Power generation from wind turbines in a solar chimney
Power generation from wind turbines in a solar chimney
... that shrouded wind turbines can generate greater power compared to bare turbines. A solar chimney generates an upward draft of wind inside a tower and a shroud around the wind turbine. There are ... Betz's limit; Solar chimney. 1. Introduction In past several years, several studies have shown that the shrouded wind turbines can generate greater power compared to bare turbines. A solar chimney ... & Environment Foundation. All rights reserved. Power generation from wind turbines in a solar chimney Tudor Foote 1 , Ramesh K. Agarwal 2 1 Graduate Student, Department of Mechanical Engineering...
- 12
- 460
- 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
... Horizontal-axis wind turbines (HAWT); Vertical-axis wind turbines (VAWT). 1. Introduction With increased emphasis on wind power generation worldwide, the optimal placement of large number of wind- turbines ... USA. Abstract In this paper, we consider the Wind Farm layout optimization problem using a genetic algorithm. Both the Horizontal –Axis Wind Turbines (HAWT) and Vertical-Axis Wind Turbines (VAWT) ... Mechanical Engineering from Shanghai Jiao Tong University in China in 2008 and M.S. in Mechanical Engineering from Washington University in St. Louis in 2010. Xiaomin's research focuses on wind...
- 12
- 635
- 1
Báo cáo khoa học: "Multilingual Lexical Database Generation from parallel texts in 20 European languages" pptx
... processing of bilingual and multilingual corpora Processing bilingual and multilingual corpora constitutes a major area of investigation in natu-ral language processing. The linguistic and trans-lational ... Paradigms and Grounding in Natural Language Learning, pages 295-299, PaGNLL Adelaide. Gale W .A. & K.W. Church. 199 1a. Identifying word correspondences in parallel texts. In Fourth DARPA ... DARPA Speech and Natural Language Workshop, p. 152-157. San Mateo, California: Morgan Kauf-mann. Gale W .A. & Church K. W. 1991b. A Program for Aligning Sentences in Bilingual Corpora. In...
- 8
- 346
- 0
Prospects of concentrating solar power to deliver key energy services in a developing country
... journal publications in international journals, 15 announcements in international conferences and articles published in magazines and books. E-mail address: chkara@epu.ntua.gr Charalampos ... excess installed capacity available within the SING grid [11]. In this case again creating (additional) interconnections either national (SIC grid) or international (i.e. to Bolivia, Peru and/or Argentina) ... significant potential for satisfying other demands as well, such as processing heat for industry, co-generating of heating, cooling and power, water desalination, household cooking and small-scale...
- 12
- 491
- 0
Báo cáo khoa học: "LANGUAGE SYNTHESIS GENERATION OF GERMAN FROM CONCEPTUAL STRUCTURE: MT PROJECT IN A JAPANESE/GERMAN" pot
... Winograd's terminology for functional gran~nar (Winograd, 1983). In general, case schemata will be mapped into CLAUSE-RS and concept schemata are mapped into NP-R~. A CLAUSE-RS has a ... representation as an interlingua in a practical application will be investigated and demonstrated by translating titles of Japanese papers from the field of "Information Technology". This material ... to ATLAS/II's analysis. In stage i, we first examine those semantic symbols which have an attached case schema and instantiate them according to their trans- formation rules. In this...
- 4
- 358
- 0
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
... (5) and insufficient (6). Y-axis: Percentage of patients Panel A: AVNRT. Panel B: AVRT. Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying ... Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized Ratio; ... AVNRT-, AVRT-and EAT patients. Panel A: Quantity and duration of episodes and the associated symptoms. Panel B: Detraction in daily life generally and in parts of daily life. AVNRT AVRT EAT variable...
- 9
- 679
- 0
DETOXIFICATION OF TRICHLOROETHYLENE (TCE) USING SOLAR LIGHT/TiO2 IN A UV CONCENTRATING RADIATION SYSTEM
... degraded in 3 to 4 hours of solar light illumination. Photocatalytic degradation of TCE increased linearly with increasing sunlight intensity. The degradation of TCE also increased with increasing ... They are readily removed from groundwater using well pump in one-pass solar detoxification system (Pacheco et al., 1993) and contaminated surface water can be treated in a UV concentrating radiation ... rapid, capable of simultaneously degrading a wide range of contaminants, and potentially cost competitive with existing technologies (Vidal et al., 1999). TiO 2 (anatase) has an energy bandgap...
- 6
- 392
- 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... MF gacccgatgttcaagatact Saito et al., 2003b MR ctcctcccacaaatcaggac QMF agacgcacgctcacctcaa in this study QMR gagcagttcacgaaatcc QMT (Probe) atacgctcttactgtttccggccgcc BACT1369F cggtgaatacgttcycgg ... MATERIAL AND METHODS Bacterial strains and cultivation Table 1 shows the strains examined in this study. MD-1 strain was isolated from Lake Kasumigaura in Japan (Saito et al., 200 3a) . MD-1 strain ... were taken from a biological contact material, honeycomb catalyst, of a practical biological treatment facility a drinking water treatment plant influent from Lake Kasumigaura—every month from...
- 9
- 522
- 0
Optimum sizing of steam turbines for concentrated solar power plants
... results indicate that by increasing the capacity of the plant, the steam inlet pressure of the turbine at which maximum efficiency can be obtained increases up to a capacity of 50MWe and then remains ... are suitable in areas with high solar irradiance. CSP plants offer a noticeable advantage when compared to photovoltaics (PVs), as large amounts of thermal energy can be stored easily with minimal ... receiver row is shared among several rows of mirrors. This can lead to the increased effect of shading of incoming solar radiation and blocking of reflected solar radiation by adjacent reflectors....
- 10
- 497
- 0
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal
... and availability of wind resources in the macro defined location for the installation of central power generation, Caldas da Rainha, Portugal. The assessment of wind resources and availability ... Climate Database and Retscreen Product Database. The economic and financial evaluation of the wind farm is made by the software RETScreen® International Clean Energy Project Analysis and the indicators ... economic assessment of hypothetical wind farm installed in Caldas da Rainha, we obtained the following results: Table 3. Economic and financial indicators of the current scenario Indicators...
- 14
- 416
- 1
Từ khóa: displaying an image from a database in a web forms controlfrom my point of view in a sentencewindows xp in a snapsecurity exams in a nutshellfree nucleotides in living cells play important roles in a variety of biological reactionsthe hypothalamic neuropeptides modulate physiological activity via g proteincoupled receptors gpcrs galaninlike peptide galp is a 60 amino acid neuropeptide that was originally isolated from porcine hypothalamus using a binding assay for galanin recepNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ