The role of a professional accountant

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... both the wild-type protein and mutants E142O and K13 3A Thermal analysis of protein unfolding The DSC curves of the wild-type protein and the mutants K13 3A, E142O, W14 0A and W140O are shown in Fig ... Our CD and DSC data show that the W140 in SNase is the amino acid responsible for the stability of the whole protein However, in comparison with the wild-type protein, the mutant W14 0A retains significant...
  • 7
  • 187
  • 0

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation ... dimensional model of the wild type (A) and mutant alkaline phosphatases G26 1A (B) and G26 1A /Y2 6 9A (C); only residues that where studied are shown respectively By introducing an Ala residue in the place...
  • 6
  • 157
  • 0

Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx
... and RAD53 related (ATR) kinases at the site of DNA damage may decrease the kinase ⁄ phosphatase ratio and allow the phosphatase to dephosphorylate cH2AX In mammalian cells, PP 2A isoforms, the ... 2008 The Authors Journal compilation ª 2008 FEBS ´ C Vazquez-Martin et al Cisplatin-induced DNA damage response Cisplatin DNA damage DNA damage H2AX- P ( H2AX) Recovery H2AX H2AX- P ( H2AX) Psy4 ... MMS-induced DNA damage, cH2AX may be removed from the site of action of the ATM ⁄ ATR kinases, allowing Pph3p–Psy4p–Psy2p to dephosphorylate cH2AX In the case of the cisplatin-induced DNA damage response,...
  • 11
  • 132
  • 0

Báo cáo y học: "Chronic whiplash and central sensitization; an evaluation of the role of a myofascial trigger points in pain modulation" docx

Báo cáo y học:
... (muscle pains) mayperpetuateandaccentuate thepain status of afflicted patients, [8,9] and Ge et al recently reported experimental evidence of a physiologic link between myofascial trigger points and ... study the authors set out to evaluate whether anesthetic infiltration of myofascial trigger points in patients with chronic and refractory neck pain can affect pain thresholds in uninjured parts ... tissues, and explained the finding as the expression of an abnormal processing of nociceptive information in the brain and spinal cord [2-7] Others have postulated that chronicposttraumatic myalgia...
  • 8
  • 185
  • 1

Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx

Báo cáo y học:
... Ogawa K, Toita T, Uno T, Fuwa N, Kakinohana Y, Kamata M, Koja K, Kinjo T, Adachi G, Murayama S: Treatment and prognosis of thymic carcinoma: a retrospective analysis of 40 cases Cancer 2002, 94(12):3115-9 ... independent prognostic parameter in the multivariate analysis due to its narrow correlation with the clinical Masaoka stage However, correlation with Masaoka can easily be explained A pseudocapsula borders ... Herein, we present a 20 year experience in clinical treatment of thymomas as a result of a retrospective single centre analysis done within a European university setting The role of a pseudocapsula...
  • 10
  • 138
  • 0

Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation

Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation
... Trk1- Seq-F1 ACAAAGACAGCACCAACAGA Trk1- Seq-R1 GAAGTAGTGAACCGCGATAA Trk1- Seq-F2 TGGATCGTGCAATTATCTTG Trk1- Seq-R2 AAGGCGATTAAGTTGGGTAA 26 2.2 DNA manipulation 2.2.1 Transformation of plasmid DNA ... seelection marrker 25 Table 2.5: List of primers Primer Sequence (5’-3’) GFP1 GATAAGGCAGATTGAGTGGA GFP2 AAAGATGACGGTAACTACAA TO105-2F CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGGGATCCCGTTAGAGCGTTGTGCTGCTCC ... establish the link between potassium transport and Agrobacteriummediated transformation As a eukaryotic model, the yeast S cerevisiae has many advantages such as the rapid growth rate, easy in...
  • 109
  • 51
  • 0

Tài liệu Organization-internal Transfer of Knowledge and the Role of Motivation: A Qualitative Case Study pptx

Tài liệu Organization-internal Transfer of Knowledge and the Role of Motivation: A Qualitative Case Study pptx
... failure Plants and failed to take on the knowledge transfer, whereas the other four succeeded Transfer of Knowledge and the Role of Motivation CASE STUDY Plant is a small plant, based in northern ... popularity of knowledge transfer and similar methods of learning Cases such as SCA Packaging highlight the need to understand better the role of motivation, and what corporate managers can to stimulate ... or the antecedent factors of cognition, organization and motivation METHODOLOGY This is a case study, and the object of study is the transfer of manufacturing knowledge in SCA Packaging (SCAP)...
  • 12
  • 168
  • 0

Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx

Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
... Atlanta, GA 30333 SUGGESTED CITATION Centers for Disease Control and Prevention The role of BCG vaccine in the prevention and control of tuberculosis in the United States: a joint statement by ... Committee and the Advisory Committee for Elimination of Tuberculosis published a joint statement on the use of BCG vaccine for the control of TB (2 ) Based on available information concerning the effectiveness ... vaccination in the prevention and control of TB in the United States CDC, the Advisory Council for the Elimination of Tuberculosis (ACET), and the Advisory Committee on Immunization Practices (ACIP),...
  • 27
  • 670
  • 2

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available from the Protein Data Bank and ... W, Thanki N, Jaenicke R & Wierenga RK (1997) A double mutation at the tip of the dimer interface loop of triosephosphate isomerase generates active Effect of mutation on the dimer interface of...
  • 15
  • 233
  • 0

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... number of differences in the N-terminal domain (located on the matrix side) It is likely that the N-terminal domain is involved in protein protein interactions with other hydrophilic domains of neighboring ... chain was established with succinate and glycerol3-phosphate as substrates Complex II activity was determined after addition of succinate, followed by inhibition by malonate, and complex III activity ... Inspection of the amino acid sequences of the known mammalian ESSS proteins reveals a high degree of conservation in the C-terminal domain (including the transmembrane region), but a significant...
  • 9
  • 215
  • 0

Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf

Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf
... good enterprises, they appear unable to ration bad ones Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey ENTERPRISE ADJUSTMENT AND THE ROLE ... Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey In 1996, the credit has overall been decreasing for 53% of the sample, it has been increasing ... passive, and will appear as endogenous variable in section 10 Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey resources as an important...
  • 30
  • 248
  • 0

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... residues are not described well and there is no example of mutational analysis of all of these residues in the same enzyme To obtain an insight into how the many conserved residues in the active sites ... circulans, whereas it may be mutated to asparagine without loss of activity in other family 18 chitinases [28,30] Preliminary results of a comparative study of available structures of family 18 chitinases ... bond ˚ and Asp140 is 10.7 A Mutational effects The residues mutated in this study are shown in Fig Asp140, Asp142, Glu144 and Asp215 were mutated individually to asparagine and alanine, Tyr10 and...
  • 10
  • 220
  • 0

Xem thêm

Từ khóa: hộp giảm tốc bánh răng côn trụGiá trị nhân văn trong tư tưởng hồ chí minh về đoàn kết tôn giáo và sự vận dụng vào xây dựng khối đoàn kết tôn giáo ở tỉnh thái bình hiện nayPhát triển du lịch văn hóa phía nam hà nộiTHỰC TẬP KHẢO SÁT BỘ TRUYỀN BÁNH RĂNGQUY TRÌNH BẢO DƯỠNG DUY TU SÂN BAY DÂN DỤNG VIỆT NAMCHƯƠNG TRÌNH ĐÀO TẠO CHUẨN ĐHQGHN TRÌNH ĐỘ THẠC SĨ ĐỊNH HƯỚNG: NGHIÊN CỨUNghiên cứu hệ thống vận tải và phân phối thuốc 3 Curcumin của Bacterial cellulose lên men từ nước vo gạo định hướng sử dụng qua đường uốngNghiên cứu nhiễu loạn điện áp trong lưới điện phân phốNghiên cứu quá trình hình thành hỗn hợp và cháy của động cơ Dual fuel (Biogas-Diesel)Nghiên cứu sự vận tải và phân phối thuốc Berberin của màng Bacterial cellulose lên men từ nước vo gạo định hướng sử dụng qua đường uốngNghiên cứu tiềm năng vận tải và phân phối thuốc Curcumin của màng Bacterial cellulose lên men từ nước dừa già định hướng sử dụng qua đường uốngChapter 1b Predicate Logic Discrete Structure for Computing (CO1007)Chapter 4 Sets and Functions Discrete Structures for Computer Science (CO1007)Tổng quan về lao hệ thần kinh trung ương100 cau trac nghiem dia ly lop 11QUẢN TRỊ NGUYÊN VẬT LIỆU TẠI CÔNG TY CỔ PHẦN XI MĂNG VICEM HẢI VÂNđề hsg tỉnh thcs (11)đề hsg tỉnh thcs (13)đề hsg tỉnh thcs (16)đề thi hsg tỉnh gdtx (1)
Nạp tiền Tải lên
Đăng ký
Đăng nhập