Diarrhea is a Major killer of Children with Severe Acute Malnutrition Admitted to Inpatient Setup in Lusaka, Zambia

... Diarrhea is a Major killer of Children with Severe Acute Malnutrition Admitted to Inpatient Set-up in Lusaka, Zambia Abel H Irena‡¹, Mwate Mwambazi², Veronica Mulenga² ¹Valid International, ... Diarrhea is a major cause of complication in children with severe acute malnutrition admitted to the inpatient unit Under the current standard management approach, diarrhea in children with SAM was ... Mortality of children with Severe Acute Malnutrition (SAM) in inpatient set-ups in sub-Saharan Africa still remains unacceptably high We investigated the prevalence and effect of diarrhea and HIV infection...

Báo cáo y học: "Cost effectiveness of community-based therapeutic care for children with severe acute malnutrition in Zambia: decision tree model" pptx

... ambulatory treatment of severe acute malnutrition in a developing country [13] That trial, with 437 children in Bangladesh in 1990 and 1991, showed that inpatient care cost $156 per child, day care ... alternative of providing no treatment [15] Household and societal costs of illness and care were beyond the scope of this study Decision tree The structure of the decision tree is shown in Figure ... probability that the intervention was cost effective for a range of values that society might be willing to pay to obtain one unit of effect (that is, dollars per life saved or per DALY gained) Finally,...

Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

... phosphatase This reverses the inhibition of synthase phosphatase by phosphorylase a There is a long-standing debate as to whether inactivation of phosphorylase is a component of the mechanism by which ... dephosphorylation of phosphorylase a [16], that inactivation of GSK-3 in the absence of phosphorylase inactivation is a small component of the mechanism by which insulin stimulates hepatocyte glycogen synthesis ... inactivation of phosphorylase is an essential component of the mechanism by which insulin stimulates glycogen synthesis and it can account for the stimulation of glycogen synthesis by insulin over a...

Báo cáo y học: "Atherogenic lipid profile is a feature characteristic of patients with early rheumatoid arthritis: effect of early treatment – a prospective, controlled study" pps

... Survival in rheumatoid arthritis: a population-based analysis of trends over 40 years Arthritis Rheum 2003, 48:54-58 Isomaki HA, Mutru O, Koota K: Death rate and causes of death in patients with rheumatoid ... in a fluorescence spectrometer at an excitation wavelength of 465 nm and emission wavelength of 535 nm [29] Statistical analysis All data were analyzed with the STATISTICA 5.1 program Comparisons ... Sundqvist KG, Lefvert AK, Rantapaa-Dahlqvist S: Activation of the immune system and inflammatory activity in relation to markers of atherothrombotic disease and atherosclerosis in rheumatoid arthritis...

Báo cáo y học: "Sepsis is a major determinant of outcome in critically ill HIV/AIDS patients." pdf

... survival of critically ill HIV/AIDS patients In this study, we prospectively followed up HIV/AIDS critically ill patients to evaluate the key factors related to outcome, with emphasis on impact of ... sepsis is the main risk factor for hospital mortality in a cohort of HIV/AIDS critically ill patients Sepsis-related mortality was increased in both shortand longer-term follow-up Indeed, sepsis ... development of organ dysfunctions was analyzed as a possible contribution to hospital mortality In our study, cardiovascular and respiratory dysfunctions increased the hazards of death, especially in...

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG...

báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf

... were associated with survival of severe sepsis when analyzed separately as well as analyzed as a haplotype Especially in the sub group of patients ≤60 years old and in patients with non-abdominal ... 0.052 Data are presented as mean and range of values death due to severe sepsis compared to patients without allele CATT7 The concomitance of the -173 allele C and the -794 allele CATT7 as a haplotype ... functional In the sepsis patient sub groups female and male patients as well as patients with age ≤60 years and in patients with non-pulmonary or non-abdominal focus the haplotype was associated with...

báo cáo hóa học: " A psychometric evaluation of the PedsQL™ Family Impact Module in parents of children with sickle cell disease" pptx

... determining discriminant validity of the PedsQL™ Family Impact Module in our population of children with sickle cell disease, we collected data on the disease status of the children with sickle cell ... and reliable measure for assessing the impact of SCD on parents and families We therefore analyzed the following properties of the PedsQL™ Family Impact Module within our population of parents, ... This was assessed using Cronbach's alpha for each of the subscales of the PedsQL™ Family Impact Module as well as for the summary and total scores A Cronbach's alpha coefficient of greater than...

báo cáo hóa học: " A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis" pdf

... this article as: Sakkalis et al., A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis Journal of NeuroEngineering and Rehabilitation 2010, ... bivariate measures that can be treated similarly to the ones in the univariate case Once the additional synchronization features are calculated they are fed to the classifier to discriminate ... achieved) and the Beta band over the frontal lobe For the Gamma bands, WT also obtained relatively stable scores over the parietal and occipital brain areas, but as shown in the topographic maps earlier,...

Báo cáo y học: "Natural killer cell dysfunction is a distinguishing feature of systemic onset juvenile rheumatoid arthritis and macrophage activation syndrome" pot

... carried out sample collection, flow cytometry, data analysis and manuscript preparation SL carried out NK cytotoxicity assays and manuscript preparation EHG carried out statistical analysis and ... manuscript preparation TBG carried out patient referral, clinical data analysis and manuscript preparation MHP carried out patient referral, clinical data analysis and manuscript preparation AF ... Grom AA, Passo M: Macrophage activation syndrome in systemic juvenile rheumatoid arthritis J Pediatr 1996, 129:630-632 10 Sawney S, Woo P, Murray K: Macrophage activation syndrome: a potentially...

Báo cáo y học: "The spliceosomal autoantigen heterogeneous nuclear ribonucleoprotein A2 (hnRNP-A2) is a major T cell autoantigen in patients with systemic lupus erythematosus" potx

... hnRNP -A2 in patients with RA [27] We observed that approximately half of the RA patients harbor T cells against hnRNP -A2 In accordance with the perception of RA as an inflammatory, Th1 type systemic ... hnRNP -A2 may constitute an important T cell autoantigen in patients with SLE, indicating a potential role for it in the pathogenesis of this disorder Materials and methods Patients and controls Peripheral ... investigated spontaneous T cell responses to hnRNP -A2 in patients with SLE and in healthy control subjects and characterized TCCs specific for this antigen The data obtained suggest that hnRNP -A2 ...

báo cáo khoa học: "Down-regulation of UHRF1, associated with re-expression of tumor suppressor genes, is a common feature of natural compounds exhibiting anti-cancer properties" pot

... mark, emphases the possibility that numerous other natural compounds can take the same pathways leading to apoptosis apoptosis in colorectal cancer by activation of p53 and p73 which are negative ... carcinoma cells Anticancer Drugs 2003, 14:193-202 103 Yagi Y, Fushida S, Harada S, Kinoshita J, Makino I, Oyama K, Tajima H, Fujita H, Takamura H, Ninomiya I, Fujimura T, Ohta T, Yashiro M, Hirakawa ... re-expression of tumor suppressor genes, is a common feature of natural compounds exhibiting anti-cancer properties Journal of Experimental & Clinical Cancer Research 2011 30:41 Submit your next manuscript...

Báo cáo y học: " A modelled economic evaluation comparing atomoxetine with methylphenidate in the treatment of children with attention-deficit/hyperactivity disorder in Spain" pot

... the Spanish context The economic evaluation employed a cost-utility analysis to calculate the incremental cost per quality-adjusted lifeyear (QALY) gained by atomoxetine compared with the treatment ... associated with atomoxetine treatment and thereby a greater number of QALYs overall in the context of the economic evaluation Overall, the incremental costs per QALYs gained of atomoxetine were between ... However, any omissions due to the shorter timeframe are likely to be again conservative in that they bias the model generally against the active therapies and more specifically against atomoxetine...

Báo cáo y học: " Echoviruses are a major cause of aseptic meningitis in infants and young children in Kuwait" ppsx

... Echoviruses are a major cause of aseptic meningitis in infants and young children in Kuwait Virology Journal 2010 7:236 Page of Submit your next manuscript to BioMed Central and take full advantage of: ... 33 in Ulaanbaatar and Tov province, Mongolia, intrafamilial spread, and risk factors for infection Epidemiol Infect 2005, 133:1131-1142 Dalwai A, Ahmad S, Pacsa A, Al-Nakib W: Echovirus is an ... in the Arabian Gulf region of the Middle East This 3-year study was carried out to determine the role and type of EVs causing AM cases in Kuwait, an Arabian Gulf country in the Middle East, and...

Báo cáo y học: "Timing of adequate antibiotic therapy is a greater determinant of outcome than are TNF and IL-10 polymorphisms in patients with sepsis." potx

... from this analysis) The rate of impairment in inflammatory response was significantly greater in patients with inadequate empirical antibiotic therapy than in patients with adequate empirical antibiotic ... determine the concentrations of proinflammatory and anti-inflammatory cytokines, and may influence whether patients have a marked hyper-inflammatory or antiinflammatory response to infection A delicate ... Predictors of 90-day mortality Only 222 patients could be evaluated for 90-day mortality Mortality rate was 25.7% Multivariate analysis of risk factors for 90-day mortality was identical to the analysis...

Xem thêm

Từ khóa: plane is a qrs axis of 120deg compatible with a diagnosis of left anterior hemiblock lahb a house of cards is an obvious example of something with low maintainability difficulties needs within a population of children with fasd internal shadow banking sub system the external shadow banking sub system is a global network of balance sheets with the origination warehousing and securitization of loans conducted mainly from the u s and the funding and matu a complete list of materials with catalogue numbers is available upon request a the proportion of patients with systemic embolism or total stroke b major bleeding c minor bleeding and d any bleeding event recorded during the 12 month follow up period without window present and the right photograph is a close up of the solid sample holder with polymer sample present the balance of payments is a periodic statement of the which of the following is a correct statement of the second law of thermodynamics which of the following is a correct statement of newtons second law of motion the theory of evolution by natural selection is a good example of how science proceeds a diamond is a crystalline form of carbon is it an organic compound a diamond is a crystalline form of carbon is it organic what is a distributed denial of service ddos attack what is a distributed denial of service attack and how does it work Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP