Chlorogenic acid composition of instant coffees

Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf

Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf
... Both transitions to latent and substrate forms were strongly but differently influenced by the amino-acid composition of the shutter region Surprisingly, we found that substitution of Lys335 to ... investigate the importance of the shutter region for the unique types of RCL insertion in PAI-1, we have now undertaken a number of substitutions in the shutter region and b strand 5A of PAI-1 and studied ... 8C [37] Therefore, to study the effect of shutter region substitutions on the transition of PAI-1 to a substrate form, we replaced the BSA in the assay buffer with 0.2% Triton X-100 The variants...
  • 10
  • 73
  • 0

Báo cáo khoa học: Fatty acid composition of chylomicron remnant-like particles influences their uptake and induction of lipid accumulation in macrophages pot

Báo cáo khoa học: Fatty acid composition of chylomicron remnant-like particles influences their uptake and induction of lipid accumulation in macrophages pot
... obtained In summary, this study shows that the fatty acid composition of chylomicron remnants in uences their uptake and induction of lipid accumulation in macrophages, with those enriched in ... fatty acid composition of chylomicron remnants affects their uptake by macrophages and induction of excessive lipid accumulation in the cells In this study, we have investigated the effects of ... THP-1 to investigate the uptake of chylomicron remnants and their induction of lipid accumulation in the cells [4,5,7,19,20] As chylomicron remnants uncontaminated with lipoproteins of a similar...
  • 9
  • 124
  • 0

Báo cáo khoa học: Suppression of nuclear factor-jB activity in macrophages by chylomicron remnants: modulation by the fatty acid composition of the particles pot

Báo cáo khoa học: Suppression of nuclear factor-jB activity in macrophages by chylomicron remnants: modulation by the fatty acid composition of the particles pot
... is in uenced by the fatty acid composition of the particles Phosphorylation of p65–NF-jB plays a critical role in regulating its transcriptional activity To further investigate the effects of the ... accompanied by modulation of in ammatory processes in macrophages, and that the extent of the inhibitory action on the NF-jB pathway depends upon the fatty acid composition of the particles Because ... from the gut to the liver in CMR in the postprandial phase In this study, we investigated the effects of CMR on NF-jB activation in macrophages and determined whether these are modulated by the fatty...
  • 14
  • 123
  • 0

FATTY ACID COMPOSITION INCLUDING TRANS FATTY ACIDS CONTENT OF SELECTED VIETNAMESE INSTANT NOODLES

FATTY ACID COMPOSITION INCLUDING TRANS FATTY ACIDS CONTENT OF SELECTED VIETNAMESE INSTANT NOODLES
... polyunsaturated fatty acids * MUFA: monounsaturated fatty acids * TFA: trans fatty acids * tc: traceal 818 Fatty acid composition including trans fatty acids content of selected Vietnamese instant noodles Trans ... abundant fatty acid in all samples; its concentration was from 39% to 42% (total fatty Fatty acid composition including trans fatty acids content of selected Vietnamese instant noodles Table Fatty acid ... composition including trans fatty acids content of selected Vietnamese instant noodles Table1 Fatty acids composition of selected Vietnamese Instant noodles Fatty acid C14:0 Brands IN1 IN2 IN3 IN4...
  • 9
  • 155
  • 0

THÀNH PHẦN hợp CHẤT AXÍT béo và CAROTENOID của gấc fatty acid and carotenoid composition of gac (momordica cochinchinensisspreng) fruit

THÀNH PHẦN hợp CHẤT AXÍT béo và CAROTENOID của gấc   fatty acid and carotenoid composition of gac (momordica cochinchinensisspreng) fruit
... Fatty Acid and Carotenoids in Gac Fruit MATERIALS AND METHODS Fatty Acid Analysis Materials Gac fruit were purchased from two Asian markets (Vinh Phat and Shun Fat) in Sacramento, ... almost half of the weight of the entire fruit Fatty Acid Analysis Data on total FAME content of aril from two gac fruit were collected Total % weight content of FAME in these two fruit was nearly ... ) standard deviation, % d RSD ) relative standard deviation, % vaccenic (in two fruit) , R-linolenic, and eicosa-11-eneoic acids were also detected The fatty acid composition of the aril and seed...
  • 6
  • 368
  • 1

Tài liệu Báo cáo Y học: Bivalent cations and amino-acid composition contribute to the thermostability of Bacillus licheniformis xylose isomerase doc

Tài liệu Báo cáo Y học: Bivalent cations and amino-acid composition contribute to the thermostability of Bacillus licheniformis xylose isomerase doc
... with Co2þ as the cofactor [26] The class II Bacillus coagulans XI, on the other hand, isomerizes xylose most efficiently when in the presence of Mn2þ, whereas its activity toward fructose is best ... responsible for the thermostability of Thermus thermophilus isopropylmalate dehydrogenase Biochim Biophys Acta 1545, 174–183 Petsko, G.A (2001) Structural basis of thermostability in hyperthermophilic ... content relates to the enzyme’s functional temperature range and that BLXI thermostability is also directly related to the binding of specific metals as cofactors At the same time, the simple relationship...
  • 11
  • 159
  • 0

báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx

báo cáo khoa học:
... GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA ... CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACCATCC TCGTCCGTCAGTAGCCACGTACAGTATC ... contrasting varieties 'Romanesco C3' (a late-maturing, non-spiny type) and 'Spinoso di Palermo' (an earlymaturing spiny type) Here, we report the isolation of the cDNA of a novel acyltransferase involved...
  • 13
  • 84
  • 0

báo cáo khoa học: " Mapping quantitative trait loci (QTLs) for fatty acid composition in an interspecific cross of oil palm" ppt

báo cáo khoa học:
... species of oil palm and use an interspecific hybrid for the analysis of QTLs associated with palm oil fatty acid composition This study employed both dominant (AFLP) and co-dominant (RFLP and SSR) ... quality in an interspecific cross of oil palm Pertanika J Trop Agric Sci 2007, 30:31-44 Alrefai R, Berk TG, Rocheford TR: Quantitative trait locus analysis of fatty acid concentration in maize ... the "aa" and "ab" genotypes The results obtained are summarized in Table As is shown for the RFLP marker CB75A, there was a significant difference for IV between palms having the "aa" and "ab"...
  • 19
  • 112
  • 0

In vitro and in vivo studies into the antidiabetic and antilipidemic effects of chlorogenic acid

In vitro and in vivo studies into the antidiabetic and antilipidemic effects of chlorogenic acid
... quality of life Before the introduction of the therapeutic use of insulin, diet 11 is the main form of treatment of the disease, and dietary measures included the use of traditional medicines which ... IN VITRO AND IN VIVO STUDIES ON THE ANTIDIABETIC AND ANTILIPIDEMIC EFFECTS OF CHLOROGENIC ACID ONG KHANG WEI [BSc Biomedical Science (Hons.)] A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... through increasing GLUT translocation and inhibiting hepatic G6Pase 1,5-dicaffeoyl-quinic acid, dicaffeoyl quinic acid, chlorogenic acid and luteolin-7-O-glucoside in the extract may be the candidates...
  • 190
  • 88
  • 0

Báo cáo y học: " A Dietary Supplement Containing Standardized Phaseolus vulgaris Extract Influences Body Composition of Overweight Men and Women"

 Báo cáo y học:
... Starch Neutralizer lV, a dried aqueous extract of the common bean (Phaseolus vulgaris) Phase had been standardized to a minimum of 3000 AAlU (alpha-amylase inhibiting units), validated by a modified ... substantially inactivate hemagglutinating activity (HA) and trypsin inhibiting activity (TIA) while preserving alpha-amylase inhibiting ability The established product is standardized to contain ... using a calibrated Bodymaster Scale (Rowenta) that also enabled calculation of the body composition (fat mass, lean body mass) through bioelectric leg-to-leg impedance measurements The patented "foot...
  • 8
  • 212
  • 1

Characterization of the Carbon Stable Isotope Ratio and Fatty Acid Structure of Zostera japonica in Coastal Areas

Characterization of the Carbon Stable Isotope Ratio and Fatty Acid Structure of Zostera japonica in Coastal Areas
... acid structure in Z japonica We found about 30 kinds of fatty acids in the leaves and stems and about 36 kinds of fatty acids in the roots and rhizomes of Z japonica We focused on the fatty acid ... based on the quantity of lipid, the content ratios of all the fatty acids, and the ratio of each fatty acid RESULTS AND DISCUSSION Characteristics of carbon stable isotope in Z japonica The mean ... dominant fatty acids and Fig shows the dominant fatty acids in the leaves and stems of Z japonica in each sampling site The term “other” in the x-axis designates the sum of all the fatty acids with...
  • 9
  • 182
  • 2

Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine

Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine
... investigating the relationship between percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and ... relatively higher in mahua biodiesel than that of biodiesel of palm In addition to unsaturation, ignition delay increases with fuel density and iodine value The effect of unsaturation on ignition ... and exhaust gas temperature was observed in case of high unsaturated biodiesel Heat release rate and cumulative heat release rate is lower in case of high- unsaturated biodiesel fuel A general...
  • 20
  • 144
  • 0

Tài liệu Báo cáo " Chemical composition of essential oil of Machilus Japonica Siebold & Zucc. (Lauraceae) from Vietnam " pptx

Tài liệu Báo cáo
... αphellandrene and β-phellandrene was 5.73 Table The composition of leaf essential oil of Machilus japonica Siebold & Zucc (Lauraceae) fromVietnam Peak Identification α-Thujene α-Pinene Sabinene KI ... areas [9-12] Results and discussion The essential oil was light yellow and the total yield of 1.23% The chemical composition of the leaf essential oils of investigated species collected in October ... leaf essential oil of investigated species from Vietnam was characterized by large amount of α- and βphellandrene (70.7%) and the ratio of αphellandrene and β-phellandrene was 5.73 Table The composition...
  • 3
  • 161
  • 0

Tài liệu Báo cáo " Composition of bird species in Huu Lien Nature Reserve, Lang Son province " pdf

Tài liệu Báo cáo
... part of Yen Thinh commune, part of Hoa Binh commune (of Huu Lung district), part of Huu Le commune (of Van Quang district) and part of Van Linh commune (of Chi Lang district), Lang Son province ... and discussions 3.1 Bird structure composition On the basis of selective inheritance of study findings earlier conducted at Huu Lien Nature Reserve and the findings obtained during the two years’ ... Museum of Natural History in Paris, France - MNHN), for catching birds to identify precisely the kinds of birds of small size living in bushes and difficult to detect For rapidly detecting birds in...
  • 12
  • 79
  • 0

Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx

Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... substitution mutant snake DNases I The thermal stabilities of the wild-type and mutant enzymes of the snakes were examined by measuring the activities remaining after incubation for 40 at various ... mechanism of generating a thermally stable enzyme form from a thermally unstable one: frog, toad and newt DNases I all have a Ser205 insertion in a domain that contains an essential Ca2+binding ... factor in the initiation of human and rat SLE [12,40], the acquisition of thermally stable characteristics during DNase I evolution may provide a clue to the etiology of SLE in humans and mice,...
  • 8
  • 158
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập