0
  1. Trang chủ >
  2. Mẫu Slide >
  3. Mẫu Slide - Template >

Functions as relations

Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc

Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc

... not affect basal PLD1 activity or PMA-stimulated PLD1 activation, but completely ablated stimulation of PLD1 by H2O2 This shows that PrxII can function as a negative regulator of PLD1 activation ... PLD1 generation of PA H2O2 can participate in many signaling pathways, including both pro-apoptotic and anti-apoptotic ones PrxII is proposed here to function as a signal terminator, eliminating ... mm NaCl, and · protease inhibitor cocktail at 37 °C for 20 The lysate was spun down at 50 000 g for 15 The supernatant was mixed with pre-equilibrated anti-HA affinity matrix and rocked at °C for...
  • 9
  • 401
  • 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS The oligonucleotide ... GDP, across the nuclear envelope regulates the binding and release of cargo by transport factors RanGTP is abundant in the nucleus as a result of the activity of RCC1, a guanine nucleotide exchange...
  • 12
  • 454
  • 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG ... lab works image acquisition and analysis software was used to quantify band intensities Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich 10 11 Statistical analysis Data are...
  • 11
  • 396
  • 0
Báo cáo khoa học: RNA helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator pot

Báo cáo khoa học: RNA helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator pot

... example, ATPase /helicase activity is found associated with TFIIH and chromatin remodeling complexes and plays crucial roles in transcriptional initiation and preinitiation The ATPase /helicase activity ... recombinant TNF -a was purchased from Roche interference RNA (siRNA) 5¢-GCAUAAAACUUCUGC GUCU-3¢ was targeted to the RHA portion from 2408 to 2426 Control siRNA 5¢-AUUCUAUCACUAGCGU GAC-3¢ was purchased ... ATP-binding and helicase activity, the enzymatic activity of RHA is required for the transcriptional activation mediated by NF -jB RHA is a nucleic acid helicase that unwinds doublestranded DNA and RNA...
  • 11
  • 485
  • 0
Enterovirus type 71 2A protease functions as a transcriptional activator in yeast ppsx

Enterovirus type 71 2A protease functions as a transcriptional activator in yeast ppsx

... (5’-CATAATGACTGGGCAAACTCATCTACCACTGCTCAA-3’) L30/43 -AS 2AY -AS1 01 (5’-TTGAGCAGTGGTAGATGAGTTTGCCCAGTCATTATG-3’) (5’-CCGCTCGAGTTACTGATCATCCAACCACAGAAG-3’) 2A- AS3 01 (5’-GCTCTAGACTGATCATCCAACCACAGAAG-3’) CoxB2AY-S ... 2AY-11 0AS (5’-TTATTAGCAATCCCCTGGTTCCGA-3’) 2AY-13 0AS VP1 / 2A- S (5’-TTATTAGCAATCCCCTGGTTCCGA-3’) (5’-CCATCGATATGATGGGTACGTTC-3’) 2A- S10 (5’-GGAATTCATGGGGAAATTTGGACAGCAG-3’) 2A- AS2 (5’-GCTCTAGACTACTGCTCCATGGCTTCATCATC-3’) ... (5’-CCGCTCGAGTTACTGCTCCATGGCTTC-3’) 2AY-21S (5’-GGAATTCCATCTTGCTACTCATAA-3’) 2AY-41S (5’-GGAATTCCTCGTATCATCTACCAC-3’) 2AY-61S (5’-GGAATTCGGAGTGTATTATTGTAA-3’) 2AY-9 0AS (5’-TTATTAATAATACTCGCTGGCCTC-3’) 2AY-110AS...
  • 9
  • 244
  • 0
báo cáo khoa học:

báo cáo khoa học: " The Arabidopsis EAR-motif-containing protein RAP2.1 functions as an active transcriptional repressor to keep stress responses under tight control" docx

... article as: Dong and Liu: The Arabidopsis EAR-motif-containing protein RAP2.1 functions as an active transcriptional repressor to keep stress responses under tight control BMC Plant Biology 2010 10:47 ... by RAP2.1 itself Therefore, the harmonious operation of the DREB-type activators and the RAP2.1 repressor maintain the activation of the RD/ COR genes at an appropriate level and the plant stress ... plant responses to cold and drought stresses in Arabidopsis RAP2.1 transcript accumulated in response to cold and drought stresses Expression of RAP2.1 negatively regulated plant tolerance to...
  • 15
  • 277
  • 0
Compactly supported basis functions as support vector kernels capturing feature interdependence in the embedding space

Compactly supported basis functions as support vector kernels capturing feature interdependence in the embedding space

... equally spaced observations of a hypothetical continuous signal By approximating the signal with compactly supported basis functions (CSBF) and employing the inner product of the embedding L2 space, ... encoded as binary in order to avoid the bias that entropic measures have toward features with many values This can greatly increase the number of features in the original data, as well as introducing ... matching instances Within a group of matching instances the inconsistency count is the number of instances in the group minus the number of instances in the group with the most frequent class...
  • 228
  • 222
  • 0
Functions and variables as symbols

Functions and variables as symbols

... C standard library) and makes the code executable Athena is MIT's UNIX-based computing environment OCW does not provide access to it Functions and variables as symbols • Let’s look at the symbols ... t main ( void ) { p u t s ( msg ) ; r e t u r n ; } • What variables and functions are declared globally? Functions and variables as symbols • Consider the simple hello world program written below: ... u t s ( msg ) ; r e t u r n ; } • What variables and functions are declared globally? msg, main(), puts(), others in stdio.h Functions and variables as symbols • Let’s compile, but not link,...
  • 46
  • 291
  • 0
The Practices and Functions of Customer Reference Marketing − Leveraging Customer References as Marketing Assets pptx

The Practices and Functions of Customer Reference Marketing − Leveraging Customer References as Marketing Assets pptx

... In the following we describe the identified practices and functions of customer reference marketing deployed by the case companies, and give an analysis of the role of customer references as marketing ... was used, designed to identify the practices and functions of customer reference marketing, and to capture the various ways in which the case companies deployed their customer references as marketing ... al., 2005) The article is structured as follows First, the nature of customer reference marketing and the role of customer references as marketing assets are explained in the context of previous...
  • 20
  • 403
  • 0
Engaging Russia as Partner and Participant- The Next Stage of NATO-Russia Relations pdf

Engaging Russia as Partner and Participant- The Next Stage of NATO-Russia Relations pdf

... interoperability, and deployment, as well as the process of making decisions about the use of force? 18 Engaging Russia as Partner and Participant: The Next Stage of NATO -Russia Relations All these are ... http://www.nato.int/docu/pr/2003/p031204e.htm (as of September 23, 2004) Also see NATO -Russia Engaging Russia as Partner and Participant: The Next Stage of NATO -Russia Relations • further work on practical aspects of our fight ... especially in the Middle East, Central Asia, and the Transcaucasus In short, the next phase of NATO -Russia relations should focus on Russia s greater engagement as a partner and a participant NATO-Russia...
  • 84
  • 247
  • 0
lanczos c. the relations of homogeneous maxwell equations to theory of functions (1919)(59s)

lanczos c. the relations of homogeneous maxwell equations to theory of functions (1919)(59s)

... ‘striking proofs,’ but in the consistency and non-arbitrariness of its construction, by which, in capturing the proper soul of Maxwell s equations, the theory of Maxwell fused with the theory of relativity, ... by Lanczos 14 The expression “ Theory of Electrons” which appears in the subtitle of Lanczos s dissertation refers to the theory of Lorentz, and others, in which electrons are postulated to be ... THE FUNCTIONAL THEORETICAL RELATIONSHIPS OF THE HOMOGENEOUS1 MAXWELL EQUATIONS A CONTRIBUTION TO THE THEORY OF RELATIVITY AND ELECTRONS “Dedicated to Albert Einstein and Max Planck, the two...
  • 59
  • 432
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Error Sign Feedback as an Alternative to Pilots for the Tracking of FEXT Transfer Functions in Downstream VDSL" pptx

... receivers and coordination at the transmitter, using some kind of precoding scheme to remove the in uence of FEXT The principle is to feed back some limited amount of information about the received signals ... efficient in the initialization phase The precoder can then be computed and transmission can start at the highest rate Then, the channel is changing slowly, for example due to changes in temperature, ... channel perfectly and the remaining interference due to crosstalk might increase around the same power level as the additive noise, thereby decreasing the performance Mathematically, this means...
  • 14
  • 601
  • 0
n order to better illustrate the necessary functions and features of this application, a rainwater retention basin is assumed as example

n order to better illustrate the necessary functions and features of this application, a rainwater retention basin is assumed as example

... modification Startup-Code and library with the actual version counter V1.2 and the append ant documentations is now adapted to STEP V11 Additional search terms wireless, m2m, without server Doc técnico ... SMS-Sending and SMS-Receiving Downloads Content of the downloads Download Library description on the Configuration Example X25 (Documentation for the implemented STEP V11 library) LibraryDescription_S ... Library for STEP Basic V11 Containing also the outdated library based on STEP V10.5 CE-X25_S7-1200_SM S_library.zip Configuration Example X25 (Documentation based on the Startup-Code) ConfigurationExampl...
  • 3
  • 300
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP