0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Pension funds and economic crises A scenario generating approach to incorporate economic crises in the asset liability management methodology

Pension funds and economic crises A scenario generating approach to incorporate economic crises in the asset liability management methodology

Pension funds and economic crises A scenario generating approach to incorporate economic crises in the asset liability management methodology

... Pension funds and economic crises A scenario generating approach to incorporate economic crises in the asset liability management methodology Master of Science Thesis For obtaining the degree ... into a scenario generating process used by the Asset Liability Management (ALM) approach of pension funds In order to develop such a scenario generating tool, historical economic data are evaluated ... discusses the data used and methodology applied All the used data are obtained from DataStream The software package used to analyse the data is Matlab1 , a computational software package mainly used...
  • 54
  • 305
  • 0
Does a Causal Link Exist between Foreign Direct Investment and Economic Growth in the Asian NIEs

Does a Causal Link Exist between Foreign Direct Investment and Economic Growth in the Asian NIEs

... the causal links between FDI and GDP and the causality of these two variables by looking at a sample of 31 developing counties in Asia, Latin America, and Africa for the period of 1970-2000 They ... Singapore, Indonesia, Malaysia, Thailand, and the Philippines, this paper tests the causal relationship between the two variables of GDP growth and FDI inflow Data for Thailand, Indonesia, Malaysia, ... we can find that inconsistency in the causal link between FDI and GDP The Granger causality test including the export variable results in different patterns of the causal link between FDI and...
  • 37
  • 358
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Our vision for this new SpringerOpen Access journal, Psychology of Well-Being: Research, Theory and Practice, is to promote a distinctly eclectic approach to investigating well-being. When the prospect of " pdf

... dedicated to well-being research, many of whom we are fortunate to have on our editorial board Several of the major achievements occurring over the past decade were facilitated by the formation of “positive ... journal but we feel the research climate and resources are now supportive of these types of challenges Well-being research has increased substantially over the past decade and the demand to disseminate ... have subsequently employed an online, open access format This means that the end users will now also be able to read Page of Vella-Brodrick and Rickard Psychology of Well-Being: Theory, Research...
  • 3
  • 432
  • 0
báo cáo khoa học:

báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx

... ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA -AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ... ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA B A genome B genome D genome CCTCGATTTTATTTTCTAATGTTATTGCAATAGCTCGGTATAATGTAACCATGTTACTAGCTTAAGATGGTTAGGGTTTCCCACTTAGGATGCATGAAATATCGCATTGGA CCTCGATTTTATTTTCTAATTTCTTCATATTGGCAAGTGCATAACTTTGCTTCCTCTCTGT ... http://www.biomedcentral.com/1471-2229/9/115 A A genome B genome D genome ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCA ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA...
  • 14
  • 324
  • 0
The benefits and limitations of a genre - based approach to teaching writing to grade 10 students in Tan Trao high schoool, Tuyen Quang province

The benefits and limitations of a genre - based approach to teaching writing to grade 10 students in Tan Trao high schoool, Tuyen Quang province

... Benefits of G.B .A on students writing proficiency 3 5-3 6-3 7 3.1.2 Limitations of G.B .A to teaching writing 3 7-3 8 3.2 Summary 3 8-3 9 CONCLUSION 1 .The benefits and limitations of the genre- based approach ... a genre based approach to teaching writing ? 6-7 1.2.2 Definitions 7-8 1.2.3 Genre- Based Approach (G.B .A) 1.2.4 Basic Principles of G.B .A 8-9 -1 0 1.2.5 The curriculum cycle of G.B .A 1 0-1 1 1.2.5.1 ... project,Metropolitan East region Chandrasegaran, A and Kum, K T (2008) Teaching Expository Writing Singapore: McGraw-Hill Education Cope, B., & Kalantizis,M (Eds) (1993) .The powers of literacy: A genre approach...
  • 9
  • 863
  • 7
Báo cáo khoa học:

Báo cáo khoa học: "A multi-staged approach to identifying complex events in textual data" ppt

... understood as relations (job title) or events (acquisitions) 3.3 Statistical training Because we had no existing methods to address financial events or relations, we took this opportunity to develop ... contextual information using text classification methods We also use text classification methods to help users to more quickly focus on an area where interesting transactions exist in an interactive ... categories down to above 3040 for categories appearing less frequently 4.2 Online Learning We have embedded our text classification method into an online learning framework that allows users to select...
  • 4
  • 404
  • 0
Astrology, Psychology, and The Four Elements An Energy Approach to Astrology & Its Use in the Counseling Arts_1 pptx

Astrology, Psychology, and The Four Elements An Energy Approach to Astrology & Its Use in the Counseling Arts_1 pptx

... relevant to its intrinsic character The real question to be answered in any inquiry into astrology is whether, and to what extent, astrology is signifrcant and of essential value to human beings, ... a minimum of meaning And it is meaning that man needs; and an understanding of man's need for meaning is necessary to any psychology of health and whole' ness Meaning is provided from within, ... BraceJovanovich Inc I wish to express my thanks also to Jim Feil, Dr Pierre Pannetier, and Dr Randolph Stone for helping me to gain some degree of insight into the workings of the four elements, and...
  • 40
  • 539
  • 1
Astrology, Psychology, and The Four Elements An Energy Approach to Astrology & Its Use in the Counseling Arts_2 pdf

Astrology, Psychology, and The Four Elements An Energy Approach to Astrology & Its Use in the Counseling Arts_2 pdf

... fire, and ether; and all thesefrve elementsare inimical to eachother But with the help of, or due to, the soul, all the five elementsare containedand activein the human body,eachone manifesting ... sensitive, and intuitive They incline to wait on circumstances for guidance in solving problems." An understanding of the elements can, as we have seen, contribute to self-knowledge in many ways, showing ... of the Sun sign Second in importance are the elements of the Moon, Ascendant, and Mars And lastly, the elements of Venus and Mercury, followed in order of importance by Jupiter and Saturn The elements...
  • 59
  • 521
  • 2
A systems-based approach to assessing leadership styles in engineers

A systems-based approach to assessing leadership styles in engineers

... Text Mining Text mining is an “area within data mining that focuses on data from textual sources” (Feldman, 2003; Ye, 2003) Text mining is a large subfield of data mining It is an area that has developed ... research data are compared to the leadership skills needed that industry communicates in trade journals This comparison is determined using a subjective and approximate reasoning approach called ... stated that the objective of text mining is to “determine the underlying information on which the data mining operations are applied” Text Mining Approaches There are three major approaches to...
  • 183
  • 331
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A Dual Decomposition Approach to Partial Crosstalk Cancelation in a Multiuser DMT-xDSL Environment" docx

... the average capacity increase for allocating less or equal crosstalk cancellation taps than rs is set to zero, (ii) the average capacity increase for allocating more crosstalk cancellation taps ... the average capacity increases per allocated crosstalk cancellation tap For each of K tones the capacity increase has to be calculated for all N − crosstalk cancellation configurations To be able ... that in each iteration of the algorithm a minimum of and a maximum of N − crosstalk cancellation taps are allocated Because of this varying granularity, the crosstalk cancellation tap constraint...
  • 11
  • 400
  • 0
Chemical drug assisted gene transfer a sensible approach to improve transgene expression in the central nervous system

Chemical drug assisted gene transfer a sensible approach to improve transgene expression in the central nervous system

... these above studies indicate a novel approach to use HDAC inhibitors to enhance baculovirus-mediated gene therapy by increasing the expression of the transgene In addition, with their intrinsic anti-tumor ... CHEMICAL DRUG- ASSISTED GENE TRANSFER: A SENSIBLE APPROACH TO IMPROVE TRANSGENE EXPRESSION IN THE CENTRAL NERVOUS SYSTEM GUO HAIYAN (B.M., PRC) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR ... or interfere with disease-causing processes(Factor, 2001) The original goal of gene therapy was to correct a genetic disorder by inserting a functional gene into an organism to replace an inherited...
  • 161
  • 418
  • 0
A chemical genetics approach to identify targets essential for the viability of mycobacteria

A chemical genetics approach to identify targets essential for the viability of mycobacteria

... A CHEMICAL GENETICS APPROACH TO IDENTIFY TARGETS ESSENTIAL FOR THE VIABILITY OF MYCOBACTERIA STEPHEN HSUEH-JENG LU (B.Sc (Hons.), University of Auckland) A THESIS SUBMITTED FOR THE DEGREE OF ... eradicate both populations The only feasible way to elucidate such a novel target is to use a forward chemical genetics approach Forward chemical genetics involves screening a library of compounds ... Technologies available for identification of drug targets The identification of the biological target of a compound has several advantages for drug development Critically, a known drug target would allow...
  • 109
  • 254
  • 0
Direct and indirect cholinergic septo hippocampal pathways cooperate to structure spiking activity in the hippocampus

Direct and indirect cholinergic septo hippocampal pathways cooperate to structure spiking activity in the hippocampus

... network activity by GABAergic MSvDB neurons 84 4.6 Synergy of direct and indirect cholinergic septo- hippocampal pathways for coordination of spiking activity in area CA3 of the hippocampus ... network activity are mediated via the direct or indirect pathway, and how these pathways might act together in order to structure hippocampal firing patterns To differentiate between the two pathways ... of the hippocampus, and the molecular layer of the DG (see Figure 1.1) In addition to the extensive septo- hippocampal cholinergic input, ChAT+ non-GABAergic cell bodies exist in the DG and hippocampus...
  • 118
  • 271
  • 0

Xem thêm

Từ khóa: exploring a uml profile approach to modeling web services in healthcareevidence based approach to evaluate information published in the pathology literature and integrate it with personal experiencetfcc tear in the wrist a superior labrum anterior to posterior slap lesion in the shoulder or a labral tear in the hipa qualitative approach to understanding ¡°new¡± poverty in the former soviet unionhence although kylie s choice of words may not appear funny her much wider and more creative range of emoticons compared to beiyie s aided in the performance of an expressive and fun personality her niceness was also fairly evident because eventhe interweaving of three core solutions to the financial and economic crisis in order to build a better futurefinancial sector reforms and economic development in nigeriafinancial sector reforms and economic growth in nigeriaagriculture and economic growth in vietnamexport and economic growth in vietnamfinancial development and economic growth in vietnamrecent banking sector reforms and economic growth in nigeriabanking sector reforms and economic growth in nigeriarole of public and private sector banks in social and economic developments in indiatourism and economic development in vietnamBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ