IAS 36 Impairment of Assets
Application of IAS 36 Impairment of fixed assets
... impairment of fixed assets and concretely shows challenging areas for companies within IAS 36 in practice We want to increase the understanding about impairment of fixed assets according to IAS ... however impairment of fixed assets is still an interesting area It can be perceived that valuation of fixed assets is not as problematic as valuation of intangible assets, but the two types of assets ... asset needs to be changed (IAS 36: 17) Depreciation of fixed assets is regulated by IAS 16 (IAS 16:1) 3.4 Measuring Recoverable Amount IAS 36 describes how recoverable amount of an asset shall be calculated...
- 42
- 346
- 0
Management ownership structure, audit quality and impairment of assets--evidence from China
... of Audit Quality in China 1.2 Objectives of the Thesis 1.3 Contributions of the Thesis 10 1.4 Organization of the Thesis 11 Chapter State Ownership, Audit Quality and Earnings Management in China ... me; And as You did not lose them in the giving, so I not lose them in the return." Management Ownership Structure, Audit Quality and Impairment of Assets - Evidence from China Certificate of Originality ... Role of Accounting Standards in Conservative Financial Reporting in China 1.1.3 Significance of State Ownership 1.1.4 Significance of State Ownership in China 1.1.5 Significance of Audit Quality...
- 259
- 335
- 0
Tài liệu Chuẩn mực kế toán quốc tế IAS 36 pptx
... APPROVAL OF IAS 36 BY THE BOARD BASIS FOR CONCLUSIONS DISSENTING OPINIONS ILLUSTRATIVE EXAMPLES © IASCF 1671 IAS 36 International Accounting Standard 36 Impairment of Assets (IAS 36) is set out ... applied for that earlier period Withdrawal of IAS 36 (issued 1998) 141 1708 This Standard supersedes IAS 36 Impairment of Assets (issued in 1998) © IASCF IAS 36 Appendix A Using present value techniques ... defined in IAS 27 Consolidated and Separate Financial Statements; © IASCF IAS 36 (b) associates, as defined in IAS 28 Investments in Associates; and (c) joint ventures, as defined in IAS 31 Interests...
- 155
- 2,492
- 11
Báo cáo khoa học: Haptoglobin binds the antiatherogenic protein apolipoprotein E – impairment of apolipoprotein E stimulation of both lecithin:cholesterol acyltransferase activity and cholesterol uptake by hepatocytes pdf
... triplicate The data are reported as percentage of the value obtained by incubation of Hpt alone, and expressed as mean ± SEM A single representative of at least three independent experiments is ... respectively After incubation, the cell were lysed for measurement of their radioactivity and protein concentration The amount of cholesterol internalized by the cells is expressed as dpm per mg of cell ... system The samples were analysed in triplicate The data are reported as percentage of the value obtained by incubation of Hpt alone, and expressed as mean ± SEM In each panel, a single representative...
- 14
- 445
- 0
Báo cáo khoa học: Thrombin-mediated impairment of fibroblast growth factor-2 activity doc
... signal after 120 of incubation The strong loss of function and loss of integrity observed after 60 of incubation agree with the almost complete inhibition of mitogenic activity of FGF (Fig 1B) ... parallels the functional impairment of FGF-2 in the presence of different time points of thrombin incubation Structural impairment is expressed as time-dependent decrease of the peak eluting at ... function of time of exposure to thrombin Figure 8B shows that increasing times of FGF-2 ⁄ thrombin incubation strongly reduced both the integrity of FGF-2 (expressed as a percentage of peak area...
- 13
- 345
- 0
Báo cáo khoa học: Modular kinetic analysis reveals differences in Cd2+ and Cu2+ ion-induced impairment of oxidative phosphorylation in liver pot
... Three -modular kinetic analysis of effects of Cd2+ and Cu2+ ions on oxidative phosphorylation Bimodulular kinetic analysis of the effects of Cd2+ and Cu2+ ions on oxidative phosphorylation To determine ... Effect of Cd2+ and Cu2+ ions on the kinetics of the CoQ-reducing and CoQoxidizing modules Effect of Cd2+ on the kinetics of the CoQ-oxidizing module (A) and CoQ-reducing module (B) Effect of Cu2+ ... which oxidative phosphorylation components were affected by Cd2+ and Cu2+ ions in liver mitochondria oxidizing succinate, we first used threemodular kinetic analysis with Dw as the connecting intermediate...
- 13
- 419
- 0
Báo cáo khoa học: Impairment of mitochondrial function by minocycline pptx
... matrix Mg2+ Depletion of Mg2+ from RLM could be explained by the high lipophilicity of MC (chloroform ⁄ water partition coefficient of 30 at pH 7.4 [24]) and the ability of MC to chelate bivalent ... propose that MC impairs the function of isolated mitochondria by two distinct mechanisms: (a) it depletes mitochondria of endogenous Mg2+, thereby inducing permeability of the IMM to K+ and Cl); ... centrifugation of the mitochondrial suspension (10 000 g for min), the mitochondrial pellet was resuspended in 450 lL of the isolation medium Aliquots of MgG-loaded RLM (0.2 mg of protein) were...
- 10
- 473
- 0
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf
... administered either by the IN or ID route IN inoculation of mice with the WR strain of VV has been shown to cause respiratory tract infection followed by dissemination of the virus to various visceral ... it is not the virus bearing the epitope nor local virus replication that results in the decreased functionality of CD8+ CTL in lungs, but rather the pulmonary site of residence of the cells Therefore, ... CTL in the lungs is not associated with a specific virus, since the effect was observed after infection with each of the three viruses used This point is further validated by the observation that...
- 8
- 381
- 0
Báo cáo y học: " Impairment of chondrocyte biosynthetic activity by exposure to 3-tesla high-field magnetic resonance imaging is temporar" pptx
... flow of electrolytes and charges that ultimately impair cartilage activity This assumption is fostered by our observations of a marked decrease in anabolic activity, as shown by sGAG synthesis ... proteoglycan synthesis of human articular chondrocytes: the role of nonenzymatic glycation Arthritis Rheum 1999, 42:1003-1009 48 Schafer SJ, Luyten FP, Yanagishita M, Reddi AH: Proteoglycan metabolism ... and catabolic activity led us to speculate that a high-energy EMF may to some extent compromise the biosynthetic activity and/or function of articular chondrocytes Although it is known that mechanical...
- 11
- 419
- 0
Báo cáo khoa học: " Ramipril mitigates radiation-induced impairment of neurogenesis in the rat dentate gyrus" potx
... acutely affecting the rate of neurogenesis within the SGZ and might therefore play a role in maintaining the basal rate of neurogenesis as well [40] The mitigating effects of ramipril following 10 GyWBI ... of Ang I to Ang II, or by antagonizing the binding of Ang II with either of its receptor subtypes [23] Using the ACEi, ramipril, we previously reported that chronic ramipril administration, initiated ... within the designated fields Counts of Ki-67 + proliferating cells were performed within the SGZ (defined as the region extending 25 μm on either side of the border between the hilus and the...
- 8
- 327
- 0
báo cáo khoa học: " The extent of the psychological impairment of prosthodontic outpatients at a German University Hospital" doc
... in approximately one third of the evaluated patients of both the POC and the TMD/ OFPOC the psychological impairment reached values that were located in the range of psychotherapeutic outpatients ... using the Mann-Whitney U test, the adequate statistical values are the mean ranks and the sum of ranks However, to improve the comparability of the obtained results, data are presented as means and ... care at the TMD/Orofacial Pain Outpatient Clinic (TMD/OFPOC) at the same university We examined sociodemographic data, self-reported somatic complaints, and psychological impairment The hypothesis...
- 8
- 216
- 0
Báo cáo y học: " Caseous calcification of the mitral annulus with mitral regurgitation and impairment of functional capacity: a case report" doc
... clinical and TTE followup yearly The noteworthiness of the case reported in this manuscript is that the patient had impairment of functional capacity (NYHA III functional class) and CCMA was responsible ... 2:205 because of co-existent mitral valve dysfunction In the latter situation it can be hypothesized that massive calcification may modify mitral annular dynamics and compromise the mitral leaflets' ... presentations The lack of a large amount of calcification and its location at the mitral- aortic fibrosa, sometimes with systolic flow in the cavity visualized by colour Doppler, are characteristics of a mitral...
- 4
- 344
- 0
Báo cáo y học: "Impairment of alternative splice sites defining a novel gammaretroviral exon within gag modifies the oncogenic properties of Akv murine leukemia virus" pdf
... CCTCTGATCTATATAACTGGAAAAATAATAATCCTTCCTTCTCTGAG GAT -AAAGAG GTAGGAA Akv- CD CCAGCGATCTATATAACTGGAAAAATAATAATCCATCATTCAGTGAA GAT -AAAGAG GTAGGAA Akv- EH CCTCTGATCTATATAACTGGAAAAATAATAATCCTTCCTTCTCTGAG ... 44 Akv- EH Akv- EH Akv wt Akv- EH Akv wt Akv- CD Akv- EH Akv- CD Akv wt Akv wt Akv- CD Akv wt Akv wt Akv wt Akv wt Akv wt Akv- CD Akv- CDH Akv- CDH Akv wt Akv wt Akv wt Akv wt Akv wt Akv wt Akv wt Akv ... wt Akv- CD Akv wt Akv wt Akv- EH Akv- EH Akv- EH Akv wt Akv wt Akv- CD Akv- CDH Akv- EH Akv wt Akv- EH Akv wt Akv wt Akv wt Akv- EH Akv- CD Akv wt Akv wt Akv wt Akv- EH Akv- EH Akv- CD Akv- CDH Akv wt Akv...
- 19
- 178
- 0
Báo cáo y học: "Memory-enhancing treatments reverse the impairment of inhibitory avoidance retention in sepsis-surviving rats" pdf
... after surgery the animals underwent an inhibitory avoidance test Inhibitory avoidance The inhibitory avoidance procedure was described in a previous report [15] The apparatus was an acrylic box ... limitations Explicitly or implicitly, learning tasks in animals involve the performance or the inhibition of some form of movement in response to sensory or other cues Of the various training procedures ... placed in a sham-operated (CLP) group Thirty days after surgery, animals underwent the training test for an inhibitory avoidance task Immediately after training, animals received a single injection...
- 6
- 211
- 0
Báo cáo y học: " In Vitro impairment of whole blood coagulation and platelet function by hypertonic saline hydroxyethyl starch" docx
... Surgery 1997, 122:609-616 doi:10.1186/1757-7241-19-12 Cite this article as: Hanke et al.: In Vitro impairment of whole blood coagulation and platelet function by hypertonic saline hydroxyethyl starch ... display fibrin polymerization only all tests Pentapharm, Munich, Germany) Since maximum clot firmness (MCF) in whole blood coagulation is mainly determined by platelet function and fibrin polymerization, ... resuscitation by intravenous administration of small amounts of hypertonic saline hydroxyethyl starch has been introduced for rapid restoration of normovolemia following severe trauma However, both hypertonic...
- 8
- 317
- 0
Từ khóa: 27 impairment of assetssheet after deducting accumulated amortisation or depreciation and any accumulated impairment in the case of assetsimpairment of intangible assets property plant and equipment investment propertyassets items of property plant and equipment and investment property valuation adjustments for impairment of goodwill may not be reversedmanagement of assets and payablesias 36 tổn thất tài sảnimpairment of alveolar gas exchangeincreases in the company s equity during the reporting period in the form of inflows or enhancements of assets or decreases in liabilities other than those relating to monetary or non monetary contributions from equity holders or ownersdecreases in equity during the reporting period in the form of outflows or depletions of assets or incurrences of liabilities other than those relating to monetary or non monetary distributions to equity holders or ownersigic and any other indirect tax incurred on the acquisition of assets or services that is not directly recoverable from the taxation authoritiesincome and expenses recognised directly in equity that are not considered as taxable income including changes in the value of assets and liabilities if these variations differ from those attributed for tax purposeswhen the carrying amount of assets and liabilities recognised in a business combination differs from their tax baserules adapted as may be required shall also apply to transfers of assets and liabilitiesimpairment of merchandise raw materials and other suppliesinstruments it shall disclose the following information by classes of assetsBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI