0
  1. Trang chủ >
  2. Kỹ Thuật - Công Nghệ >
  3. Điện - Điện tử >

Sensor-based navigation of a mobile robot in an indoor environment

Sensor-based navigation of a mobile robot in an indoor environment

Sensor-based navigation of a mobile robot in an indoor environment

... Conclusion We are interested in the navigation of a mobile robot in partially known environment such as inside an of- fice or a flat. In such cases, a plan of the evolution zone of the robot containing most ... including the unknown obstacle in the data base and starting again the plan- ning [15]. In fact the main penalization due to un- known obstacles is the decreasing of the linear speed of the robot. ... processing inaccurate and uncertain data with application to autonomous mobile robot and sensorial fusion. C. Barret was born in Marseille, France, in 1946. He obtained the Aggregation degree in Applied...
  • 18
  • 431
  • 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... 5¢-d(TCAGAAATTAAAGCGGATGCATTATTTGCATG)-3¢.The upstream primer containing the NdeI restriction site(underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAAAAAATTG)-3¢ and the downstream primer containing ... Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphataseKonstantinos Mavromatis1,*, Iason Tsigos2,*, Maria Tzanodaskalaki2, Michael Kokkinidis1,3and Vassilis ... Gly262 to Ala, upperprimer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAATGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCACCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper primer5¢-d(TAATGCATCCGCTTTAATTTCTGAAATTAATG)-3¢,...
  • 6
  • 488
  • 0
Management of pulmonary tuberculosis patients in an urban setting in Zambia: a patient’s perspective ppt

Management of pulmonary tuberculosis patients in an urban setting in Zambia: a patient’s perspective ppt

... RESEARC H ARTIC LE Open AccessManagement of pulmonary tuberculosispatients in an urban setting in Zambia: a patient’s perspectiveChanda Mulenga1,2*, David Mwakazanga1, Kim Vereecken3, ... TheNational TB and Leprosy Control Programme. Ministry of Health, Lusaka,Zambia.7. Kaona FA, Tuba M, Siziya S, Sikaona L: An assessment of factorscontributing to treatment adherence and knowledge ... the health centre. Patient education is an impor-tant aspect of TB treatme nt management and is alsoincluded in the guidelines to improve cure rates andcompliance. Further, as part of patient...
  • 8
  • 612
  • 0
The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

... Finally, reducing transport offers some additional, if smaller, potential for E and GHG gains (and again data for the Canadian food system is lacking) and a significant body of literature has ... study of comparative grain management systems in Michigan, found the enhanced ‗substrate diversity‘ of a transitional organic management system that combined green manures and compost enhanced ... Australia using an LCA analyses considered three scenarios; (1) a sheep meat supply chain in Western Australia, (2) a beef supply chain in Victoria, Australia producing organic beef, and (3) a...
  • 41
  • 524
  • 1
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... considered the same parameters defined in Tables 1 and 2 in Software RETScreen International Clean Energy Project Analysis in order to make an analysis of economic and financial viability of wind energy ... Product Database. The economic and financial evaluation of the wind farm is made by the software RETScreen® International Clean Energy Project Analysis and the indicators calculated are WACC, NPV,...
  • 14
  • 416
  • 1
Writing a Simple Program in an Assembly Language

Writing a Simple Program in an Assembly Language

... a program directly with machine language. For this reason, assembly language is used since it enables machine language to be expressed in easily understandable alphabets. For example, a machine ... write as follows to prepare a separate section for storing the addition results in: .SECTION ROM_DATA,DATA,LOCATE=H'1100 DATA1: .DATA.B 10 DATA2: .DATA.B 100 .SECTION RAM_DATA,DATA,LOCATE=H'2000 ... s a s . c o m Page 29 Chapter 4 Writing a Simple Program in an Assembly Language This chapter gives an overview of a program developed in an assembly language used by the H8/300H. Only basic instructions...
  • 24
  • 533
  • 0
Managing and Practicing OD in an IT Environment - A Structured Approach to Developing IT Project Teams

Managing and Practicing OD in an IT Environment - A Structured Approach to Developing IT Project Teams

... scheduleslips and turnover among the team. The database analysts and theprogrammers are unable to agree on the proper ways to pass informationback and forth between the interface and the database, and ... with a system forcapturing and reinvesting IT project savings in a measurable way.IT and the projects that create it are going to be an increasingly integral part of modern life in the years ... Boeing 747 in full flight. The structuredframework of teambuilding, organizational alignment, and organizational learn-ing attempts to do a better job of painting the airplane while keeping...
  • 33
  • 566
  • 0
Luận văn english prepositions of place at, on, in an analysis of errors made by secondary school students

Luận văn english prepositions of place at, on, in an analysis of errors made by secondary school students

... greatest sweet eaters in the world- AT is used before the particular name of a building or organizatione.g: She works at Legal and general Insurance But: She works in an insurance companySometimes, ... There's a drop of paint on the window in the window/mirror I see my face in the windowon the island Robinson Crusoe was marooned on an inhabited island in the island He was born in Long Islandon ... language learners. Corder, in his serminal1967 paper, made the point that errors are evidence of what the learners have taken in (intake) rather than what teachers think they have put in (input)....
  • 46
  • 1,351
  • 18
Tài liệu Building a RISC System in an FPGA ppt

Tài liệu Building a RISC System in an FPGA ppt

... jump and branch-taken take three cycles (no branchListing 1—This sample C code declares a binary search tree data structure and defines a binary searchfunction. Search returns a pointer ... using a jump. Because insert-ing a jump may make other branchesfar, we repeat until no far branchesremain.Next, we evaluate fixups. For eachone, we look up the target address andapply that ... the datapath area be-cause the adder, with the immediatemux, can do the effective address add,and the PC incrementer can also addbranch displacements. The memoryaddress mux can help load the...
  • 7
  • 401
  • 3

Xem thêm

Từ khóa: the role of a security manager in enhancing security in an organizationmodeling by a mobile robotthe balance of payments always balances in an accounting sense discussthe security account manager failed a kdc request in an unexpected way 0x0the security account manager failed a kdc request in an unexpected way 0x800the security account manager failed a kdc request in an unexpected way 0x208Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Chuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP