Sedimentary rocks and the origin of sedimentary strata

Information, Entropy, and the Origin of Life

Information, Entropy, and the Origin of Life
... account for the diversity of life in the biosphere, it is generally recognized that the origin of life is one of the great unsolved mysteries in science (Radetsky1992; Wade 2000) At the heart of this ... Second Law of Thermodynamics For them, the origin of life is nothing more or less than the emergence of sufficient biological information to enable a system of biopolymers to (1) store information, ... 2004 21:6 Information, Entropy, and the Origin of Life 333 chose to quantify the information “i” per register (or position) in his message as i = K log W (1a) where W is the total number of symbols...
  • 3
  • 157
  • 0

báo cáo khoa học: " DNA sequence diversity and the origin of cultivated safflower (Carthamus tinctorius L.; Asteraceae)" ppsx

báo cáo khoa học:
... levels of nucleotide diversity within and among species of sect Carthamus, and investigate the origin of cultivated safflower using data derived from seven nuclear genes Results DNA sequence diversity ... average of SNP per 15 bp of sequence Considering just the 11 safflower individuals, there were 34 SNPs, corresponding to an average of SNP per 95 bp of sequence Estimates of nucleotide diversity ... native to the deserts of southern Israel and western Iraq, is the wild progenitor of safflower Safflower and C palaestinus share a self-compatible breeding system [12]; thus, the near absence of heterozygous...
  • 9
  • 60
  • 0

Báo cáo y học: "Relation between lipogranuloma formation and fibrosis, and the origin of brown pigments in lipogranuloma of the canine liver" ppsx

Báo cáo y học:
... 0y 0y 7m 3y1 m 3y5 m y 10 m 4y 4y 4y4 m 4y5 m 4y6 m 5y2 m 5y4 m 6y 6y2 m 6y3 m 7y 7y4 m 7y4 m 7y9 m 8y1 m 8y3 m 8y9 m 9y 9y 9y3 m 9y6 m 9y7 m 9y9 m 9y9 m 9y9 m 10 y 10 y m 10 y m 10 y 11 m 11 y 11 y m 11 y m 11 y ... fibrosis, and speculated the origin of brown pigments of lipogranulomas Results Histopathology of the liver Histopathological diagnoses of the 52 canine autopsy cases examined in the present study are ... Hepatology 2008, 7:5 fibrotic cytokines, is necessary and sufficient for the induction and progression of fibrotic lesions, and may serve as the initiating event in the activation of myofibroblasts,...
  • 6
  • 88
  • 0

Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific primers ... V a aspis, V a zinnikeri, and the remaining four clones having an intron D similar to that of the V am ammodytes ammodytin I1 gene All PLA2 genes contained a TAA stop codon, an AATAAA polyadenylation...
  • 10
  • 128
  • 0

A Philosophical Inquiry Into The Origin Of Our Ideas Of The Sublime And Beautiful

A Philosophical Inquiry Into The Origin Of Our Ideas Of The Sublime And Beautiful
... The Beautiful in Sounds 26 Taste and Smell 27 The Sublime and Beautiful Compared Part IV Of the Efficient Cause of the Sublime and Beautiful Association Cause of Pain and Fear Continued How the ... not the Cause of Beauty 10 How Far the Idea of Beauty May be Applied to the Qualities of the Mind 11 How Far the Idea of Beauty May be Applied to Virtue 12 The Real Cause of Beauty 13 Beautiful ... of the nature of those which regard self-preservation, and turning upon pain may be a source of the sublime or it may turn upon ideas of pleasure; and then whatever has been said of the social...
  • 165
  • 134
  • 0

Báo cáo khoa học: Modeled ligand-protein complexes elucidate the origin of substrate specificity and provide insight into catalytic mechanisms of phenylalanine hydroxylase and tyrosine hydroxylase pptx

Báo cáo khoa học: Modeled ligand-protein complexes elucidate the origin of substrate specificity and provide insight into catalytic mechanisms of phenylalanine hydroxylase and tyrosine hydroxylase pptx
... binding to the catalytic domains of PAH and TH Docking of the native cosubstrate BH4 into the crystal structure of the PAH catalytic domain yielded a total of 286 conformations Out of these, 44 ... PAH and TH has been used to model the full length structure of TPH [24] We have modeled the catalytic sites of PAH and TH and introduced BH4 and the amino acid substrates phenylalanine or tyrosine ... docking The computational approach allowed first, the creation of binary complexes of the natural pterin cosubstrate BH4 and the catalytic domain of the enzymes, followed by the docking of amino...
  • 11
  • 102
  • 0

Báo cáo Y học: Ascidian arrestin (Ci-arr), the origin of the visual and nonvisual arrestins of vertebrate pdf

Báo cáo Y học: Ascidian arrestin (Ci-arr), the origin of the visual and nonvisual arrestins of vertebrate pdf
... common root of the vertebrate visual and b -arrestins This result allows us to propose a hypothesis that Ci-Arr is the prototype of vertebrate arrestin and that in the evolutionary process to vertebrates ... Vertebrate arrestins are subdivided into two groups, visual arrestins and b -arrestins The tree showed that Ci-Arr was more closely related to the vertebrate arrestins than to protostome arrestins and ... 2002 Origin of vertebrate visual and nonvisual arrestins (Eur J Biochem 269) 5113 and possesses some of the features typical of a vertebrate, including a dorsal tubular central nervous system and...
  • 7
  • 168
  • 0

báo cáo hóa học: " Temporal expression and cellular origin of CC chemokine receptors CCR1, CCR2 and CCR5 in the central nervous system: insight into mechanisms of MOG-induced EAE" pptx

báo cáo hóa học:
... cells in defined lesional stages Quantification of CCR1, CCR2 and CCR5 mRNA expressing Quantification of CCR1, CCR2 and CCR5 mRNA expressing cells in defined lesional stages Mean numbers of CCR1+ ... expression of CCR1, CCR2 and CCR5 in the spinal cord (data not shown) Enhanced expression of CCR1, CCR2 and CCR5 mRNA was subsequently observed over cells within inflammatory aggregates during the early ... of CCR1, CCR2 and CCR5 mRNA in the rat spinal cord No expression of CCR1, CCR2 or CCR5 was detected within the spinal cord of healthy control rats (Fig 2A, 2D, 2G) or MOG-EAE rats in the pre-symptomatic...
  • 13
  • 166
  • 0

Báo cáo sinh học: " Darwin and Huxley revisited: the origin of allometry" docx

Báo cáo sinh học:
... critics proclaimed the death of Darwinism.” ‘Darwinism’ here refers to the random heritable variation and natural selection parts of the theory, not the idea of evolution itself One of the popular alternatives ... and W(s) determine the length and width of the head (L for the vertical axis of the ellipse and W for the horizontal axis) Note that the values of L(s) and W(s) depend on the size s; when L(s) ... 104:12931-12935 Darwin CR: Journal of Researches into the Natural History and Geology of the Countries Visited During the Voyage of H.M.S Beagle Round the World, Under the Command of Capt Fitz Roy,...
  • 7
  • 86
  • 0

Báo cáo khoa học: "Mucin pattern reflects the origin of the adenocarcinoma in Barrett''''s esophagus: a retrospective clinical and laboratorial study" ppsx

Báo cáo khoa học:
... were the pathologists and involved in laboratory investigation AVSR was involved in collecting data, laboratory investigation, carried out the immunoassays All authors read and approved the final ... Esophagus An infiltrative proximal Adenocarcinoma over a long BarAn infiltrative proximal Adenocarcinoma over a long Barrett's Esophagus Undifferentiated adenocarcinoma arising in 10.7 cm lenght Barrett's ... mucin pattern) and MUC5AC in the superficial columnar epithelium (gastric mucin pattern) [14] This is the same pattern already described for incomplete intestinal metaplasia of the stomach, and...
  • 8
  • 125
  • 0

Xem thêm

Đăng ký
Đăng nhập