Báo động 70% trẻ vào viện mắc bệnh về đường hô hấp

Tài liệu Một số bệnh về đường hấptrẻ pptx

Tài liệu Một số bệnh về đường hô hấp ở trẻ pptx
... mát , làm thông thoáng đường thở cách hút đờm dãi, nằm đầu cao, nới rộng quần áo Cho thở oxy trẻ có biểu suy thở Nếu tím tái nặng, ngừng thở đặt ống nội khí quản, hấp hỗ trợ Khi trẻ sốt cao ... biến sức khỏe, bệnh tật trẻ mà có hướng điều trị, phòng bệnh tốt Viêm phổi phế cầu - Bệnh nguy hiểm trẻ em Trong số bệnh hấp khiến trẻ em phải nhập viện mùa hè viêm phổi phế cầu bệnh thường gặp ... phiện, trẻ bị chết trúng độc SUYỄN TRẺ EM PHẦN CHÌM CỦA TẢNG BĂNG BS.Trần Anh Tuấn Trưởng khoa hấp – BV.Nhi Đồng I/ SUYỄN LÀ GÌ ? Suyễn (hay gọi hen phế quản) bệnh hấp mãn tính thường gặp trẻ...
  • 10
  • 244
  • 2

ước tính chi phí điều trị các bệnh về đường hấp của người dân giữa hai xã bị ảnh hưởng bởi ô nhiễm môi trường do hoạt động sản xuất gạch nung và môi trường có không khí trong lành tại tỉnh trà vinh

ước tính chi phí điều trị các bệnh về đường hô hấp của người dân giữa hai xã bị ảnh hưởng bởi ô nhiễm môi trường do hoạt động sản xuất gạch nung và môi trường có không khí trong lành tại tỉnh trà vinh
... DÂN GIỮA HAI XÃ BỊ ẢNH HƢỞNG BỞI Ô NHIỄM MÔI TRƢỜNG DO HOẠT ĐỘNG SẢN XUẤT GẠCH NUNG VÀ MÔI TRƢỜNG CÓ KHÔNG KHÍ TRONG LÀNH TẠI TỈNH TRÀ VINH 36 4.1 TỈ LỆ MẮC CÁC BỆNH VỀ ĐƢỜNG HÔ HẤP TỰ KHAI ... bệnh hấp Trà Vinh so với nƣớc 39 4.2 ƢỚC TÍNH CHI PHÍ ĐIỀU TRỊ CÁC BỆNH VỀ ĐƢỜNG HÔ HẤP CỦA NGƢỜI DÂN Ở HAI XÃ BỊ ẢNH HƢỞNG BỞI Ô NHIỄM MÔI TRƢỜNG DO HOẠT ĐỘNG SẢN XUẤT GẠCH NUNG VÀ MÔI ... tiêu chung Ƣớc tính đƣợc chi phí điều trị bệnh đƣờng hấp ngƣời dân hai bị ảnh hƣởng ô nhiễm môi trƣờng hoạt động sản xuất gạch nung môi trƣờng không khí lành tỉnh Trà Vinh 1.2.2 Mục...
  • 75
  • 102
  • 0


... phòng bệnh cho trẻ KẾT LUẬN Tỷ lệ mắc bệnh nhiễm khuẩn hấp cấp tính trẻ em tuổi huyện Châu Thành Tỷ lệ nhiễm khuẩn hấp cấp tính trẻ < tuổi tuần 36 ,5% Một số yếu tố liên quan đến nhiễm khuẩn ... khuẩn hấp cấp tính trẻ em tuổi huyện Châu Thành 2.1 Các yếu tố từ trẻ - Độ tuổi + < tuổi Tỷ lệ nhiễm khuẩn hấp cấp tính: 20% + > tuổi Tỷ lệ nhiễm khuẩn hấp cấp tính: 37 ,5% -Tình trạng ... nhiễm khuẩn hấp cấp tính trẻ em tuổi đặc biệt viêm phổi Châu Thành huyện triển khai chương trình chống nhiễm khuẩn hấp cấp tính, huyện có 10.6 15 trẻ em tuổi Tại chưa có nghiên cứu nhiễm khuẩn...
  • 12
  • 69
  • 0


... phòng bệnh cho trẻ KẾT LUẬN Tỷ lệ mắc bệnh nhiễm khuẩn hấp cấp tính trẻ em tuổi huyện Châu Thành Tỷ lệ nhiễm khuẩn hấp cấp tính trẻ < tuổi tuần 36 ,5% Một số yếu tố liên quan đến nhiễm khuẩn ... khuẩn hấp cấp tính trẻ em tuổi huyện Châu Thành 2.1 Các yếu tố từ trẻ - Độ tuổi + < tuổi Tỷ lệ nhiễm khuẩn hấp cấp tính: 20% + > tuổi Tỷ lệ nhiễm khuẩn hấp cấp tính: 37 ,5% -Tình trạng ... xã, huyện Châu Thành, Tỉnh Trà Vinh Tìm hiểu số yếu tố liên quan đến NKHHCT trẻ em tuổi huyện Châu Thành, Tỉnh Trà Vinh ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU ĐỐI TƯỢNG NGHIÊN CỨU Trẻ em tuổi bà mẹ...
  • 12
  • 147
  • 0

Ánh nắng mặt trời, lợi ích tuyệt vời của ánh nắng mặt trời và phòng bệnh viêm đường hấp mùa hè cho trẻ em

Ánh nắng mặt trời, lợi ích tuyệt vời của ánh nắng mặt trời và phòng bệnh viêm đường hô hấp mùa hè cho trẻ em
... nhức xương, thấp khớp, da xơ cứng bệnh tim mạch 10 http://doduynhat.tk/ Tăng sức đề kháng phòng bệnh viêm đường hấp cho trẻ mùa nắng 11 http://doduynhat.tk/ Nền nhiệt độ ẩm cao mùa môi trường ... thuận lợi cho nhiều dịch bệnh xuất bùng phát Trẻ nhỏ từ 0-5 tuổi đối tượng dễ bị lây bệnh sức đề kháng thể trẻ mẫn cảm với virus gây bệnh Hiện dịch sởi, thủy đậu bệnh viêm đường hấp đặc biệt viêm ... người nghĩ, ánh nắng mùa có hại có sức khỏe, nhiên thực tế không hoàn toàn vậy, biết tận dụng thời điểm, cách ánh nắng lợi cho sức khỏe Phòng chống bệnh xương: Sáng sớm, nên phơi nắng 15 phút,...
  • 18
  • 299
  • 0

Nghiên cứu đặc điểm bệnhđường hấp của công nhân tiếp xúc nghề nghiệp với bụi talc và tổn thương phổi ở động vật thực nghiệm

Nghiên cứu đặc điểm bệnh lý đường hô hấp của công nhân tiếp xúc nghề nghiệp với bụi talc và tổn thương phổi ở động vật thực nghiệm
... Nghiêm Thị Minh Châu Nghiên cứu đặc điểm bệnh đờng hấp công nhân tiếp xúc nghề nghiệp với bụi talc tổn thơng phổi động vật thực nghiệm Chuyên ngành: Sức khoẻ nghề nghiệp Mã số: 62 72 73 ... lao động, xác định số đặc điểm bệnh đờng hấp công nhân tiếp xúc trực tiếp với bụi talc ngành sản xuất săm lốp cao su 3- Những đóng góp luận án - Lần nghiên cứu ảnh hởng bụi talc động vật thực ... trờng lao động, đặc điểm bệnh hấp công nhân tiếp xúc nghề nghiệp với bụi talc Tổng Công ty Cao su Sao Vàng Tổng Công ty Cao su Miền Nam, kết quả: 2.1- Môi trờng điều kiện bảo hộ lao động -...
  • 29
  • 175
  • 0

Phòng bệnh viêm đường hấp cho trẻ doc

Phòng bệnh viêm đường hô hấp cho trẻ doc
... để phòng bệnh viêm đường hấp cho trẻ? Khi thời tiết thay đổi đột ngột, nắng nóng, bậc phụ huynh cần quan tâm chăm sóc trẻ, không cho trẻ trời nắng, lúc nắng gay gắt Đối với trẻ lớn, không cho ... cho trẻ chơi không cho trẻ đá bóng trời lúc nắng nóng Không cho quạt xoáy thẳng vào trẻ trẻ chơi nằm ngủ Không cho trẻ phòng máy lạnh có nhiệt độ chênh lệch vượt xa nhiệt độ nhà trời (ngay trẻ ... độ dinh dưỡng tốt cho trẻ Hạn chế cho trẻ ăn kem uống nước có đá Khi nghi trẻ bị sốt cần cặp nhiệt độ cho trẻ, không nên dùng tay người lớn sờ vào trán trẻ dự đoán trẻ sốt hay không Tốt cặp nhiệt...
  • 4
  • 197
  • 0

Làm cách nào để hỗ trợ phòng ngừa bệnh viêm đường hấptrẻ docx

Làm cách nào để hỗ trợ phòng ngừa bệnh viêm đường hô hấp ở trẻ docx
... khuẩn hấp Nhiễm khuẩn hấp bao gồm trường hợp ho, cảm lạnh, viêm mũi-họng, viêm amidan, viêm tai giữa, VA Nhiễm khuẩn hấp bao gồm: viêm khí phế quản, viêm phổi Phần lớn nhiễm khuẩn đường ... nhiễm bệnh viêm đường hấp trở lại Chính vậy, để giúp trẻ có tảng sức khoẻ tốt thời kỳ trẻ tự tạo hệ miễn dịch cho việc cần thiết bậc cha mẹ giúp trẻ phòng ngừa nâng cao khả miễn dịch bệnh nhiễm ... khó khăn trẻ việc đối phó với bệnh nhiễm khuẩn đường hấp cấp Có nhiều yếu tố nguy góp phần gia tăng tỷ lệ trẻ em bị nhiễm khuẩn đường hấp cấp Trẻ em sinh nhẹ cân, sinh non, trẻ không nuôi...
  • 5
  • 185
  • 0

Nghiên cứu đặc điểm lâm sàng, dịch tễ học, phương pháp chẩn đoán sớm, phác đồ điều trị hiệu quả và dự phòng bệnh viêm đường hấp cấp do vi rút cúm A1H1N1, vi rút cúm A và vi rút hợp bào hấp ở Việt Nam

Nghiên cứu đặc điểm lâm sàng, dịch tễ học, phương pháp chẩn đoán sớm, phác đồ điều trị hiệu quả và dự phòng bệnh viêm đường hô hấp cấp do vi rút cúm A1H1N1, vi rút cúm A và vi rút hợp bào hô hấp ở Việt Nam
... Nớc Nghiên cứu đặc điểm lâm sàng, dịch tễ học, phơng pháp chẩn đoán sớm, phác đồ điều trị hiệu dự phòng bệnh vi m đờng hấp cấp vi rút H5N1, vi rút cúm A vi rút hợp bào hấp Vi t Nam Đề tài ... biện pháp phòng chống bệnh vi m đờng hấp cấp vi rút cúm H5N1, vi rút cúm A vi rút hợp bào hấp Phần A: Vi m đờng hấp cấp vi rút cúm a v vi rút cúm a/ h5n1 Chơng Tổng quan 1.1 Khái niệm cúm ... PCR (bp) mồi NP_F NP_R 69 ggaattcatggcgtctcaaggcaccaaa 71 tcccccgggtcaattgtcatattcctctgc N1_F GGAATTCATGAATCCAAATCAGAAGATAATAACCATT N1_R TCCCCCGGGCTACTTGTCAATGGTGAAT 1573 Thành phần phản ứng...
  • 272
  • 396
  • 2


... LUẬN sinh trùng co thể ảnh hường lên hệ thống hấp qua hai chế: (1) Tổn thuơng học gây sư diện sinh trùng (2) Do đáp ứng miễn dịch thể sinh trùng hay thành phần sinh trùng[ 4] Biểu đường ... lâm sàng minh họa cho vấn đề nhiễm sinh trùng nội tạng trẻ em Trường hợp Bệnh nhân nam 11tuổi, nhà Quận TP HCM, đến khám bệnh : ho máu Bệnh sử ngày không sốt , sáng ngủ dậy sau đánh thấy ... có hiệu điều trị tổn thương phổi nhiễm sinh trùng kể Cần giáo dục cộng đồng cách lan truyền bệnh, mối nguy hại bệnh , cách phòng tránh nhiễm sinh trùng ...
  • 9
  • 304
  • 0

tỷ lệ hiện mắc và các yếu tố liên quan đến bệnh viêm đường hấp tại Hà Nội

tỷ lệ hiện mắc và các yếu tố liên quan đến bệnh viêm đường hô hấp tại Hà Nội
... đònh tỷ lệ mắc, mô tả đặc điểm yếu tố nguy cơ, đường lây truyền liên quan đến bệnh viêm đường hấp cấp trẻ em trung tâm bảo trợ trẻ em số 4, Ba Vì, Nội Tìm hiểu mối liên quan yếu tố nguy ... côi đến khám nhập viện Bệnh viện Nhi Trung ương Các em có biểu tình trạng bệnh viêm đường hấp cấp mức độ nặng, sau số trẻ tử vong Liệu yếu tố nguy liên quan đến bệnh viêm đường hấp ... lệ mắc đặc điểm yếu tố nguy liên quan đến bệnh VĐHH cấp -Tỷ lệ mắc (prevalence) bệnh VĐHH cấp trẻ em Trung tâm bảo trợ trẻ em số 4, Ba Vì, Nội 20/45 (44,4%) Tỷ lệ hoàn toàn không cao số liệu...
  • 5
  • 177
  • 0

Nghiên cứu thực trạng và thử nghiệm điều trị bệnh viêm đường hấp trên một số giống chó được sử dụng làm chó nghiệp vụ

Nghiên cứu thực trạng và thử nghiệm điều trị bệnh viêm đường hô hấp trên một số giống chó được sử dụng làm chó nghiệp vụ
... c b nh viêm ñư ng h p chó theo l a tu i 4.2 T l m c th viêm ñư ng h p 4.3 T l b nh viêm ñư ng h p 4.4 : Thân nhi t c a chó chó theo l a tu i gi ng chó 44 55 T n s h p c a chó nghi ... i m c ñích góp ph n làm gi m thi t h i b nh viêm ñư ng h p gây chó ñ ng th i b sung vào tài li u nghiên c u b nh viêm ñư ng h p c a chó ti n hành nghiên c u ñ tài: Nghiên c u Trư ng ð ... a chó, làm gi m hi u qu làm vi c ñ c bi t làm m t kh ñánh c a chó nghi p v Chính v n ñ nêu cho th y: vi c nghiên c u tìm nguyên nhân bi n pháp phòng tr b nh viêm ñư ng h p c a chó vi c làm...
  • 77
  • 437
  • 1

Luận văn nghiên cứu sự biến đổi một số chỉ tiêu lâm sàng, phi lâm sàng, vi khuẩn học và thử nghiêm điều trị bệnh viêm đường hấp của chó nghiệp vụ

Luận văn nghiên cứu sự biến đổi một số chỉ tiêu lâm sàng, phi lâm sàng, vi khuẩn học và thử nghiêm điều trị bệnh viêm đường hô hấp của chó nghiệp vụ
... đại học nông nghiệp I - Hà nội phạm văn khuông nghiên cứu biến đổi số tiêu lâm sàng, phi lâm sàng, vi khuẩn học thử nghiệm điều trị bệnh vi m đờng hấp chó nghiệp vụ Luận văn thạc sĩ nông nghiệp ... vi m đờng hấp gây đàn chó nghiệp vụ đồng thời bổ sung vào tài liệu nghiên cứu chó nghiệp vụ tiến hành nghiên cứu đề tài: Nghiên cứu biến đổi số tiêu lâm sàng, phi lâm sàng, vi khuẩn học thử ... mắc bệnh vi m đờng hấp đàn chó nghiệp vụ 41 4.2 Theo dõi biến đổi số tiêu lâm sàng chó nghiệp vụ mắc bệnh vi m đờng hấp 44 4.3 Kết phân lập vi khuẩn dịch mũi chó bị bệnh vi m đờng hấp...
  • 120
  • 365
  • 1

Bệnh viêm đường hấp mãn tính ở gà pot

Bệnh viêm đường hô hấp mãn tính ở gà pot
... lấm - Bệnh tích Mặt sưng, thủy thủng, viêm mắt, phù đầu Hình 1: bị sưng mặt Hình 2: bệnh bị viêm mắt tiết dịch - Khi bệnh cấp tính: Xoang mũi viêm lồi lên, khí quản tích nhiều dịch viêm ... cho bệnh CRD bệnh hấp khác phát triển - Khi nhập đàn vào nên có thời gian cách ly (trung bình 21 ngày) Mặt khác nên thường xuyên tiến hành kiểm tra máu đàn giống để loại thải dương tính ... màng bao phúc mạc tăng sinh trắng đục viêm dính vào tim, gan, ruột Phôi chết trước nở túi khí phôi có chất dịch nhày bã đậu màu trắng Hình 5: Viêm màng bao tim, viêm màng bao phúc mạc tăng sinh trắng...
  • 4
  • 277
  • 1

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập