) densitometric analysis representing relative change in RFC mRNA expression Data shown are the mean of eight separate sets of experiments ***P < 0.001 versus control Lanes 1, 2, control; lanes 3–5, ethanol; lane 6, negative control BBMVs was performed to identify RFC using polyclonal antibodies raised against a specific region of rat RFC; reactivity was found at approximately 65 kDa Moreover, there was no cross-reaction of RFC antibodies against any protein in the vesicular preparations used Antisera against the leucine aminopeptidase (LAP) showed reactivity at 80 kDa, which served as an internal control LAP is a membranebound aminopeptidase whose activity has been found to be unaffected by chronic ethanol feeding [18,19] The expression of the RFC protein was observed to be 2.3-fold higher in BBMVs from the control group relative to those from the chronic ethanol-fed group (Fig 5A,B) When studied along the crypt–villus axis in BBMVs isolated from different cell types from the two groups of rats, maximum RFC expression in the control group was observed in the villus tip membrane, followed by the mid-villus and then the crypt base (Fig 6A,B) In comparison with the villus tip of the control group, there was a two- and 2.5-fold lower RFC expression in the mid-villus and crypt base BBMVs, respectively However, in the ethanol-fed group, RFC expression was observed to be at a maximum at the villus tip, with equal expression in the mid-villus and crypt base, which was three-fold less than that at the villus tip Notably, ethanol feeding reduced the expression of RFC protein in membranes isolated from cells along the entire crypt–villus axis (Fig 6A,B) FEBS Journal 274 (2007) 6317–6328 ª 2007 The Authors Journal compilation ª 2007 FEBS A Hamid et al Intestinal folate malabsorption in alcoholism A was localized along the tip epithelial cells and towards the enterocyte brush border, and positive cells were visible up to the base of the villi, i.e at the villus–crypt junction However, there was a gradual decrease in intensity from villus to crypt cells (Fig 7A) In ethanol-fed rats, there was a marked decrease in the intensity of positively stained cells; only a few cells along the tip of the villi and mid-villus showed positivity (Fig 7B) No staining was detected in the sections incubated with only secondary antibody Furthermore, RFC protein was not detected in the lamina propria, muscularis mucosa, submucosa, muscularis externa or smooth muscle cells of the small intestine (data not shown) 80kDa ~65kDa Mean relative RFC protein levels (RFC/LAP) B *** Control Ethanol Fig (A) Western blot analysis of intestinal BBMVs using antiRFC (65 kDa) and anti-LAP (80 kDa) IgG (B) Densitometric analysis representing the relative change in RFC protein levels Data shown are the mean of eight separate sets of experiments Lane 1, control; lane 2, ethanol ***P < 0.001 versus control A 80kDa B Mean relative RFC protein levels (RFC/LAP) ~65kDa 1.00 Villus tip 0.50 Mid villus ** 0.75 Crypt base ### ### 0.25 ### ### ** *** Control Ethanol Fig (A) Western blot analysis of BBMVs isolated from the intestinal villus tip, mid-villus and crypt base cells using anti-RFC (65 kDa) and anti-LAP (80 kDa) IgG (B) Densitometric analysis representing the relative change in RFC protein levels Data shown are the mean of four separate sets of experiments Lanes 1, 4, villus tip; lanes 2, 5, mid-villus; lanes 3, 6, crypt base (lanes 1–3, control; lanes 4–6, ethanol) **P < 0.01, ***P < 0.001 versus the respective control ###P < 0.001 versus villus tip of respective group RFC distribution and localization across the intestinal vertical axis The distribution pattern of RFC protein was determined by immunohistochemical localization In control rats, localization of RFC was mainly seen along the epithelial cells of the villus lining; stronger expression Histochemical assessment of jejunal sections After visualizing the slides under a light microscope, no changes in intestinal architecture were observed in the intestinal tissues from control (Fig 8A) and ethanol-fed (Fig 8B) rats However, ethanol-fed rats showed mucodepletion and an increase in intraepithelial lymphocytes of the epithelial cells of the villus lining There was no evidence of any haemorrhagic mucosal lesions in the intestines of ethanol-fed rats Estimation of serum and red blood cell (RBC) folate levels As this study dealt with folate malabsorption during alcoholism, it was important to determine the folate levels at the end of ethanol treatment The results showed that a significant (P < 0.001) decrease (32%) in serum folate levels occurred in the chronic ethanolfed group; the mean serum folate levels were 49.64 ± 5.29 and 33.71 ± 4.95 lgỈL)1 in control and ethanol-fed rats, respectively In addition, the RBC folate concentration showed a 34% decrease (P < 0.001) in chronic ethanol-fed rats, with mean values of 950 ± 29.84 and 624 ± 49.73 lgỈL)1 in control and ethanol-fed rats, respectively DNA methylation profile of jejunal tissue DNA from highly proliferating jejunal tissue was isolated, and methylation was studied using the amount of labelled S-adenosyl methionine (SAM) incorporated into DNA (Fig 9) The amount of SAM incorporated into DNA is inversely proportional to the degree of methylation It was observed that DNA from the ethanol-fed group incorporated eightfold more SAM relative to that from the control FEBS Journal 274 (2007) 6317–6328 ª 2007 The Authors Journal compilation ª 2007 FEBS 6321 Intestinal folate malabsorption in alcoholism A A Hamid et al B Fig Immunohistochemical analysis of rat jejunal sections exposed to anti-RFC IgGs, showing relative localization and distribution pattern of RFC protein (as depicted by brown counterstaining of haematoxylin) along the intestinal absorptive axis Figures (· 450) shown are representative of each group: (A) control; (B) ethanol A B Fig Haematoxylin–eosin staining of jejunal sections, showing no change in intestinal architecture after chronic ethanol ingestion Figures (· 450) shown are representative of each group: (A) control; (B) ethanol Discussion SAM utilized (µMx103/µg DNA) 80 *** 60 40 20 Control Ethanol Fig [3H]-labelled SAM incorporated (lMỈlg)1 jejunal DNA) as an index of jejunal DNA methylation profile Values are means ± standard deviation (n ¼ 8) ***P < 0.001 versus control group Such results indicate a decrease in the degree of methylation of DNA in chronic ethanolfed rats 6322 Chronic alcoholism is often associated with folate deficiency, which is mainly a result of malabsorption of folate across the intestinal membrane [12,20] In a rat model of experimental alcoholism, we examined the mechanism of the regulation of folate transport mediated by RFC, the major folate transporter protein in the intestine It was observed that a significant concentration of blood alcohol was maintained when determined 24 h after the last dose of ethanol of gỈkg)1 body weight per day at the end of a month course Such a dose was chosen according to earlier studies [21], which suggested that the ethanol concentration of jejunal tissue should not exceed 6% in animal experiments in order to be relevant to the human intestine In the present study, gỈkg)1 body weight of ethanol FEBS Journal 274 (2007) 6317–6328 ª 2007 The Authors Journal compilation ª 2007 FEBS A Hamid et al (20% solution) per day produced nontoxic blood alcohol concentrations, and rats showed no significant histological alterations in the intestinal mucosa and no clinical signs of intoxication [22] A significant decrease in folic acid uptake by BBMVs in the chronic ethanol-fed group, which appeared even after 1.5 months of treatment, suggests that ethanol feeding has a profound malabsorptive effect on folate uptake, which may be of biological significance The decrease was associated with an increase in Km and a decrease in Vmax, suggesting that both the affinity of the transporter and the number of transporter sites on BBMVs are reduced after chronic ethanol ingestion The increase in Km may also suggest that an alternative route of folate transport is operational after chronic ethanol feeding These observations confirmed an earlier study which was carried out at toxic blood alcohol levels in the micropig model of chronic alcoholism [20] In order to evaluate the mechanism of reduced folate uptake, the expression profile of RFC was of prime importance, as RFC is believed to be a major folate carrier responsible for intestinal folate absorption [15,23], although recently a protoncoupled folate transporter has been found to play an essential role in folate absorption in the intestine [24] The decreased Vmax value of intestinal folate uptake observed in chronic ethanol-fed rats was found to be associated with a marked decrease in the intestinal mRNA level of RFC In the present study, only jejunal tissue was used for expression studies, as earlier investigations [25] have established that the jejunum is the preferred site of absorption of exogenous folate The finding that transcripts were reduced by more than three-fold, whereas transport, as Vmax, was reduced by less than two-fold, might suggest that chronic ethanol ingestion in rats has differential effects on the transcriptional and post-transcriptional regulation of RFC, or on the stability of the RFC mRNA and protein Alternatively, another route of folate transport may be up-regulated in alcoholic conditions In this regard, the proton-coupled folate transporter may be suggested to play an important role in intestinal folic acid transport; however, its mechanism and specificity in alcoholism need to be evaluated independently Furthermore, western blot analysis of BBMVs revealed that the down-regulation of RFC at the protein level paralleled that of mRNA analysis The decreased RFC protein molecules in BBMVs may reflect either greater turnover or reduced synthesis of transporter molecules during alcoholism In addition, RFC was less prominently expressed at the basolateral surface; moreover, down-regulation was evident at the basolateral membrane during alcoholism (A Hamid et al., unpublished Intestinal folate malabsorption in alcoholism data) Earlier studies carried out in models of dietary folate deficiency support our findings that transcriptional regulatory mechanisms operate in the folate transport system via RFC [17,26] The role of RFC regulation across the crypt–villus axis during alcoholism was evaluated It was observed that the apical membrane folate transport activity was greatest in differentiated upper villus cells, followed by differentiating mid-villus cells, and lowest in proliferating cells, and the proportional distribution of the RFC protein was found along the entire crypt–villus axis These results were in accordance with earlier studies [27], where a similar RFC distribution was shown to exist across the crypt–villus axis Importantly, chronic ethanol feeding decreased RFC protein expression along the entire crypt–villus axis In addition, the higher level of RFC protein in villus tip cells suggests that a larger number of folate transporters are expressed at the villus tip and that the redistribution of RFC occurs with the maturation of intestinal stem cells Such findings correlate with the observed higher rate of folate uptake in villus tip cells relative to crypt base cells A similar distribution has been reported previously for biotin uptake [28] Consistent with immunoblot analysis, immunohistochemical staining revealed RFC localization along the entire crypt–villus axis; moreover, staining was significantly more intense in epithelial cells lining the villus tip and decreased towards the crypt–villus junction in the control group A stronger expression was observed towards the enterocyte BBM In the chronic ethanolfed group, RFC was evident at the villus tip, decreased significantly in the mid-villus and was hardly noticeable in the crypt base However, only a few positive cells along the villus tip and mid-villus could be seen during immunohistochemical staining Thus, chronic ethanol feeding imparts its effect more strongly in proliferating and differentiating cells in the context of RFC recruitment in the intestine Such a condition is detrimental to the cell and represents the severe pathophysiological condition in alcoholics, not only with respect to body folate homeostasis, but also because crypt cells form the intestinal stem cells and require regulated RFC expression for the sustained supply of folate to meet the burden of the high proliferation and turnover of these cells Importantly, there was no change in the villus architecture during ethanol ingestion, suggesting that the observed reduced folate uptake is a specific effect of ethanol, rather than a secondary effect caused by a general loss of intestinal epithelial architecture Furthermore, the significant decrease in serum and RBC folate levels in the ethanol-fed group in this study was an expected finding, as FEBS Journal 274 (2007) 6317–6328 ª 2007 The Authors Journal compilation ª 2007 FEBS 6323 Intestinal folate malabsorption in alcoholism A Hamid et al reduced intestinal folate uptake associated with decreased expression of RFC will influence body folate homeostasis These results may explain indirectly the observations in a recent study [8], where chronic alcohol ingestion for weeks in rats was found to be associated with hyperhomocysteinaemia and lower levels of SAM The low folate levels result in low SAM levels which, in turn, may influence DNA methylation, as reflected by the observed hypomethylated jejunal DNA in alcohol-fed rats Our study is in agreement with that of Choi et al [29], who observed hypomethylation of colonic mucosal DNA in rats after chronic ethanol ingestion, although no systemic folate reduction was observed, by contrast with our study Such a discrepancy may be attributed to the different methods employed for ethanol administration and the restriction of the study to weeks only, in comparison with months in our investigation Regardless of how chronic ethanol ingestion produces genomic DNA hypomethylation of jejunal tissue in rats, it may have implications regarding the mechanism(s) by which chronic alcohol exposure increases the risk of different cancers in humans Taken together, the results show that chronic ethanol ingestion leads to decreased intestinal BBM folic acid uptake and reduced jejunal mRNA levels encoded by RFC, resulting in low RFC protein levels and recruitment along the entire BBM of the crypt–villus axis The decreased transport efficiency of intestinal BBM is reflected in reduced serum and RBC folate levels, which may result in the observed hypomethylation of jejunal DNA Experimental procedures Animals Young adult male albino rats (Wistar strain), weighing 100–150 g, were obtained from the Postgraduate Institute of Medical Education and Research’s Central Animal House (Chandigarh, India) The rats were housed in clean wire mesh cages with controlled temperature (23 ± °C) and humidity (45–55%) and with a 12 h ⁄ 12 h dark ⁄ light cycle throughout the study The rats were randomized into two groups of eight animals each, such that the mean body weights and range of body weights for each group of animals were similar The rats in group I were given gỈkg)1 body weight of ethanol (20% solution) per day for months, and those in group II received an isocaloric amount of sucrose (36% solution) orally by Ryle’s tube daily for months Such a dose does not produce a toxic blood alcohol concentration [21] and is therefore relevant to human studies The rats were fed a commercially available pellet diet (Ashirwad Industries, Chandigarh, India) containing mgỈkg)1 folic acid and water ad libitum The body weights of the rats were recorded twice weekly Animals from both groups were killed under anaesthesia using sodium pentothal, and blood was drawn from the tail vein for alcohol and folate estimations Starting from the ligament of Treitz, two-thirds of the small intestine was removed, flushed with ice-cold saline and processed for the isolation of cells The protocol of the study was approved by the Institutional Animal Ethical Committee (IAEC) and the Institutional Biosafety Committee (IBC) Estimation of blood alcohol levels Chemicals Radiolabelled [3Â,5Â,7,9-3H]folic acid, potassium salt (specic activity, 24.0 Ciặmmol)1) and S-adenosyl[methyl-3H]methionine (specific activity, 70.0 CiỈmmol)1) were purchased from Amersham Pharmacia Biotech (Kwai Chung, Hong Kong) d-[U-14C]Glucose (specific activity, 140 mCiỈmmol)1) was provided by Bhabha Atomic Research Centre, Mumbai, India Prokaryotic CpG DNA methyl transferase was obtained from New England Biolabs (Beverly, MA, USA) A Moloney murine leukaemia virus reverse transcriptase kit (RevertAidTM M-MuLV RT) was purchased from MBI Fermentas Life Sciences (Rockville, MD, USA) RNAlater (RNA stabilization solution) and diethylpyrocarbonate were obtained from Ambion, Inc (Austin, TX, USA) and Amresco (Solon, OH, USA) respectively Methotrexate, bovine serum albumin and d,l-dithiothreitol or Cleland’s reagent were purchased from 6324 Sigma-Aldrich Co (St Louis, MO, USA) Cellulose nitrate membrane filters (0.45 lm) were obtained from Millipore Corporation (Bedford, MA, USA) Alcohol was estimated from whole blood drawn from rats 24 h after the last dose of ethanol at the end of the treatment period using the alcohol dehydrogenase method [30] Isolation of intestinal epithelial cells The intestinal epithelial cells were isolated following the method of Weiser [31] with modifications The upper twothirds of the small intestine was cut and flushed two to three times with 0.9% saline One end of the intestine was tied with a thread and filled with rinsing buffer containing mm d,l-dithiothreitol in normal saline The rinsing buffer was then replaced with a solution consisting of 1.5 mm KCl, 96 mm NaCl, 27 mm sodium citrate, mm KH2PO4 and mm Na2HPO4, and kept at 37 °C for 15 in a beaker containing NaCl ⁄ Pi The intestine was then filled with a solution containing 1.5 mm EDTA and 0.5 mm FEBS Journal 274 (2007) 6317–6328 ª 2007 The Authors Journal compilation ª 2007 FEBS A Hamid et al d,l-dithiothreitol in NaCl ⁄ Pi, and kept at 37 °C in a shaker at 100 r.p.m for 30 min; the solution was then collected for the isolation of total enterocytes Furthermore, small intestinal epithelial cells enriched in enterocytes of different origins along the crypt–villus axis were also isolated In this case, different cell fractions were collected after filling the intestine for different time intervals Fractions 1–3 were collected at 4, and intervals, fractions 4–6 at 3, and intervals, and fractions 7–9 at 7, 10 and 15 intervals Each consecutive three fractions were pooled and represented the villus tip, mid-villus and crypt base cells, respectively The collected cells were centrifuged at 800 g for 15 The pellet contents were mixed with a Pasteur pipette and centrifuged at 800 g for 10 after the addition of mL of cold NaCl ⁄ Pi Two more NaCl ⁄ Pi washings were performed These cells were then used for BBM isolation Preparation of BBMVs from isolated intestinal epithelial cells BBMVs were prepared from isolated total intestinal cells from control and ethanol-fed rats at different time intervals during the course of treatment at °C by the method of Kessler et al [32] with some modifications The final pellet containing cells was homogenized by adding mm Tris)50 mm mannitol buffer, and 10 mm MgCl2 was added to the homogenate followed by intermittent shaking for 10 The contents were centrifuged at 3000 g for 15 and the supernatant was then run at 27 000 g for 30 The pellet thus obtained was suspended in a small amount of loading buffer containing 280 mm mannitol and 20 mm Hepes–Tris, pH 7.4, and centrifuged at 27 000 g for 30 The final pellet obtained was suspended in loading buffer so as to obtain a protein concentration of approximately mgỈmL)1 These BBMVs were used to study [3H]folic acid uptake at 1.5, and months of ethanol treatment Experiments to determine kinetic constants and western blot analysis were carried out using BBMV preparations from rats fed ethanol for months BBMVs were also isolated from cells representing the villus tip, mid-villus and crypt base from rats sacrificed at the end of treatment The respective cell fractions from two animals were pooled for this purpose to obtain sufficient BBMVs These BBMVs were used to determine [3H]folic acid uptake across the crypt–villus axis and to analyse the RFC protein levels in different cell types Assessment of morphological purity of membrane vesicles by transmission electron microscopy The final BBMV preparations obtained were suspended in NaCl ⁄ Pi and centrifuged at 27 000 g for 30 Vesicular suspensions were fixed at °C in 3% buffered glutaralde- Intestinal folate malabsorption in alcoholism hyde for 5–6 h and centrifuged at 10 000 g for 10 Suspensions were gently rinsed twice with 0.2 m NaCl ⁄ Pi at °C and postfixed for h at °C with 1% buffered osmium tetroxide After dehydration in 70%, 90% and absolute ethanol for h, 20 and h, respectively, the suspensions were treated with propylene oxide at room temperature The preparations were embedded in epoxy resin TAAB-812 (TAAB Laboratories, Aldermaston, UK) and polymerized for 24 h at 60 °C Semi-thin sections were placed on microslides, stained with 0.5% alkaline toluidine blue and examined under a light microscope to verify the areas of intensity Ultrathin sections (60 nm) were cut, placed on metal grids, stained on ultracut E (Reichert-Jung, Nuslock, Germany) and double stained with uranyl acetate and lead citrate The microslides were then examined under a Zeiss EM-906 transmission electron microscope (Carl Zeiss, Dresden, Germany) Transport of [3H]folic acid Uptake studies were performed at 37 °C using incubation buffer containing 100 mm NaCl, 80 mm mannitol, 10 mm Hepes, 10 mm 2-morpholinoethanesulfonic acid, pH 5.5, and 0.5 lm [3H]folic acid, unless otherwise noted Isolated BBMVs (10 lL; 50 lg protein) from control and ethanolfed rats were added to incubation buffer containing [3H]folic acid of known concentration for different specific assays Reaction was stopped by the addition of ice-cold stop solution containing 280 mm mannitol and 20 mm Hepes–Tris, pH 7.4, followed by rapid vacuum filtration Nonspecific binding to the filters was determined by residual filter counts after filtration of the incubation buffer and labelled substrate without vesicles [33,34] The radioactivity retained by the filters was determined by liquid scintillation counting (Beckman Coulter LS 6500, Beckman Coulter, Fullerton, CA, USA) For the determination of the kinetic constants Km and Vmax, transport of [3H]folic acid was measured by varying the concentration of [3H]folic acid from 0.125 to 1.50 lm in the incubation buffer at pH 5.5 RT-PCR analysis Total RNA from all animals was isolated from the upper cm of jejunal tissues following the method of Chomeczynski and Sacchi [35] cDNA synthesis was carried out from the purified and intact total RNA, according to the manufacturer’s instructions (MBI Life Sciences) Expression of RFC and b-actin was evaluated using sequence-specific primers corresponding to the sequence in the open reading frame A 20 lL PCR mixture was prepared in · PCR buffer consisting of 0.6 U of Taq polymerase, lm of each primer (for both b-actin and RFC) and 200 lm of each dNTP In optimized PCR, the initial denaturation step was carried out for at 95 °C The denaturation, annealing FEBS Journal 274 (2007) 6317–6328 ª 2007 The Authors Journal compilation ª 2007 FEBS 6325 Intestinal folate malabsorption in alcoholism A Hamid et al and elongation steps were carried out for at 94 °C, at 68 °C and at 72 °C, respectively, for 35 cycles The final extension step was carried out for 10 at 72 °C The primers designed using primer3 input (version 0.3.0) were as follows: RFC: forward, 5¢GAACGTCCGGCAACCACAG3¢; reverse, 5¢GATGGACTTGGAGGCCCAG3¢; b-actin: forward, 5¢CACTGTGCCCATCTATGAGGG3¢; reverse, 5¢TCCACATCTGCTGGAAGGTGG3¢ The expected PCR products of 489 and 588 bp were obtained for RFC and b-actin, respectively, when electrophoresed on a 1.2% agarose gel The densitometric analyses of the products were determined using scion image software (Scion Image Corporation, Frederick, MD, USA) Estimation of folate by microbiological assay Folate estimations were determined by micotitre plate assay using Lactobacillus casei [39] All steps were carried out in aseptic conditions Genomic DNA methylation studies DNA isolation was performed by the conventional method using a lysis buffer containing proteinase K, as described previously [29] The methylation status of CpG sites in genomic DNA was determined by the in vitro methyl acceptance capacity of DNA using S-adenosyl-[methyl-3H]methionine as a methyl donor and a prokaryotic CpG DNA methyltransferase [40] Western blot analysis For protein expression studies, BBMVs (100–150 lg) isolated from epithelial cell preparations (either total cells or different cell fractions) were resolved by 10% SDS ⁄ PAGE and transferred to nitrocellulose membrane for 4–5 h at °C (transfer at 25 V and 300 mA) Western blotting was performed using the procedure described by Towbin et al [36], employing polyclonal primary antibodies (rabbit anti-rat RFC, : 500 dilution) kindly provided by H M Said (University of California, Irvine, USA) These were raised against a specific region of rat RFC synthetic peptide corresponding to amino acids 495– 512 The polyclonal antibodies against LAP, an intestinal brush border peptidase, were rabbit anti-rat LAP (1 : 500 dilution) Secondary antibodies were goat anti-rabbit IgG [horseradish peroxidase (HRP)-labelled] (1 : 2000 dilution) Blot quantification was carried out using scion image software Immunohistochemical analysis Freshly cut intestinal jejunal sections were cut into cm pieces and slit open, followed by fixing in a sufficient amount of 10% formalin [37] using primary antibodies [rabbit polyclonal anti-rat RFC (1 : 100)] and secondary antibodies [goat anti-rabbit IgG (HRP-labelled) (1 : 500)] Haematoxylin was employed for counterstaining Haematoxylin–eosin staining Haematoxylin–eosin staining was carried out following the routine histological method described by Kayser and Bubenzer [38] The haematoxylin–eosin staining technique employs haematoxylin, which is a basic dye and stains acidic components, such as nucleoproteins and mucopolysaccharides, and eosin, which is an acidic dye and stains the basic components present in cytoplasmic proteins 6326 Statistics Each uptake assay was performed three times with eight independent preparations from each group The data were computed as the mean ± standard deviation Group means were compared using Student’s t-test, and analysis of variance was used when necessary The acceptable level of significance was P < 0.05 for each analysis Acknowledgements Financial assistance by the Council of Scientific and Industrial Research (CSIR), New Delhi, India is gratefully acknowledged References Suh JR, Herbig AK & Stover PJ (2001) New perspectives on folate catabolism Annu Rev Nutr 21, 255–282 Balamurugan K & Said HM (2006) Role of reduced folate carrier in intestinal folate uptake Am J Physiol Cell Physiol 291, C189–C193 Zhao R & Goldman ID (2003) Resistance to antifolates Oncogene 22, 7431–7457 Sabharanjak S & Mayor S (2004) Folate receptor endocytosis and trafficking Adv Drug Deliv Rev 56, 1099– 1109 Kumar CK, Nguyen TT, Gonzales FB & Said HM (1998) Comparison of intestinal folate carrier clone expressed in IEC-6 cells and in Xenopus oocytes Am J Physiol Cell Physiol 274, C289–C294 Zhang L, Wong SC & Matherly LH (1998) Transcript heterogeneity of the human reduced folate carrier results from the use of multiple promoters and variable splicing of alternative upstream exons Biochem J 332, 773–780 Novakovic P, Stempak JM, Sohn KJ & Kim YI (2006) Effects of folate deficiency on gene expression in the FEBS Journal 274 (2007) 6317–6328 ª 2007 The Authors Journal compilation ª 2007 FEBS A Hamid et al 10 11 12 13 14 15 16 17 18 19 20 21 apoptosis and cancer pathways in colon cancer cells Carcinogenesis 27, 916–924 Sakuta H & Suzuki T (2005) Alcohol consumption and plasma homocysteine Alcohol 37, 73–77 Yi P, Melnyk S, Pogribna M, Pogribny IP, Hine RJ & James SJ (2000) Increase in plasma homocysteine associated with parallel increases in plasma S-adenosylhomocysteine and lymphocyte DNA hypomethylation J Biol Chem 275, 29318–29323 Schalinske KL & Nieman KM (2005) Disruption of methyl group metabolism by ethanol Nutr Rev 63, 387– 391 Villanueva J, Chandler CJ, Shimasaki N, Tang AB, Nakamura M, Phinney SD & Halsted CH (1994) Effects of ethanol feeding on liver, kidney and jejunal membranes of micropigs Hepatology 19, 1229–1240 Halsted CH, Robles EA & Mezey E (1971) Decreased jejunal uptake of labeled folic acid (3H-PGA) in alcoholic patients: roles of alcohol and nutrition N Engl J Med 285, 701–706 Mason JB & Choi SW (2005) Effects of alcohol on folate metabolism: implications for carcinogenesis Alcohol 35, 235–241 Purohit V, Abdelmalek MF, Barve S, Benevenga NJ, Halsted CH, Kaplowitz N, Kharbanda KK, Liu QY, Lu SC, McClain CJ, et al (2007) Role of S-adenosylmethionine, folate, and betaine in the treatment of alcoholic liver disease: summary of a symposium Am J Clin Nutr 86, 14–24 Hamid A, Kaur J & Mahmood A (2007) Evaluation of the kinetic properties of the folate transport system in intestinal absorptive epithelium during experimental ethanol ingestion Mol Cell Biochem 304, 265–271 Kaushik S & Kaur J (2005) Effect of chronic cold stress on intestinal epithelial cell proliferation and inflammation in rats Stress 8, 191–197 Said HM, Chatterjee N, Haq RU, Subramanian VS, Ortiz A, Matherly LH, Sirotnak FM, Halsted C & Rubin SA (2000) Adaptive regulation of intestinal folate uptake: effect of dietary folate deficiency Am J Physiol Cell Physiol 179, C1889–C1895 Kaur J, Virender Jaswal MS, Nagpaul JP & Mahmood A (1992) Chronic ethanol feeding and microvillus membrane glycosylation in normal and protein malnourished rat intestine Nutrition 8, 338–342 Kaur J, Nagpaul JP & Mahmood A (1994) Expression of brush border enzymes in ethanol fed rat intestine Indian J Med Res 100, 289–294 Villanueva JA, Devlin AM & Halsted CH (2001) Reduced folate carrier: tissue distribution and effects of chronic ethanol intake in the micropig Alcohol Clin Exp Res 25, 415–420 Persson J (1991) Alcohol and the small intestine Scand J Gastroenterol 26, 3–15 Intestinal folate malabsorption in alcoholism 22 Muldoon RT & McMartin KE (1994) Ethanol acutely impairs the renal conservation of 5-methyltetrahydrofolate in the isolated perfused rat kidney Alcohol Clin Exp Res 18, 333–339 23 Matherly LH, Hou Z & Deng Y (2007) Human reduced folate carrier: translation of basic biology to cancer etiology and therapy Cancer Metastasis Rev 26, 111–128 24 Qiu A, Jansen M, Sakaris A, Min SH, Chattopadhyay S, Tsai E, Sandoval C, Zhao R, Akabas MH & Goldman ID (2006) Identification of an intestinal folate transporter and the molecular basis for hereditary folate malabsorption Cell 127, 917–928 25 Said HM (2004) Recent advances in carrier-mediated intestinal absorption of water-soluble vitamins Annu Rev Physiol 66, 419–446 26 Subramanian VS, Chatterjee N & Said HM (2003) Folate uptake in the human intestine: promoter activity and effect of folate deficiency J Cell Physiol 196, 403– 408 27 Balamurugan K & Said HM (2003) Ontogenic regulation of folate transport across rat jejunal brush-border membrane Am J Physiol Gastrointest Liver Physiol 285, G1068–G1073 28 Chatterjee NS, Kumar CK, Ortiz A, Rubin SA & Said HM (1999) Molecular mechanism of the intestinal biotin transport process Am J Physiol Cell Physiol 277, C605–C613 29 Choi SW, Stickel F, Baik HW, Kim YI, Seitz HK & Mason JB (1999) Chronic alcohol consumption induces genomic but not p53-specific DNA hypomethylation in rat colon J Nutr 129, 1945–1950 30 Burtis CA & Ashwood ER (1994) Textbook of Clinical Chemistry, 2nd edn W.B Saunders Co, Philadelphia, PA 31 Weiser MM (1973) Intestinal epithelial cell surface membrane glycoprotein synthesis I An indicator of cellular differentiation J Biol Chem 248, 2536–2541 32 Kessler M, Acuto O, Storelli C, Murer H, Muller M & Samenza G (1978) A modified procedure for the rapid preparation of efficiently transporting vesicles from small intestinal brush border membranes Their use in investigating some properties of d-glucose and choline transport Biochim Biophys Acta 506, 136–154 33 Hamid A & Kaur J (2005) Kinetic characteristics of folate binding to rat renal brush border membrane in chronic alcoholism Mol Cell Biochem 280, 219–225 34 Hamid A & Kaur J (2006) Chronic alcoholism alters the transport characteristics of folate in rat renal brush border membrane Alcohol 38, 59–66 35 Chomeczynski P & Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate– phenol–chloroform extraction Anal Biochem 162, 156–159 FEBS Journal 274 (2007) 6317–6328 ª 2007 The Authors Journal compilation ª 2007 FEBS 6327 Intestinal folate malabsorption in alcoholism A Hamid et al 36 Towbin H, Staehelin T & Gordon J (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications Proc Natl Acad Sci USA 76, 4350–4354 37 Zhang Y, Shao JS, Xie QM & Alpers DH (1996) Immunolocalization of alkaline phosphatase and surfactantlike particle proteins in rat duodenum during fat absorption Gastroenterology 110, 478–488 38 Kayser K & Bubenzer J (1990) Microwave-assisted staining procedures in routine histopathology Histochemistry J22, 365–370 6328 39 Tamura T (1990) Microbiological assay of folates In Folic Acid Metabolism in Health and Disease (Picciano MF, Stokstad ELR & Gregory JF, eds), pp 121–137 Wiley-Liss, New York 40 Kim YI, Christman JK, Fleet JC, Cravo ML, Salomon RN, Smith D, Ordovas J, Selhub J & Mason JB (1995) Moderate folate deficiency does not cause global hypomethylation of hepatic and colonic DNA or c-myc-specific hypomethylation of colonic DNA in rats Am J Clin Nutr 61, 1083–1090 FEBS Journal 274 (2007) 6317–6328 ª 2007 The Authors Journal compilation ª 2007 FEBS ... mechanisms of regulation of folate malabsorption during chronic alcoholism Under chronic alcoholic conditions, the kinetic constants of the folate transport process in intestinal brush border membrane. .. the intestinal membrane [12,20] In a rat model of experimental alcoholism, we examined the mechanism of the regulation of folate transport mediated by RFC, the major folate transporter protein in. .. decrease in the degree of methylation of DNA in chronic ethanolfed rats 6322 Chronic alcoholism is often associated with folate deficiency, which is mainly a result of malabsorption of folate across